HBVdb

Dataset for nucleotide sequence P of genotype RF

[Download (right click)] [Edit] [Sequences] [Repertoires]

928 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


FN594767_P_P-RF-DE      atgcccctatcttatcaacacttccggagaatactgttgttagac-----
GQ161806_P_P-RF-EA      atgcccctatcttatcaacacttccggaractactgttgttagac-----
KJ717794_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803788_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF053179_P_P-RF-BC      atgcccctatcttatcaacacttccggagactactgttattagag-----
KJ803772_P_P-RF-BC      atgcccctatcttatcaacacttccggagactactgttattagag-----
KF873530_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873537_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679945_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873540_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873538_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873543_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873542_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873535_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679939_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679940_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679952_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttrttagac-----
KF873534_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873531_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873532_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873533_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873521_P_P-RF-BC      atgcccctatcttatccacacttccggagactactgttgttagac-----
KU679955_P_P-RF-CB      atgcccctatcttatccacacttccggaaactactgttgttagac-----
KU679950_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679944_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679953_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679948_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873519_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679946_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873517_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873518_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873511_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873513_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873515_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679954_P_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KU679942_P_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KU679943_P_P-RF-BC      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KF873527_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679956_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679958_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873522_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873523_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873524_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679941_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF053166_P_P-RF-BC      atgcccctatcttatccacacttcctgagacttctgttgttagag-----
KJ803827_P_P-RF-BC      atgcccctatcttatccacacttcctgagacttctgttgttagag-----
FR714496_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826145_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MH746813_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MH746811_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MH746812_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MH368022_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagat-----
FR714490_P_P-RF-GB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC172106_P_P-RF-GB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY470996_P_P-RF-GC      atgcccctatcttatcaacaatttcggaaactactgttgttagac-----
KY471004_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY470998_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY471001_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY471007_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY470997_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY470999_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
KY471000_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
KY471002_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
KY471003_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY471006_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY471005_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP148441_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP148449_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP148447_P_P-RF-GC      atgcccctatcttatcaacaattccggaaactactgttgttagac-----
KP148586_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP148442_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP148450_P_P-RF-GC      atgcccctatcttatcaacaattccggaaactactgttgttagac-----
FJ023659_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023662_P_P-RF-GC      atgcccctatcttatcaacaattccggaaactactgttgttagac-----
EU835240_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023666_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023670_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ882611_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagat-----
EU833891_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ882610_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ882614_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ882617_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagat-----
FJ882612_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagat-----
FJ882618_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagat-----
FJ882613_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023665_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
FJ023667_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023673_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023664_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023668_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB241109_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ361772_P_P-RF-GC      atgcccctatcttatccacacttccggaaactactgttgttagac-----
HQ700519_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700521_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803822_P_P-RF-CB      atgcccctatcttatcaatgcttccggaaactgctgttgttagac-----
KF053186_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803778_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660686_P_P-RF-DC      atgcccttatcttatcaacacttccggaaactactgttgttagac-----
DQ478890_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660684_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttggtagac-----
AY057948_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KT991427_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
FJ562263_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KT991424_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
AY817511_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660689_P_P-RF-DC      atgcccctgtcttatcaagacttccggaaactactgttgttagac-----
HM750144_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750150_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774485_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP276253_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750146_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP276256_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750145_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX354997_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750148_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750147_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750143_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750149_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ349241_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774456_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750142_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774482_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774461_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY470853_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470844_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470843_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470846_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470847_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470849_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470850_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470855_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470854_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KX660685_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774475_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774433_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774431_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
KY629632_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774498_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KT991421_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KT991419_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KT991420_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KT991423_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562278_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KT991417_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB270535_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774486_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774453_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY670781_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774454_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
DQ478898_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU787435_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774492_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY800249_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774422_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774483_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774458_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU787434_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774420_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774426_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774474_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY817515_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774457_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774447_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774495_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY817512_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774490_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
DQ478886_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774425_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774428_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY862866_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY862864_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY862865_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF491455_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774481_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF491451_P_P-RF-DC      atgcccctatcttatccacacttccggaaactactgttgttagac-----
KC774478_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774480_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660674_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660680_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774476_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774439_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774449_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774470_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF491449_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774484_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774452_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774442_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774443_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774435_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774455_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660677_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774479_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660675_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774448_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774430_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
KF917451_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgctagac-----
KC774466_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774488_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KC774493_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KU519422_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY817513_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774487_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY817509_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF491448_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY817510_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU519423_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774499_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774489_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774432_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774434_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX429898_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP276254_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP276255_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF491456_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774424_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
DQ478889_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
DQ478887_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
DQ478892_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774468_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
DQ478897_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774423_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774471_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774497_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774494_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774463_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774472_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826150_P_P-RF-BC      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MG826151_P_P-RF-BC      atgcccctatcgtatcaacacttccggaaactactgttgttagac-----
HQ700520_P_P-RF-CB      atgcccctatcttatcaacacttccggagactactgttattagac-----
AB105172_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AP011102_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB493842_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AP011103_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB493838_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB493847_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB493840_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB493837_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ358155_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ358156_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700518_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700527_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700528_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700530_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700523_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700531_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700532_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF925389_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386674_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU660227_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826147_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826141_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826142_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826148_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ598675_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
MG826146_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KT003704_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP148352_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AP011104_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AP011105_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
LC416040_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB031265_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ717832_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803804_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB674504_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803798_P_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JF436923_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803785_P_P-RF-CB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ410506_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF925382_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactgctgttattagac-----
MF925370_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF925381_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
GQ924618_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ027310_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377595_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU882006_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC315400_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ684848_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK052976_P_P-RF-BD      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK052967_P_P-RF-BD      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK052970_P_P-RF-BD      atgcccctatcttatcaacacttccgaaaactactgttgttagac-----
MK052968_P_P-RF-BD      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ801477_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MH094410_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774414_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939627_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ410497_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ717800_P_P-RF-CB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ803791_P_P-RF-CB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ717816_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF053188_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
KJ803782_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
KJ717815_P_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KJ803803_P_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KJ717814_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803802_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF053160_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803753_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377592_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagag-----
EU939623_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
GQ377556_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939630_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939620_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377539_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562229_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377594_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377602_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562247_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377626_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377565_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377634_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939621_P_P-RF-CB      atgcccctatcttatcaacgcttccggaaactactgttgttagac-----
FJ562328_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377573_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377613_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ040174_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377604_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377590_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377549_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377564_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactacagttgttagac-----
GQ377596_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377614_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700542_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939631_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939629_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377635_P_P-RF-BC      atgcccctatcttatcaacgcttccggaaactactgttgttagac-----
GQ377630_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774178_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774364_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC793112_P_P-RF-BC      --------------------------------------------------
KP148337_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173279_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173358_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173349_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173350_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173320_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173322_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386646_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826149_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700526_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
X75656_P_P-RF-CB        atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700580_P_P-RF-CB      atgcccctatcttatcaacgcttccggagactactgttattagac-----
HQ700498_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700499_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU695745_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700554_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
HQ700560_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700557_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700462_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700485_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AP011108_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU695746_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700505_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU695744_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU695741_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU695743_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700509_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700515_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700507_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700508_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU522070_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU695742_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ684849_P_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774198_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774201_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774307_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774323_P_P-RF-CB      atgcccctatcttatcatcacttcgggaaactactgtggactcac-----
KC774193_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774291_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY206374_P_P-RF-CB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ377560_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB033557_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700547_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX504540_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826144_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF436919_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX096713_P_P-RF-CA      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562317_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactattgttagac-----
EU589337_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ032343_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KC774246_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ040175_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ475335_P_P-RF-CB      atgcccctatcttatcaacacttccggaaattactgttgttagac-----
EU881995_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ032337_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EF494376_P_P-RF-CA      atgcccctatcttatcaacacttctggaaactactgttgttagac-----
AB300369_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562294_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939547_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactattgttagac-----
JQ040148_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX661485_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ040142_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX661486_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG893554_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG893555_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KR013843_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377522_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB367800_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY247030_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ732168_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY040627_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB049609_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB367400_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB642096_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB367419_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB205152_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY123041_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AF330110_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF828935_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF828936_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF828938_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF828933_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF828934_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562302_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
Y18857_P_P-RF-CB        atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774212_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939668_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU919166_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU919167_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386586_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
DQ089798_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963862_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963868_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963859_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963869_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963856_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963857_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963858_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963861_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963863_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963864_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963865_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963866_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963867_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963870_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963860_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU916239_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU916241_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU916240_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195950_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195951_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939551_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562267_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939577_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
Y18856_P_P-RF-CB        atgcccctctcttatcaacacttccggaaactactgttgttagac-----
JQ040146_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774188_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GU357843_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AF233236_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB367393_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU717211_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JN400086_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AF411409_P_P-RF-CB      atgcccctatcttatcaacacttccggaagctactgttgttagac-----
KJ173329_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562226_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871994_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871995_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871989_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871991_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871992_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871996_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871993_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871984_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871985_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871983_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871999_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871981_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871986_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871990_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871987_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871988_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774324_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774222_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GU385774_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU787444_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB670303_P_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KY363263_P_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KC774344_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX661498_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939606_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386635_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX661487_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY881840_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
M38454_P_P-RF-CB        atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY123424_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871997_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377534_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939565_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377520_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377581_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377607_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939589_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377516_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377544_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
LC279266_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
LC279267_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
LC279265_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
LC279263_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
LC279264_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KM213033_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774258_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195940_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195941_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195939_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195955_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195956_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195957_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562227_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagat-----
FJ562314_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG893559_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386633_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562305_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774305_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774234_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU916232_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964306_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964316_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964313_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964308_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964307_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964303_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964009_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964008_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964007_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964005_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964006_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964010_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964304_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964305_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964309_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964310_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964312_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964314_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964315_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964317_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964311_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AF461361_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386593_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KM875422_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774349_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KU964351_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ410520_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB198084_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750133_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY167095_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774263_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774332_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774341_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173299_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173300_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KR013806_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF436922_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377611_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX429896_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX661494_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963883_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KR013816_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377548_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386649_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386578_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386585_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377633_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774328_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX026887_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774317_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774322_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562287_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963993_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963991_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963990_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963994_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963995_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963998_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963999_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964001_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964003_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173325_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173326_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774230_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774183_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774186_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK321265_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK720627_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK720628_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG893561_P_P-RF-CB      atgcccctatcttatcaacacttcggaaaactactgttgttagac-----
LC458432_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ787446_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ787480_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386581_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774294_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY470893_P_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ586803_P_P-RF-AF      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ586810_P_P-RF-AF      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EF494378_P_P-RF-CA      atgcccctatcttatcaatacttccggaaactactgttattagac-----
JQ801476_P_P-RF-CG      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HE981179_P_P-RF-FG      atgcccctatcctatccacacttccggaaactactgttgttagac-----
FJ562223_P_P-RF-CD      atgcccctatcttatcatcacttccggaaattactgttgttagac-----
GQ377627_P_P-RF-CD      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF488705_P_P-RF-AD      atgcccctatcttatcaacacttccggaaactactgttattagac-----
AY233277_P_P-RF-AC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF214656_P_P-RF-AC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM146131_P_P-RF-AD      atgccactatcttatcaacacttccggaaactactgttgttagac-----
AY161145_P_P-RF-AD      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AY161146_P_P-RF-AD      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF925404_P_P-RF-AC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY161140_P_P-RF-AD      atgcccctatcttatcaacacttccggagactactgttgttagat-----
AY161141_P_P-RF-AD      atgcccctatcttatcaacacttccggagactactgttgttagat-----
AB194949_P_P-RF-AE      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ331048_P_P-RF-AE      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ161753_P_P-RF-AE      atgcccctatcttatcaacacttccggagaatactgttgttagac-----
GQ161767_P_P-RF-AE      atgcccctatcttatcaacacttccggagaatactgttgttagac-----
GQ161837_P_P-RF-AE      atgcccctatcttatcaacacttccggagaatactgttgttagac-----
HF571060_P_P-RF-AE      atgcccctatcttatcaacacttccggagaatactgttgttagac-----
AY236161_P_P-RF-DA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
X65259_P_P-RF-DA        atgcccctatcctatcaacacttccggagactactgttgttacac-----
X68292_P_P-RF-DA        atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF488699_P_P-RF-DE      atgcccctatcttatcaacacttcctgagacttgtgttgataaag-----
JN664929_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AB033558_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN664933_P_P-RF-DA      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
JN664925_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KC875338_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KC875339_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN664915_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ205378_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ205377_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ205387_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ205386_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ205379_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagaa-----
MK516279_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MK516280_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MK541689_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN664934_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttgttagac-----
JN664940_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
DQ315779_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KT366505_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MH685719_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU736916_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357641_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttcttagac-----
KU736917_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU736914_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU736915_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KP168420_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KP168421_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
FJ904397_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904442_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904436_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
AM494716_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GU177079_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904405_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttattagac-----
FJ904437_P_P-RF-DE      atgcccctatcttatcaacaattccggagacttgtgttgttagac-----
FJ904416_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttgttagac-----
FJ904417_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttgttagac-----
FJ904398_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttgttagac-----
KP288875_P_P-RF-DE      atgcccctatcttatcaatacttccggagactactgttgttagac-----
FJ904430_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttattagac-----
FJ904414_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttcttagac-----
FJ904444_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttattagac-----
FJ904396_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904403_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904401_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904404_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttgttagac-----
FJ904408_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
FJ904409_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904394_P_P-RF-DE      atgcccctatcttatcaacacttccggagmctactgttgttagac-----
FJ904407_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904447_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttgttagac-----
KF170740_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KP168416_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU736923_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357627_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357631_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357628_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357632_P_P-RF-DE      atgcccctatcttatcaacacttccggagactgctgttgttagac-----
KX357626_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagag-----
KX357624_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357625_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357629_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357634_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357630_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357633_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357623_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357635_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357636_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KP168417_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KP168418_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU736921_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU736922_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU711666_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ349207_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904425_P_P-RF-DE      atgcccctatcttatcaacacttccggagattactgttgttagac-----
FJ904441_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904400_P_P-RF-DE      atgcccctatcttatcaatccttccggagactactgttgttagac-----
FJ904406_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
FJ904440_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX827299_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM606741_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KP995112_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM606750_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM606751_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FN594770_P_P-RF-DE      atgcccctatcctatcaacacttccggagaatactgttgttagac-----
FN594771_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FN594769_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
GQ161754_P_P-RF-DE      atgcccctatcctatcaacacttccggagaatactgttgttagac-----
KU668440_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttgttagac-----
KJ470898_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttattagac-----
KJ470892_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470897_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
KJ470891_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470887_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470888_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470890_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470884_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470886_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF618346_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF618347_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192835_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192840_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192841_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192833_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192836_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192837_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192838_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192839_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ692536_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
KF779353_P_P-RF-DA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700494_P_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttattagac-----
AB048702_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
AB048703_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
HQ700492_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH481860_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH481859_P_P-RF-DE      acgcccctatcctatcaacacttccggagactactgttgctagac-----
MH481862_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH481858_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH481861_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700493_P_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttgttagac-----
HQ700579_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700585_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700536_P_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttgttagac-----
HQ700537_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700540_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700503_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700534_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700533_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700584_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700541_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700535_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700500_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB033559_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700524_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700525_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700538_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700497_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700501_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700582_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700581_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700583_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JN664935_P_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ647351_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
KJ647356_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF925360_P_P-RF-DB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
EF103282_P_P-RF-AD      atgcccctatcttatcaacacttccggagactactgttgttagac-----
EF103283_P_P-RF-AD      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF925402_P_P-RF-BD      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN257154_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttattagac-----
JN040803_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttattagac-----
JN642160_P_P-RF-DE      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JN688717_P_P-RF-DE      atgcccctatcttatcaactcttccggagactactgttgttagac-----
JN257204_P_P-RF-DE      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY341335_P_P-RF-DE      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803771_P_P-RF-DB      atgcccctatcttatcaacgcttccggagactactgttattagat-----
EU594406_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttgttagac-----
MF925396_P_P-RF-DC      atgcccctatcttatcaatacttccggagacttctgttgttagac-----
JQ687532_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
X80925_P_P-RF-DE        atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF925401_P_P-RF-DB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF925371_P_P-RF-DC      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF925388_P_P-RF-DC      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN664946_P_P-RF-DA      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
MF925392_P_P-RF-DB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM524357_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KR905422_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KT366503_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AB330368_P_P-RF-DA      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF471643_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttgttagac-----
MF925397_P_P-RF-DC      atgcccctatcttatcaacacttccggagactgctgttgttagac-----
MF925384_P_P-RF-DB      atgcccctatcttatcaacacttccggagacttctgttgttagac-----
JF754613_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttattagac-----
AB674436_P_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttgttagac-----
JN040798_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN257191_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN642137_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
JN642141_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN642152_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AB674432_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JF754616_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AB674433_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN257189_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN642127_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagag-----
JN257206_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN257216_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN257174_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN257210_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN257164_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN642139_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MK052957_P_P-RF-DE      atgcccctatcttatcaacacttccggagattgctgttgttagag-----
MK052969_P_P-RF-DE      atgcccctatcttatcaacacttccggagattgctgttgttagag-----
JN688715_P_P-RF-DE      atgcccctatcctatcaatccttccggagactactgttgttagac-----
DQ464164_P_P-RF-DE      atgcccctatcctatccacacttccggagactactgttgttagac-----
DQ464167_P_P-RF-DE      atgcccctatcctatccacacttccggagactactgttgttagac-----
DQ464165_P_P-RF-DE      atgcccctatcctatccacacttccggagactactgttgttagac-----
DQ464166_P_P-RF-DE      atgcccctatcctatccacacttccggagactactgttgttagac-----
KJ586811_P_P-RF-DF      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JN688689_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB270538_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KC774450_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
EF103284_P_P-RF-AD      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB188243_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
KJ647349_P_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttattagac-----
JF440017_P_P-RF-DA      atgcccctatcttatcaacacttcctcaaactactgttgttagac-----
MH724239_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagag-----
KM359442_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttattagac-----
KM386676_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
KM577666_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
MN507835_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF488702_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF679991_P_P-RF-DE      atgcccctatcttatcaacacttccggagtgtactgttgttagac-----
JN664943_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ183486_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AB188245_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MK598656_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MK598654_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MK598652_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MK598653_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
KT366504_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
EF103285_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM577667_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AB583679_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MN507850_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM577665_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM577663_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM577664_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KT366492_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AY373430_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM524359_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AJ627217_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
EU594435_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MK618439_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
DQ111987_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
EU594436_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ349221_P_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttgttagac-----
KX827302_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH464835_P_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttgttagac-----
MH724243_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
EU185780_P_P-RF-AD      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KC012653_P_P-RF-AD      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MH724222_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AJ627221_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttattagac-----
FJ349212_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttattagac-----
JF440013_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440012_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440008_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440011_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440004_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440005_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440001_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgcgttgttagac-----
JF439999_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440010_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440006_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440002_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440003_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440000_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF439998_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF439995_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF439994_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440009_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440007_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440015_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF439996_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440014_P_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
MK618440_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MK618438_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MK618444_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MK618442_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MK618445_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
AB210819_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898698_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898699_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
AJ344117_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898690_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MF967563_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
U95551_P_P-RF-DE        atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898686_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898687_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898688_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898693_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898695_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898696_P_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MH724240_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AY233293_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
GU563560_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH464850_P_P-RF-DA      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY233295_P_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MH464851_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH464846_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH464852_P_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
KX765835_P_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KF219922_P_P-RF-GH      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB222708_P_P-RF-AD      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ272886_P_P-RF-GF      atgcccctatcttatccacacttccggaaactactgttgttagac-----
JQ272887_P_P-RF-GF      atgcccctatcttatccacacttccggaaactactgttgttagac-----
EF464099_P_P-RF-AG      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HE981180_P_P-RF-GF      atgcccctatcctatccacacttccggaaactactgttgttagac-----
KP274926_P_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB933279_P_P-RF-AG      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB933280_P_P-RF-AG      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB933281_P_P-RF-AG      atgcccctatcctatcaacacttccggagactactgttgttagac-----
EU833890_P_P-RF-GA      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AF297619_P_P-RF-DA      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AF297620_P_P-RF-DA      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ707426_P_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JF439776_P_P-RF-AG      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF925386_P_P-RF-AC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB453985_P_P-RF-AC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB933282_P_P-RF-AG      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB933283_P_P-RF-AG      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF440021_P_P-RF-AG      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF440019_P_P-RF-AG      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JF440022_P_P-RF-AG      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
                                                                          

FN594767_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ161806_P_P-RF-EA      -ga------m------gag------gcaggtcccctagaagaagaactcc
KJ717794_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803788_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF053179_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803772_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873530_P_P-RF-CB      -aa------c------gag------gcaggacccctagaagaagaactcc
KF873537_P_P-RF-CB      -ga------m------gag------gcaggtcccctagaagaagaactcc
KU679945_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KF873540_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KF873538_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KF873543_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KF873542_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KF873535_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679939_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679940_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679952_P_P-RF-CB      -aa------c------gag------gcaggwccyctaraagaagaactcc
KF873534_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873531_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873532_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873533_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873521_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679955_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679950_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679944_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679953_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679948_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873519_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679946_P_P-RF-BC      -ga------c------gag------gcaggtcccctaraagaagaactcc
KF873517_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873518_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873511_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873513_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873515_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679954_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaaraagaactcc
KU679942_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679943_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873527_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679956_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679958_P_P-RF-CB      -aa------c------gag------gcaggtccactagaagaagaactcc
KF873522_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873523_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873524_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679941_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF053166_P_P-RF-BC      -ca------c------gga------gcaggacccctagaagaagaactcc
KJ803827_P_P-RF-BC      -ca------c------gga------gcaggacccctagaagaagaactcc
FR714496_P_P-RF-CB      -ga------c------gag------gcaggacccctagaagaagaactcc
MG826145_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaaaaagaactcc
MH746813_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaaaaagaactcc
MH746811_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH746812_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH368022_P_P-RF-GC      -gt------c------gag------gcaggtcccctagaagaagaactcc
FR714490_P_P-RF-GB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC172106_P_P-RF-GB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470996_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471004_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470998_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471001_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471007_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470997_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470999_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471000_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471002_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471003_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471006_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471005_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148441_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148449_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148447_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148586_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148442_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148450_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023659_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023662_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU835240_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023666_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023670_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ882611_P_P-RF-GC      -gc------c------gag------gcaggtcccctagaagaagaactcc
EU833891_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ882610_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ882614_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ882617_P_P-RF-GC      -ca------c------gag------gcaggtcccytagaagaagaactcc
FJ882612_P_P-RF-GC      -ca------c------gag------gcaggtcccttagaagaagaactcc
FJ882618_P_P-RF-GC      -ca------c------gag------gcaggtcccttagaagaagaactcc
FJ882613_P_P-RF-GC      -ca------c------gag------gcaggtcctctagaagaagaactcc
FJ023665_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023667_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023673_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023664_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023668_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB241109_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ361772_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700519_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700521_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803822_P_P-RF-CB      -ga------c------gag------gcaggacccctagaagaagaactcc
KF053186_P_P-RF-BC      -ga------c------gag------gcaggtccactagaagaagaactcc
KJ803778_P_P-RF-BC      -ga------c------gag------gcaggtccactagaagaagaactcc
KX660686_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
DQ478890_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KX660684_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
AY057948_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KT991427_P_P-RF-DC      -ga------c------aat------gcaggtcccctagaagacgaactcc
FJ562263_P_P-RF-DC      -ga------c------aat------gcaggtcccctagaagacgaactcc
KT991424_P_P-RF-DC      -ga------c------aat------gcaggtcccctagaagacgaactcc
AY817511_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KX660689_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750144_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750150_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KC774485_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KP276253_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750146_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KP276256_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750145_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KX354997_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750148_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750147_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750143_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750149_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
FJ349241_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KC774456_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750142_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KC774482_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KC774461_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470853_P_P-RF-DC      -ga------c------gag------gcaggtcacctagaagaagaactcc
KY470844_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470843_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470846_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470847_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470849_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470850_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470855_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470854_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX660685_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774475_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774433_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774431_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY629632_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774498_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT991421_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT991419_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT991420_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT991423_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562278_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT991417_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB270535_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774486_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774453_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY670781_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774454_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ478898_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU787435_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774492_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY800249_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774422_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774483_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774458_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU787434_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774420_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774426_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774474_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY817515_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774457_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774447_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774495_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY817512_P_P-RF-DC      -ga------c------gag------gctggtcccctagaagaagaactcc
KC774490_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ478886_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774425_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774428_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY862866_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY862864_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY862865_P_P-RF-DC      -ga------c------gag------gcaggtcccttagaagaagaactcc
JF491455_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774481_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF491451_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774478_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774480_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX660674_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX660680_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaaytcc
KC774476_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774439_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774449_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774470_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF491449_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774484_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774452_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774442_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774443_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774435_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774455_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX660677_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774479_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX660675_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774448_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774430_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF917451_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774466_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774488_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774493_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU519422_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY817513_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774487_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY817509_P_P-RF-DC      -ga------c------gag------gcaggtcccctagatgaagaactct
JF491448_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY817510_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU519423_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774499_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774489_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774432_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774434_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX429898_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP276254_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP276255_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF491456_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774424_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ478889_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ478887_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ478892_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774468_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ478897_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774423_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774471_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774497_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774494_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774463_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774472_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG826150_P_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MG826151_P_P-RF-BC      -ga------c------gag------gcaggtcccctcgaagaagaactcc
HQ700520_P_P-RF-CB      -aa------c------gag------gcaggtcctctagaagaagaactcc
AB105172_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AP011102_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB493842_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AP011103_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB493838_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB493847_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB493840_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB493837_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ358155_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ358156_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700518_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700527_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700528_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700530_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ700523_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700531_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700532_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925389_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386674_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU660227_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG826147_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
MG826141_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG826142_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
MG826148_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ598675_P_P-RF-CB      -aa------c------gac------gcaggtcccctagaagaagaactcc
MG826146_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KT003704_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148352_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AP011104_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AP011105_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
LC416040_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB031265_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ717832_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803804_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB674504_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803798_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF436923_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ803785_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ410506_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925382_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925370_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925381_P_P-RF-CB      -aa------c------gag------gcaggtcccctagaagaagaactcc
GQ924618_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ027310_P_P-RF-CB      -ga------m------gag------gcaggtcccctagaagaagaactcc
GQ377595_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU882006_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC315400_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ684848_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK052976_P_P-RF-BD      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK052967_P_P-RF-BD      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK052970_P_P-RF-BD      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK052968_P_P-RF-BD      -ga------a------gag------gcaggtcccctagaagaagaactcc
JQ801477_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH094410_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774414_P_P-RF-BC      -ga------a------aag------gcaggtcccctagaagaagaactcc
EU939627_P_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ410497_P_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ717800_P_P-RF-CB      -ga------a------gag------gcaggtcccctggaagaagaactcc
KJ803791_P_P-RF-CB      -ga------a------gag------gcaggtcccctggaagaagaactcc
KJ717816_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF053188_P_P-RF-CB      -ga------a------gat------gcaggtcccctagaagaagaactcc
KJ803782_P_P-RF-CB      -ga------a------gat------gcaggtcccctagaagaagaactcc
KJ717815_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ803803_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ717814_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ803802_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KF053160_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803753_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377592_P_P-RF-CB      -ga------a------ggg------gcaggtcccctagaagaagaactcc
EU939623_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377556_P_P-RF-CB      -ga------a------gga------gcaggtcccctagaagaagaactcc
EU939630_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
EU939620_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377539_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562229_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377594_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377602_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ562247_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377626_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377565_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377634_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
EU939621_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ562328_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377573_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377613_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
JQ040174_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377604_P_P-RF-CB      -aa------a------gat------gcaggcaccctagaagaagaactcc
GQ377590_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377549_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377564_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377596_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377614_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ700542_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939631_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939629_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377635_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377630_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774178_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774364_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC793112_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148337_P_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ173279_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ173358_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ173349_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173350_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173320_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173322_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386646_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG826149_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700526_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
X75656_P_P-RF-CB        -gt------c------gag------gcaggtcccctagaagaagaactcc
HQ700580_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700498_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700499_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU695745_P_P-RF-CB      -aa------c------gag------gcaggtaccctagaagaagaactcc
HQ700554_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700560_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700557_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ700462_P_P-RF-CB      -ga------c------gag------gcaggwcccctagaagaagaactcc
HQ700485_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AP011108_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU695746_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ700505_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU695744_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU695741_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU695743_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700509_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ700515_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ700507_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ700508_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
EU522070_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU695742_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ684849_P_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774198_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774201_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774307_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774323_P_P-RF-CB      -ga------c------gag------gcaggtcccataggcgcgttactcc
KC774193_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774291_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY206374_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377560_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB033557_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700547_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX504540_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG826144_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF436919_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX096713_P_P-RF-CA      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562317_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU589337_P_P-RF-CB      -ac------c------ggg------gcaggacccctagaagaagaactcc
FJ032343_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KC774246_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ040175_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ475335_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU881995_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ032337_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
EF494376_P_P-RF-CA      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
AB300369_P_P-RF-CB      -ga------c------gag------gtaggtcccctagaagaagaactcc
FJ562294_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939547_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ040148_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX661485_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ040142_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX661486_P_P-RF-CB      -ga------c------gag------gcaggacccctagaagaagaactcc
MG893554_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG893555_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KR013843_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377522_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB367800_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY247030_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ732168_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY040627_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB049609_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB367400_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB642096_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB367419_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB205152_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
AY123041_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AF330110_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF828935_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF828936_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF828938_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF828933_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF828934_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562302_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
Y18857_P_P-RF-CB        -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774212_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939668_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU919166_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU919167_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386586_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ089798_P_P-RF-CB      -aa------c------gag------gcaggtcccctagaagaagaactcc
KU963862_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963868_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963859_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963869_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963856_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963857_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963858_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963861_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963863_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963864_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963865_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963866_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963867_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963870_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963860_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU916239_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU916241_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU916240_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195950_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195951_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939551_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562267_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939577_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaataactcc
Y18856_P_P-RF-CB        -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ040146_P_P-RF-CB      -ga------c------gag------gcaggacccctagaagaagaactcc
KC774188_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GU357843_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AF233236_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB367393_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU717211_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN400086_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AF411409_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173329_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562226_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871994_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871995_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871989_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871991_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871992_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871996_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871993_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871984_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871985_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871983_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871999_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871981_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871986_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871990_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871987_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871988_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774324_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774222_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GU385774_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU787444_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB670303_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY363263_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774344_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX661498_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
EU939606_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386635_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX661487_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY881840_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
M38454_P_P-RF-CB        -gannnnnnc------gag------gcaggtcccctagaagaagaactcc
AY123424_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871997_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377534_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939565_P_P-RF-CB      -ga------c------gat------gcaggtcccctagaagaagaactcc
GQ377520_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377581_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377607_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939589_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377516_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377544_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
LC279266_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
LC279267_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
LC279265_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
LC279263_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
LC279264_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM213033_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774258_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195940_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195941_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195939_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195955_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195956_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195957_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562227_P_P-RF-CB      -gt------c------gag------gcaggtccgctagaagaagaactcc
FJ562314_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG893559_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386633_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562305_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774305_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774234_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU916232_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964306_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964316_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964313_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964308_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964307_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964303_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964009_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964008_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964007_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964005_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964006_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964010_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964304_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964305_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964309_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964310_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964312_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964314_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964315_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964317_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964311_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AF461361_P_P-RF-CB      -ga------c------gag------gcaggacccctagaagaagaactcc
FJ386593_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM875422_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774349_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964351_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ410520_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB198084_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HM750133_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY167095_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774263_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774332_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774341_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173299_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173300_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KR013806_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF436922_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377611_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
JX429896_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
JX661494_P_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU963883_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KR013816_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377548_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386649_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386578_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386585_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377633_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774328_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX026887_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774317_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774322_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562287_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963993_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963991_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963990_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963994_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963995_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963998_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963999_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964001_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964003_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173325_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173326_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774230_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774183_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774186_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK321265_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK720627_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK720628_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG893561_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
LC458432_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ787446_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ787480_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386581_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774294_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470893_P_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ586803_P_P-RF-AF      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ586810_P_P-RF-AF      -gacgagacc------gag------gcaggtcccctagaagaagaactcc
EF494378_P_P-RF-CA      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ801476_P_P-RF-CG      -ga------c------gag------gcaggtcccctagaagaagaactcc
HE981179_P_P-RF-FG      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562223_P_P-RF-CD      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377627_P_P-RF-CD      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF488705_P_P-RF-AD      -gacgagacc------gag------gtaggtcccctagaagaagaactcc
AY233277_P_P-RF-AC      -gacgagacc------gag------gcaggtcccctagaagaagaactcc
KF214656_P_P-RF-AC      -ga------c------gag------gcaggtcccctagaagaagaactcc
HM146131_P_P-RF-AD      -gacgaggcc------gag------gtaggtcccctagaaggagaactcc
AY161145_P_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY161146_P_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925404_P_P-RF-AC      -gacgagacc------gag------gcaggtcccctagaagaagaactcc
AY161140_P_P-RF-AD      -gtcgagacc------gag------gcaggttccctagaagaagaactcc
AY161141_P_P-RF-AD      -gtcgagacc------gag------gcaggttccctagaagaagaactcc
AB194949_P_P-RF-AE      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
GQ331048_P_P-RF-AE      -gaagggacc------gag------gtaggtcccctagaagaagaactcc
GQ161753_P_P-RF-AE      -gaa------------gag------gcaggtcccctagaagaagaactcc
GQ161767_P_P-RF-AE      -gaa------------gag------gcaggtcccctagaagaagaactcc
GQ161837_P_P-RF-AE      -gaa------------gag------gcaggtcccctagaagaagaactcc
HF571060_P_P-RF-AE      -gaa------------gag------gcaggtcccctagaagaagaactcc
AY236161_P_P-RF-DA      -ga------c------gag------gcaggtcccctagaagaagaactcc
X65259_P_P-RF-DA        -ga------c------gag------gcaggtcccctagaagaagaactcc
X68292_P_P-RF-DA        -ga------c------ggg------acaggtcccctagaagaagaactcc
MF488699_P_P-RF-DE      -ga------c------gag------gcaggaccaataaaataccatctcc
JN664929_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB033558_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN664933_P_P-RF-DA      ggg------c------gag------gcaggtcccctagaagaagaactcc
JN664925_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC875338_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC875339_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN664915_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ205378_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ205377_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ205387_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ205386_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ205379_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK516279_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK516280_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK541689_P_P-RF-DE      -ga------c------gag------gcaggacccctagaagaagaactcc
JN664934_P_P-RF-DE      -ga------a------gag------gcaggtcccct---agaagaactcc
JN664940_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ315779_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT366505_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH685719_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU736916_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357641_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU736917_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU736914_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU736915_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP168420_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP168421_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904397_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904442_P_P-RF-DE      -ga------a------gag------gcaggtcccctaaaggaagaactcc
FJ904436_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
AM494716_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
GU177079_P_P-RF-DE      -ga------agggaccgag------gcaggtcccctagaagaagaactcc
FJ904405_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904437_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904416_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904417_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904398_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP288875_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904430_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagacgaactcc
FJ904414_P_P-RF-DE      -ga------a------gat------gcaggtcccctagaagaagaactcc
FJ904444_P_P-RF-DE      -ga------a------gag------gcaggacccctagaagaagaactcc
FJ904396_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904403_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904401_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904404_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904408_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904409_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904394_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904407_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904447_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KF170740_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP168416_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU736923_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357627_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357631_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357628_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357632_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357626_P_P-RF-DE      -ga------a------gag------gcaggtcccttagaagaagaactcc
KX357624_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357625_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357629_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357634_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357630_P_P-RF-DE      -ga------a------gat------gcaggtcccctagaagaagaactcc
KX357633_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357623_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357635_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357636_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP168417_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP168418_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU736921_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU736922_P_P-RF-DE      -ga------a------rag------gcaggtcccctagaagaagaactcc
KU711666_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ349207_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagacgaactcc
FJ904425_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904441_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904400_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaggaagaactcc
FJ904406_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904440_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX827299_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KM606741_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP995112_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KM606750_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KM606751_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FN594770_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FN594771_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FN594769_P_P-RF-DE      -ga------a------gag------gcaggtcccctggaagaagaactcc
GQ161754_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU668440_P_P-RF-DE      -ga------c------gag------gcaggtcacctagaagaagaactcc
KJ470898_P_P-RF-DE      -aa------c------gag------gcaggccccctagaagaagaactcc
KJ470892_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470897_P_P-RF-DE      -ga------c------gag------gcaggacccctagaagaagaactcc
KJ470891_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470887_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470888_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470890_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470884_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470886_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF618346_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF618347_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192835_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192840_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192841_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192833_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192836_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192837_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192838_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192839_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ692536_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF779353_P_P-RF-DA      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700494_P_P-RF-DE      -aa------c------gag------gcaggacccctagaagaagaactcc
AB048702_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB048703_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700492_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH481860_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaaggactcc
MH481859_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH481862_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH481858_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH481861_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700493_P_P-RF-DE      -aa------c------gag------gcaggtccactagaagaagaactcc
HQ700579_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700585_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700536_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700537_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700540_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700503_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700534_P_P-RF-DE      -ga------c------gag------tcaggtcccctagaagaagaactcc
HQ700533_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700584_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700541_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700535_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700500_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB033559_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700524_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700525_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700538_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700497_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700501_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700582_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700581_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700583_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN664935_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ647351_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ647356_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925360_P_P-RF-DB      -ca------c------gag------gcaggtcccctagaagaagaactcc
EF103282_P_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
EF103283_P_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925402_P_P-RF-BD      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257154_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN040803_P_P-RF-DE      -aa------c------gag------gcaggtcccctagaagaagaactcc
JN642160_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN688717_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257204_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY341335_P_P-RF-DE      -ga------c------gag------gcaggacccctagaagaagaactcc
KJ803771_P_P-RF-DB      -gc------c------gag------gcaggtcccctagaagaagaactcc
EU594406_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925396_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ687532_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
X80925_P_P-RF-DE        -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925401_P_P-RF-DB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925371_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925388_P_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN664946_P_P-RF-DA      ggg------c------gag------gcaggtcccctagaagaagaactcc
MF925392_P_P-RF-DB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM524357_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KR905422_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT366503_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB330368_P_P-RF-DA      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
KF471643_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925397_P_P-RF-DC      -ga------c------gag------gcaggtcctctagaagaagaactcc
MF925384_P_P-RF-DB      -aa------c------gag------gcaggtcccttagaagaagaactcc
JF754613_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB674436_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN040798_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257191_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN642137_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN642141_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN642152_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB674432_P_P-RF-DE      -ga------c------gag------gcaggacccctagaagaagaactcc
JF754616_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB674433_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257189_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN642127_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257206_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257216_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257174_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257210_P_P-RF-DE      -ga------c------gat------gcaggwcccctagaagaagaactcc
JN257164_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN642139_P_P-RF-DE      -ga------c------gag------tcaggtcccctagaagaagaactcc
MK052957_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK052969_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN688715_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ464164_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ464167_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ464165_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ464166_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ586811_P_P-RF-DF      -ga------c------gag------gcaggtcccctagaagaactccccc
JN688689_P_P-RF-DE      -aa------c------aag------gcaggtcccctagaagaagaactcc
AB270538_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774450_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
EF103284_P_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB188243_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ647349_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440017_P_P-RF-DA      -ga------c------gggaccgaggcaggtcccctagaagaagaactcc
MH724239_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM359442_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM386676_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM577666_P_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
MN507835_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF488702_P_P-RF-DE      -ga------c------gag------gcaggtcccctaaaagaagaactcc
KF679991_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN664943_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ183486_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB188245_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK598656_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK598654_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK598652_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK598653_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT366504_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
EF103285_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM577667_P_P-RF-DE      -ga------c------gat------gcaggtcccctagaagaagaactcc
AB583679_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN507850_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM577665_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM577663_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM577664_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT366492_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY373430_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM524359_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AJ627217_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU594435_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK618439_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ111987_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU594436_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ349221_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX827302_P_P-RF-DE      -ga------c------gat------gcaggtcccctagaagaagaactcc
MH464835_P_P-RF-DE      -ga------c------gagnnnnnngcaggtcccctagaagaagaactcc
MH724243_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaagtcc
EU185780_P_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC012653_P_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH724222_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AJ627221_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ349212_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440013_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440012_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440008_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440011_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440004_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440005_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440001_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF439999_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440010_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440006_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440002_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440003_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440000_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF439998_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF439995_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF439994_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440009_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440007_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440015_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF439996_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440014_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK618440_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK618438_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK618444_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK618442_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK618445_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB210819_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898698_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898699_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AJ344117_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898690_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF967563_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
U95551_P_P-RF-DE        -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898686_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898687_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898688_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898693_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898695_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898696_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH724240_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY233293_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GU563560_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH464850_P_P-RF-DA      -ga------c------gagnnnnnngcaggtcccctagaagaagaactcc
AY233295_P_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH464851_P_P-RF-DE      -ga------c------gagnnnnnngcaggtcccctagaagaagaactcc
MH464846_P_P-RF-DE      -ga------c------gagnnnnnngcaggtcccctagaagaagaactcc
MH464852_P_P-RF-DE      -ga------c------gagnnnnnngcaggtcccctagaagaagaactcc
KX765835_P_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF219922_P_P-RF-GH      -ra------m------gag------gcaggkcccctmgaagaagaactcc
AB222708_P_P-RF-AD      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
JQ272886_P_P-RF-GF      -ga------c------gag------gcaggtcccctcgaagaagaactcc
JQ272887_P_P-RF-GF      -ga------c------gag------gcaggtcccctcgaagaagaactcc
EF464099_P_P-RF-AG      -ga------a------gag------gcaggtcccctcgaagaagaactcc
HE981180_P_P-RF-GF      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP274926_P_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
AB933279_P_P-RF-AG      -ga------a------gag------gcaggtcccctcgaagaagaactcc
AB933280_P_P-RF-AG      -ga------a------gag------gcaggtcccctcgaagaagaactcc
AB933281_P_P-RF-AG      -ga------a------gag------gcaggtcccctcgaagaagaactcc
EU833890_P_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
AF297619_P_P-RF-DA      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
AF297620_P_P-RF-DA      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
JQ707426_P_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JF439776_P_P-RF-AG      -gacgggacc------gag------gcaggtcccctcgaagaagaactcc
MF925386_P_P-RF-AC      -gacgggacc------gag------tcaggtcccctagaagaagaactcc
AB453985_P_P-RF-AC      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
AB933282_P_P-RF-AG      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
AB933283_P_P-RF-AG      -gacsggacc------gas------gcaggtcccctagaagaagaactcc
JF440021_P_P-RF-AG      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
JF440019_P_P-RF-AG      -ga------a------gag------gcaggtcccctagaagaagaactcc
JF440022_P_P-RF-AG      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
                                                    **     *            * 

FN594767_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
GQ161806_P_P-RF-EA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KJ717794_P_P-RF-CB      ctcgccttgcagacgaaggtctcaatcgccgcttcgcagaagatgtaaat
KJ803788_P_P-RF-CB      ctcgccttgcagacgaaggtctcaatcgccgcttcgcagaagatgtaaat
KF053179_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ803772_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873530_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KF873537_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679945_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873540_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873538_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873543_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873542_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873535_P_P-RF-CB      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679939_P_P-RF-CB      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679940_P_P-RF-CB      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679952_P_P-RF-CB      ctcgcctcgcaracgaaggtctcaatcgccgcgtcgcaraagatctcaat
KF873534_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873531_P_P-RF-CB      ctcgcctcgcagacgaargtctcaatcgccgcgtcgcagaagatctcaat
KF873532_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873533_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873521_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679955_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679950_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KU679944_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KU679953_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KU679948_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctmaat
KF873519_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KU679946_P_P-RF-BC      ctcgcctcgcaracgaaggtctcaatcgccgcgtcgccgaagatctcaat
KF873517_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KF873518_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KF873511_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KF873513_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KF873515_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KU679954_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaraagatctcaat
KU679942_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679943_P_P-RF-BC      ctcgcctcgcaracgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873527_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679956_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679958_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KF873522_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KF873523_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KF873524_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KU679941_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KF053166_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ803827_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FR714496_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MG826145_P_P-RF-BC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH746813_P_P-RF-BC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH746811_P_P-RF-BC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH746812_P_P-RF-BC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH368022_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaat
FR714490_P_P-RF-GB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KC172106_P_P-RF-GB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY470996_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471004_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY470998_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471001_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471007_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY470997_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY470999_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471000_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471002_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471003_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471006_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471005_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KP148441_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcggaagatctcaat
KP148449_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagagctcaat
KP148447_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP148586_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP148442_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP148450_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023659_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023662_P_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
EU835240_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023666_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023670_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882611_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU833891_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882610_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882614_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882617_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882612_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882618_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882613_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023665_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023667_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023673_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023664_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023668_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB241109_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ361772_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700519_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700521_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ803822_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF053186_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ803778_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660686_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ478890_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660684_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaat
AY057948_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT991427_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562263_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT991424_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY817511_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660689_P_P-RF-DC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HM750144_P_P-RF-DC      ctcgcctcgcagacgaaggtcccaatcgccgcgtcgcagaagatctcaat
HM750150_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774485_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP276253_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750146_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP276256_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750145_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX354997_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750148_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750147_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750143_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750149_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ349241_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774456_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750142_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774482_P_P-RF-DC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KC774461_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470853_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470844_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470843_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470846_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470847_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470849_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470850_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470855_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470854_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660685_P_P-RF-DC      ctcgcctcgcagacaaaggtctcaatcgccgcgtcgcgaaagatctcgat
KC774475_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774433_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774431_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY629632_P_P-RF-DC      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774498_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT991421_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT991419_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT991420_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT991423_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562278_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT991417_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB270535_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774486_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774453_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY670781_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774454_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ478898_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU787435_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774492_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY800249_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774422_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774483_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774458_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU787434_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774420_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774426_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774474_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY817515_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774457_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774447_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774495_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY817512_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774490_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ478886_P_P-RF-DC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KC774425_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774428_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY862866_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY862864_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY862865_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF491455_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774481_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF491451_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774478_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774480_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660674_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660680_P_P-RF-DC      ctcgccwcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774476_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774439_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774449_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774470_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF491449_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774484_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774452_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774442_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774443_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774435_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774455_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660677_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774479_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660675_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774448_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774430_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF917451_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774466_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774488_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774493_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU519422_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY817513_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774487_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
AY817509_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF491448_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY817510_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU519423_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774499_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774489_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774432_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774434_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX429898_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP276254_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP276255_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF491456_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774424_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ478889_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccacgtcgcagaagatctcaat
DQ478887_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ478892_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774468_P_P-RF-DC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
DQ478897_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774423_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774471_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774497_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774494_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774463_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774472_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG826150_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG826151_P_P-RF-BC      ctcccctggcagaggaaggtttcaatcgccgcgtcgcagaagatctcaat
HQ700520_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagcagatctcaat
AB105172_P_P-RF-CB      ctcgcctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaat
AP011102_P_P-RF-CB      ctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaat
AB493842_P_P-RF-CB      ctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaat
AP011103_P_P-RF-CB      ctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaat
AB493838_P_P-RF-CB      ctcgcctcgcagacgacgatctcaatcgccgcgtcgccgaagatctcaat
AB493847_P_P-RF-CB      ctcgcctcgcagacgacgatctcaatcgccgcgtcgccgaagatctcaat
AB493840_P_P-RF-CB      ctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaat
AB493837_P_P-RF-CB      ctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaat
GQ358155_P_P-RF-CB      ctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaat
GQ358156_P_P-RF-CB      ctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaat
HQ700518_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700527_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700528_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700530_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700523_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700531_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700532_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925389_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ386674_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU660227_P_P-RF-BC      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG826147_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG826141_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG826142_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG826148_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
KJ598675_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG826146_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
KT003704_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP148352_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
AP011104_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AP011105_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
LC416040_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB031265_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ717832_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KJ803804_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB674504_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ803798_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF436923_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgtagaagatctcaat
KJ803785_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcttcgcagaagatctcaat
KJ410506_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925382_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925370_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925381_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ924618_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ027310_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377595_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU882006_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC315400_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ684848_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK052976_P_P-RF-BD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK052967_P_P-RF-BD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK052970_P_P-RF-BD      ctcgcctcgcagacaaaggtctcaatcgccgcgtcacaaaagatctcaat
MK052968_P_P-RF-BD      ctcgccccgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ801477_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH094410_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774414_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939627_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ410497_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ717800_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcttggcagaagatctcaat
KJ803791_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcttggcagaagatctcaat
KJ717816_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF053188_P_P-RF-CB      ctcgcctcgcagacgaaggactcaatcgccgcgtcgcagacgatctcaat
KJ803782_P_P-RF-CB      ctcgcctcgcagacgaaggactcaatcgccgcgtcgcagacgatctcaat
KJ717815_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ803803_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ717814_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcttcgcagaagatctcaat
KJ803802_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcttcgcagaagatctcaat
KF053160_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ803753_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377592_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939623_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
GQ377556_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
EU939630_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939620_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377539_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562229_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377594_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377602_P_P-RF-CB      ctcgcctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaat
FJ562247_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377626_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
GQ377565_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377634_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939621_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562328_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377573_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377613_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ040174_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377604_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377590_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377549_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377564_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377596_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377614_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700542_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
EU939631_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939629_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377635_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377630_P_P-RF-BC      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774178_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774364_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC793112_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
KP148337_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173279_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173358_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173349_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173350_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173320_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KJ173322_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
FJ386646_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG826149_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700526_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
X75656_P_P-RF-CB        ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
HQ700580_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagamgatctcagt
HQ700498_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
HQ700499_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
KU695745_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
HQ700554_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaat
HQ700560_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
HQ700557_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
HQ700462_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
HQ700485_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
AP011108_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
KU695746_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700505_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KU695744_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KU695741_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KU695743_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700509_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700515_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700507_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700508_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
EU522070_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU695742_P_P-RF-CB      atcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ684849_P_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774198_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaat
KC774201_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaat
KC774307_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KC774323_P_P-RF-CB      ctcgcctcgcagacgagaagaccaattgccgcgtcccagaagatctcaat
KC774193_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KC774291_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AY206374_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
GQ377560_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AB033557_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700547_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX504540_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG826144_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
JF436919_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
KX096713_P_P-RF-CA      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562317_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU589337_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
FJ032343_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774246_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ040175_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ475335_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU881995_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
FJ032337_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EF494376_P_P-RF-CA      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB300369_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
FJ562294_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939547_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ040148_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX661485_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ040142_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
JX661486_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG893554_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG893555_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KR013843_P_P-RF-CB      ctcgcctcgcggacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377522_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB367800_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY247030_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ732168_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatctccgcgtcgcagaagatctcaat
AY040627_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB049609_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB367400_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB642096_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB367419_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB205152_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY123041_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AF330110_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF828935_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
JF828936_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
JF828938_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
JF828933_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
JF828934_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
FJ562302_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
Y18857_P_P-RF-CB        ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774212_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939668_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
EU919166_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU919167_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ386586_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
DQ089798_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963862_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963868_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963859_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963869_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963856_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963857_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963858_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963861_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963863_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963864_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963865_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963866_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963867_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963870_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963860_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU916239_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU916241_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU916240_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB195950_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB195951_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939551_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
FJ562267_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939577_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaag
Y18856_P_P-RF-CB        ctcgcctcgcagacgaaggtctcaatccgcgcgtcgcagaagatctcaat
JQ040146_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774188_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GU357843_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AF233236_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB367393_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaag
EU717211_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN400086_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AF411409_P_P-RF-CB      ctcgcctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaat
KJ173329_P_P-RF-CB      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562226_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
EU871994_P_P-RF-CB      ctcgcctcgcagacgaaggtcttaatcgccgcgtcgcagaagatctcaat
EU871995_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871989_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871991_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871992_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871996_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871993_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871984_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871985_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871983_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871999_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871981_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871986_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871990_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871987_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871988_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774324_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774222_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GU385774_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU787444_P_P-RF-CB      ctcgcctcttgcacgaaggtctccttcgccgagacgaaaaagatctcaat
AB670303_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY363263_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
KC774344_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX661498_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939606_P_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
FJ386635_P_P-RF-CB      ctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaat
JX661487_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY881840_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
M38454_P_P-RF-CB        ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY123424_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871997_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377534_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
EU939565_P_P-RF-CB      ctcgcctcgcagactaaggtctcaatcgccgcgtcgccgaagatctcaat
GQ377520_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
GQ377581_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377607_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939589_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377516_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377544_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
LC279266_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
LC279267_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
LC279265_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
LC279263_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
LC279264_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM213033_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774258_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB195940_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB195941_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB195939_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB195955_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB195956_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB195957_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562227_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562314_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG893559_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ386633_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562305_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774305_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774234_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU916232_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964306_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964316_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964313_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964308_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964307_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964303_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964009_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964008_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964007_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964005_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964006_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964010_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964304_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964305_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964309_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964310_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964312_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964314_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964315_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964317_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964311_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AF461361_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ386593_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM875422_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774349_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964351_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ410520_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB198084_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750133_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY167095_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774263_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774332_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774341_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173299_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173300_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KR013806_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF436922_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377611_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
JX429896_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX661494_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963883_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KR013816_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377548_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ386649_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ386578_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ386585_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377633_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774328_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX026887_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774317_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774322_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562287_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963993_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963991_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963990_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963994_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963995_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963998_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963999_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964001_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964003_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173325_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173326_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774230_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774183_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774186_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK321265_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK720627_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK720628_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG893561_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
LC458432_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ787446_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ787480_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ386581_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774294_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470893_P_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ586803_P_P-RF-AF      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ586810_P_P-RF-AF      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
EF494378_P_P-RF-CA      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaagt
JQ801476_P_P-RF-CG      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HE981179_P_P-RF-FG      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562223_P_P-RF-CD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377627_P_P-RF-CD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF488705_P_P-RF-AD      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AY233277_P_P-RF-AC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KF214656_P_P-RF-AC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HM146131_P_P-RF-AD      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AY161145_P_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY161146_P_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925404_P_P-RF-AC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AY161140_P_P-RF-AD      ctcgcctcgcagacgaagatctcaatcgccgcttcgcagaagatctcaat
AY161141_P_P-RF-AD      ctcgcctcgcagacgaagatctcaatcgccgcttcgcagaagatctcaat
AB194949_P_P-RF-AE      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
GQ331048_P_P-RF-AE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
GQ161753_P_P-RF-AE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
GQ161767_P_P-RF-AE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
GQ161837_P_P-RF-AE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HF571060_P_P-RF-AE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AY236161_P_P-RF-DA      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
X65259_P_P-RF-DA        ctcgcctgccagaccaaggtctcaatcgccgcgtcgcagaagatctcaat
X68292_P_P-RF-DA        ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF488699_P_P-RF-DE      ctcgaatcgcagactaacgtctcactcgccgcatcacataagatcacaat
JN664929_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
AB033558_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664933_P_P-RF-DA      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664925_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC875338_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC875339_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664915_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ205378_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ205377_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ205387_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ205386_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ205379_P_P-RF-DE      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK516279_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK516280_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK541689_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664934_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664940_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ315779_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT366505_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH685719_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU736916_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357641_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU736917_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU736914_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU736915_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP168420_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP168421_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904397_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904442_P_P-RF-DE      ctcgcctcgcagacaaaggtctaaatctccgcgtcgcagaagatctcaat
FJ904436_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AM494716_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GU177079_P_P-RF-DE      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
FJ904405_P_P-RF-DE      ctcgcctagcagacgaaggtgtcaatcgccgcgtcgcagaagaactcaat
FJ904437_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904416_P_P-RF-DE      ctcgcctagcagacgaaggtstcaatcgccgcgtcgcagaagatctcaat
FJ904417_P_P-RF-DE      ctcgcctagcagacgaaggtstcaatcgccgcgtcgcagaagatctcaat
FJ904398_P_P-RF-DE      ctcgcctcgcagacgaaggtstcaatcgccgcgtcgcagaagatctcaat
KP288875_P_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904430_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904414_P_P-RF-DE      ctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaat
FJ904444_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904396_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904403_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904401_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904404_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
FJ904408_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaat
FJ904409_P_P-RF-DE      ctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaat
FJ904394_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904407_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904447_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF170740_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP168416_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU736923_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357627_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357631_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357628_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccat
KX357632_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357626_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357624_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357625_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357629_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357634_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357630_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357633_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357623_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357635_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357636_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP168417_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP168418_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU736921_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU736922_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaraagatctcaat
KU711666_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ349207_P_P-RF-DE      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904425_P_P-RF-DE      ctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaat
FJ904441_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904400_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccat
FJ904406_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904440_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX827299_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM606741_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP995112_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM606750_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM606751_P_P-RF-DE      ctcgcctcgcaaacgaaggtctcaatcgccacgtcgcagagaatctcaat
FN594770_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FN594771_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FN594769_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ161754_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU668440_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470898_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KJ470892_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470897_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470891_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470887_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470888_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470890_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470884_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470886_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF618346_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF618347_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192835_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192840_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192841_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192833_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192836_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192837_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192838_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192839_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ692536_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KF779353_P_P-RF-DA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700494_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AB048702_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AB048703_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700492_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagaactcaat
MH481860_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH481859_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH481862_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH481858_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH481861_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700493_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700579_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700585_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700536_P_P-RF-DE      ctcgcctcgcakacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700537_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700540_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700503_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700534_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700533_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700584_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700541_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700535_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700500_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AB033559_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700524_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700525_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700538_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700497_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700501_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700582_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700581_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700583_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
JN664935_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
KJ647351_P_P-RF-DE      ctcgcctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctaaat
KJ647356_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MF925360_P_P-RF-DB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
EF103282_P_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EF103283_P_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
MF925402_P_P-RF-BD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257154_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
JN040803_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN642160_P_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN688717_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
JN257204_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY341335_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KJ803771_P_P-RF-DB      ctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctaaat
EU594406_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MF925396_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ687532_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
X80925_P_P-RF-DE        ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MF925401_P_P-RF-DB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925371_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925388_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664946_P_P-RF-DA      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925392_P_P-RF-DB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM524357_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KR905422_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT366503_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB330368_P_P-RF-DA      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
KF471643_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
MF925397_P_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925384_P_P-RF-DB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF754613_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB674436_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
JN040798_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257191_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN642137_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
JN642141_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN642152_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB674432_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF754616_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
AB674433_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257189_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN642127_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257206_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257216_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257174_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257210_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257164_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN642139_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK052957_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK052969_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN688715_P_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ464164_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgaagaagatctaaat
DQ464167_P_P-RF-DE      ctcgcctcccagacgaagatctcaatcgccgcgtcccagaagatctaaat
DQ464165_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaat
DQ464166_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaat
KJ586811_P_P-RF-DF      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN688689_P_P-RF-DE      ctcgcctcgcagaccagggtctaaatcgccgcgtcgcagaagatctcaat
AB270538_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774450_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EF103284_P_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB188243_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KJ647349_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440017_P_P-RF-DA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH724239_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM359442_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM386676_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM577666_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN507835_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MF488702_P_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF679991_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664943_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ183486_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB188245_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK598656_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MK598654_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
MK598652_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
MK598653_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KT366504_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EF103285_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KM577667_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB583679_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN507850_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM577665_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM577663_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM577664_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT366492_P_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY373430_P_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM524359_P_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AJ627217_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU594435_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
MK618439_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
DQ111987_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
EU594436_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
FJ349221_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX827302_P_P-RF-DE      cccgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH464835_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH724243_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatctccgcgtcgcagaagatctcaat
EU185780_P_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC012653_P_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH724222_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AJ627221_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
FJ349212_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440013_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440012_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440008_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440011_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440004_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440005_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440001_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF439999_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440010_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440006_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440002_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440003_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440000_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF439998_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF439995_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF439994_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440009_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440007_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440015_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF439996_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440014_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK618440_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK618438_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK618444_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK618442_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK618445_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB210819_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
JX898698_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898699_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AJ344117_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898690_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF967563_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
U95551_P_P-RF-DE        ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898686_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898687_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898688_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898693_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898695_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898696_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH724240_P_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AY233293_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GU563560_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH464850_P_P-RF-DA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AY233295_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH464851_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH464846_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH464852_P_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX765835_P_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF219922_P_P-RF-GH      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
AB222708_P_P-RF-AD      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
JQ272886_P_P-RF-GF      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ272887_P_P-RF-GF      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EF464099_P_P-RF-AG      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
HE981180_P_P-RF-GF      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
KP274926_P_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
AB933279_P_P-RF-AG      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
AB933280_P_P-RF-AG      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
AB933281_P_P-RF-AG      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
EU833890_P_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
AF297619_P_P-RF-DA      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
AF297620_P_P-RF-DA      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
JQ707426_P_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JF439776_P_P-RF-AG      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
MF925386_P_P-RF-AC      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
AB453985_P_P-RF-AC      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
AB933282_P_P-RF-AG      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
AB933283_P_P-RF-AG      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcasaagatctcaat
JF440021_P_P-RF-AG      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
JF440019_P_P-RF-AG      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
JF440022_P_P-RF-AG      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
                          *         *            *   *            *       

FN594767_P_P-RF-DE      ctccagcttcccaatgttagtattccttggactcacaaggtgggaaattt
GQ161806_P_P-RF-EA      ctccagcttcccgatgttagtattccttggactcacaaggtgggaaattt
KJ717794_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ803788_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KF053179_P_P-RF-BC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KJ803772_P_P-RF-BC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KF873530_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KF873537_P_P-RF-CB      ctcggggatcccaatgttagtatcccgtggactcataaggtgggaaattt
KU679945_P_P-RF-CB      ctcgggaatctaaatgttagtatcccgtggactcataaggtgggaaattt
KF873540_P_P-RF-CB      ctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaattt
KF873538_P_P-RF-CB      ctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaattt
KF873543_P_P-RF-CB      ctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaattt
KF873542_P_P-RF-CB      ctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaattt
KF873535_P_P-RF-CB      ctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaactt
KU679939_P_P-RF-CB      ctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaactt
KU679940_P_P-RF-CB      ctcgggratcccaatgttagtatcccgtggactcataaggtgggaaactt
KU679952_P_P-RF-CB      ctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaactt
KF873534_P_P-RF-CB      ctcgggaatctcaatgttagtatcccgtggactcataaggtgggaaactt
KF873531_P_P-RF-CB      ctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaactt
KF873532_P_P-RF-CB      ctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaactt
KF873533_P_P-RF-CB      ctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaactt
KF873521_P_P-RF-BC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KU679955_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KU679950_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KU679944_P_P-RF-BC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KU679953_P_P-RF-BC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KU679948_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KF873519_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KU679946_P_P-RF-BC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KF873517_P_P-RF-BC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KF873518_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KF873511_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KF873513_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KF873515_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KU679954_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU679942_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU679943_P_P-RF-BC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KF873527_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU679956_P_P-RF-CB      ctcgggaatctcaatgttagtatcccgtggactcataaggtgggaaactt
KU679958_P_P-RF-CB      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KF873522_P_P-RF-CB      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KF873523_P_P-RF-CB      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KF873524_P_P-RF-CB      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KU679941_P_P-RF-CB      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KF053166_P_P-RF-BC      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactt
KJ803827_P_P-RF-BC      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactt
FR714496_P_P-RF-CB      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
MG826145_P_P-RF-BC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
MH746813_P_P-RF-BC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
MH746811_P_P-RF-BC      ctcgggaatcccagtgttagtattccttggactcataaggtgggaaactt
MH746812_P_P-RF-BC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
MH368022_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
FR714490_P_P-RF-GB      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KC172106_P_P-RF-GB      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KY470996_P_P-RF-GC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KY471004_P_P-RF-GC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KY470998_P_P-RF-GC      ctcgggaatcccaatgttagtattccttggactcataaggtggggaactt
KY471001_P_P-RF-GC      ctcgggaatcccaatgttagtattccttggactcataaggtggggaactt
KY471007_P_P-RF-GC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KY470997_P_P-RF-GC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KY470999_P_P-RF-GC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KY471000_P_P-RF-GC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KY471002_P_P-RF-GC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KY471003_P_P-RF-GC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KY471006_P_P-RF-GC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KY471005_P_P-RF-GC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KP148441_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KP148449_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KP148447_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KP148586_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KP148442_P_P-RF-BC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
KP148450_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
FJ023659_P_P-RF-BC      ctcgggaatcccaatgttagtataccttggactcataaggtgggaaactt
FJ023662_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
EU835240_P_P-RF-GC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ023666_P_P-RF-GC      ctcgggaaccccaatgttagtatcccttggactcataaggtgggaaactt
FJ023670_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
FJ882611_P_P-RF-GC      ctcgggaatccaaatgttagtatcccttggactcataaggtgggaaactt
EU833891_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
FJ882610_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
FJ882614_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
FJ882617_P_P-RF-GC      ctcgggaatccmaatgttagtatcccttggactcataaggtgggaaactt
FJ882612_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
FJ882618_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
FJ882613_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
FJ023665_P_P-RF-GC      ctcggggatcccaatgttagtatcccttggactcataaggtgggaaactt
FJ023667_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
FJ023673_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
FJ023664_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
FJ023668_P_P-RF-GC      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
AB241109_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggacacataaggtgggaaactt
FJ361772_P_P-RF-GC      ctcgggaacctcaatgttaatatcccttggactcataaggtgggaaactt
HQ700519_P_P-RF-CB      ctcgggaatcccaatgttagtataccttggactcataaggtgggaaactt
HQ700521_P_P-RF-CB      ctcgggaatcccaatgttagtataccttggacccataaggtgggaaactt
KJ803822_P_P-RF-CB      ctagggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KF053186_P_P-RF-BC      ctcgggaatcttaatgttagtatcccttggactcataaggtgggaaactt
KJ803778_P_P-RF-BC      ctcgggaatcttaatgttagtatcccttggactcataaggtgggaaactt
KX660686_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
DQ478890_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KX660684_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
AY057948_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KT991427_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggacgcataaggtggggaactt
FJ562263_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggacgcataaggtggggaactt
KT991424_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggacgcataaggtggggaactt
AY817511_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KX660689_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
HM750144_P_P-RF-DC      ctcgggaatctcaatgttagtattccctggactcataaggtgggaaactt
HM750150_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KC774485_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KP276253_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
HM750146_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KP276256_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
HM750145_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KX354997_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
HM750148_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
HM750147_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
HM750143_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
HM750149_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
FJ349241_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KC774456_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
HM750142_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
KC774482_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KC774461_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KY470853_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KY470844_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KY470843_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KY470846_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KY470847_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KY470849_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KY470850_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KY470855_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KY470854_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KX660685_P_P-RF-DC      ctcgggaatctcaatgttagtatgccttgtactcataaagtgggaaactt
KC774475_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774433_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
KC774431_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
KY629632_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774498_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KT991421_P_P-RF-DC      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactt
KT991419_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KT991420_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KT991423_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ562278_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KT991417_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB270535_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774486_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774453_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KY670781_P_P-RF-DC      ctcggggatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774454_P_P-RF-DC      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactt
DQ478898_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU787435_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774492_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AY800249_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774422_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774483_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774458_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU787434_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774420_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774426_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774474_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AY817515_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774457_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774447_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774495_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AY817512_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774490_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
DQ478886_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggtctcataaggtgggcaactt
KC774425_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774428_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AY862866_P_P-RF-DC      ctcaggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AY862864_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AY862865_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JF491455_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774481_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JF491451_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774478_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774480_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KX660674_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KX660680_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774476_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774439_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774449_P_P-RF-DC      ctcggggatcccaatgttagtatcccttggactcataaggtgggaaactt
KC774470_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JF491449_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774484_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774452_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774442_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774443_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774435_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774455_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KX660677_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774479_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KX660675_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774448_P_P-RF-DC      ctcgggaatctcaatgttagtatcccgtggactcataaggtgggaaactt
KC774430_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
KF917451_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774466_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774488_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774493_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU519422_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AY817513_P_P-RF-DC      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaactt
KC774487_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AY817509_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
JF491448_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AY817510_P_P-RF-DC      ctcgggaatctcaatgttagtgtcccttggactcataaggtgggaaactt
KU519423_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774499_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774489_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774432_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774434_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
JX429898_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
KP276254_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KP276255_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JF491456_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774424_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
DQ478889_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
DQ478887_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
DQ478892_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774468_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
DQ478897_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774423_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774471_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774497_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774494_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774463_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774472_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
MG826150_P_P-RF-BC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
MG826151_P_P-RF-BC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
HQ700520_P_P-RF-CB      ctcgggaatcccaatgttagtataccctggactcataaggtgggaaactt
AB105172_P_P-RF-CB      ctcgggaatcccaatgttagtataccttggactcataaggtgggaaactt
AP011102_P_P-RF-CB      ctcgggaatcccaatgttagtataccttggactcataaggtgggaaactt
AB493842_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaactt
AP011103_P_P-RF-CB      ctcgggaatcccaatgttagtataccttggactcataaggtgggaaactt
AB493838_P_P-RF-CB      ctcgggaatcccaatgttagtataccctggactcataaggtgggaaactt
AB493847_P_P-RF-CB      ctcgggaatcccaatgttagtataccctggactcataaggtgggaaactt
AB493840_P_P-RF-CB      ctcgggaatcccaatgttagtataccttggactcataaggtgggaaactt
AB493837_P_P-RF-CB      ctcgggaatcccaatgttagtataccttggactcataaggtgggaaactt
GQ358155_P_P-RF-CB      ctcgggaatcccaatgttagtataccttggactcataaggtgggaaactt
GQ358156_P_P-RF-CB      ctcgggaatcccaatgttagtataccttggactcataaggtgggaaactt
HQ700518_P_P-RF-CB      ctcgggaatcccaatgttagtataccttggactcataaggtgggaaactt
HQ700527_P_P-RF-CB      ctcgggaatcccaatgttagtataccttggactcacaaggtgggaaactt
HQ700528_P_P-RF-CB      ctcgggaatcccaatgttagtataccttggactcataaggtgggaaactt
HQ700530_P_P-RF-CB      ctcgggaatcccaatgttagtataccttggactcataaggtgggaaactt
HQ700523_P_P-RF-CB      ctcgggaatccaaatgttagtataccttggactcataaggtgggaaactt
HQ700531_P_P-RF-CB      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
HQ700532_P_P-RF-CB      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
MF925389_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ386674_P_P-RF-BC      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
EU660227_P_P-RF-BC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
MG826147_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
MG826141_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
MG826142_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
MG826148_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ598675_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
MG826146_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
KT003704_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaacct
KP148352_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AP011104_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AP011105_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
LC416040_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB031265_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ717832_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ803804_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB674504_P_P-RF-DC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ803798_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JF436923_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ803785_P_P-RF-CB      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactt
KJ410506_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
MF925382_P_P-RF-CB      ctcgggaacctcaatgttgatatcccttggactcataaggtgggaaactt
MF925370_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
MF925381_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
GQ924618_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JQ027310_P_P-RF-CB      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactt
GQ377595_P_P-RF-BC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
EU882006_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC315400_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
HQ684848_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
MK052976_P_P-RF-BD      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
MK052967_P_P-RF-BD      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
MK052970_P_P-RF-BD      ctcggaaatctcaatgttagtattccttggacacataaggtgggaaactt
MK052968_P_P-RF-BD      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
JQ801477_P_P-RF-BC      ctcgggratctcaatgttagtattccgtggacacataaggtgggaaactt
MH094410_P_P-RF-BC      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
KC774414_P_P-RF-BC      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
EU939627_P_P-RF-BC      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
KJ410497_P_P-RF-BC      ctcggcaatctcaatgttagtataccttggacacataaggtgggaaactt
KJ717800_P_P-RF-CB      cttggcaatctcaatgttagtattccttggacacacaaggtgggaaacta
KJ803791_P_P-RF-CB      cttggcaatctcaatgttagtattccttggacacacaaggtgggaaacta
KJ717816_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KF053188_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
KJ803782_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
KJ717815_P_P-RF-CB      ctcgggaatctaaatgttagtattccttggacacataaggtgggaaactt
KJ803803_P_P-RF-CB      ctcgggaatctaaatgttagtattccttggacacataaggtgggaaactt
KJ717814_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
KJ803802_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
KF053160_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ803753_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
GQ377592_P_P-RF-CB      ctcgggaacctcaatgttagtattccttggacacataaggtgggaaactt
EU939623_P_P-RF-CB      ctcgggactctcaatgttaatattccttggacacataaggtgggaaactt
GQ377556_P_P-RF-CB      ctcgggaacctcaatgttaatattccttggactcataaggtgggaaactt
EU939630_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
EU939620_P_P-RF-CB      ctcgggaatctaaatgttagtattccttggacacataaggtgggaaactt
GQ377539_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
FJ562229_P_P-RF-CB      ctcgggaatctaaatgttagtattccttggacacataaggtgggaaactt
GQ377594_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaattt
GQ377602_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
FJ562247_P_P-RF-CB      ctcggggatctcaatgttagtattccttggacacataaggtgggaaactt
GQ377626_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
GQ377565_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
GQ377634_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
EU939621_P_P-RF-CB      ctcgggaatctcagtgttagtattccttggacacataaggtgggaaattt
FJ562328_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
GQ377573_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
GQ377613_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacgcataaggtgggaaactt
JQ040174_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
GQ377604_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
GQ377590_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtggggaactt
GQ377549_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
GQ377564_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
GQ377596_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
GQ377614_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
HQ700542_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtggggaactt
EU939631_P_P-RF-BC      ctcgggaatcttaatgtcagtatcccttggactcataaggtgggaaactt
EU939629_P_P-RF-BC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
GQ377635_P_P-RF-BC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
GQ377630_P_P-RF-BC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774178_P_P-RF-BC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774364_P_P-RF-BC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC793112_P_P-RF-BC      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
KP148337_P_P-RF-BC      ctcgggaatctcaatgttagtattccttggacgcataaggtgggaaactt
KJ173279_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
KJ173358_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaactt
KJ173349_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ173350_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KJ173320_P_P-RF-CB      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactt
KJ173322_P_P-RF-CB      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactt
FJ386646_P_P-RF-CB      ctcgggaatcttaatgtcagtatcccttggacgcataaggtgggaaactt
MG826149_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
HQ700526_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
X75656_P_P-RF-CB        ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
HQ700580_P_P-RF-CB      ctcgggaaccycaatgttaatatcccttggactcataaggttggaaattt
HQ700498_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaactt
HQ700499_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaactt
KU695745_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaactt
HQ700554_P_P-RF-CB      ctcggggatcccaatgttagtatcccttggactcataaggtgggaaactt
HQ700560_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
HQ700557_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
HQ700462_P_P-RF-CB      ctcgggaatctcaatgttaatatcccttggactcataaggtgggaaactt
HQ700485_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AP011108_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU695746_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
HQ700505_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU695744_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU695741_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU695743_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
HQ700509_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
HQ700515_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
HQ700507_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
HQ700508_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
EU522070_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU695742_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
HQ684849_P_P-RF-BC      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactt
KC774198_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774201_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774307_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774323_P_P-RF-CB      ctcggggatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774193_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774291_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AY206374_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggcaactt
GQ377560_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggcaactt
AB033557_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
HQ700547_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JX504540_P_P-RF-CB      ctcgggaatccaaatgttagtatcccttggacgcataaggtgggaaactt
MG826144_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JF436919_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KX096713_P_P-RF-CA      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
FJ562317_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU589337_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ032343_P_P-RF-CB      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
KC774246_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggacacataaggtgggaaactt
JQ040175_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
GQ475335_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU881995_P_P-RF-CB      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactt
FJ032337_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EF494376_P_P-RF-CA      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
AB300369_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ562294_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
EU939547_P_P-RF-CB      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactt
JQ040148_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JX661485_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JQ040142_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JX661486_P_P-RF-CB      ctcgggaatctcaatgttagtatcccatggactcataaggtgggaaactt
MG893554_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
MG893555_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KR013843_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
GQ377522_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB367800_P_P-RF-CB      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaactt
AY247030_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JQ732168_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AY040627_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB049609_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB367400_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB642096_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB367419_P_P-RF-CB      ctcgggaacctcaatgttagtatcccttggacgcataaggtgggaaactt
AB205152_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AY123041_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AF330110_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JF828935_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JF828936_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JF828938_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JF828933_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JF828934_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ562302_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
Y18857_P_P-RF-CB        ctcgggaatctcaatgttagaatcccttggactcataaggtgggaaactt
KC774212_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU939668_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU919166_P_P-RF-CB      ctcggggatctcaatgttagtatcccttggactcataaggtgggaaattt
EU919167_P_P-RF-CB      ctcggggatctcaatgttagtatcccttggactcataaggtgggaaattt
FJ386586_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
DQ089798_P_P-RF-CB      ctcgggatcctcaatgttagtatcccttggactcataaggtgggaaactt
KU963862_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963868_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963859_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963869_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963856_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963857_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963858_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963861_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963863_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963864_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963865_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963866_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963867_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963870_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KU963860_P_P-RF-CB      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
EU916239_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
EU916241_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
EU916240_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
AB195950_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB195951_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU939551_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ562267_P_P-RF-CB      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactt
EU939577_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
Y18856_P_P-RF-CB        ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JQ040146_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaamctt
KC774188_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
GU357843_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AF233236_P_P-RF-CB      ctcgggaatctcaatgttagtaccccttggactcataaggtgggaaactt
AB367393_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU717211_P_P-RF-CB      ctcggggatctcaatgttagtatcccttggactcataaggtgggaaattt
JN400086_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AF411409_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ173329_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaattt
FJ562226_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
EU871994_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871995_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871989_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871991_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871992_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871996_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871993_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871984_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871985_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871983_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871999_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871981_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871986_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871990_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871987_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871988_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774324_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774222_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
GU385774_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU787444_P_P-RF-CB      ctcgggaatctcggtgttaatatcgcttgcactcatagggcgggaaactt
AB670303_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaactt
KY363263_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774344_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JX661498_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
EU939606_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ386635_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaactt
JX661487_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
KY881840_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
M38454_P_P-RF-CB        ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AY123424_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU871997_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
GQ377534_P_P-RF-CB      ctcgggaatctcaatgttagtatcccctggactcataaggtgggaaactt
EU939565_P_P-RF-CB      ctcgggaatctcaatgttagtatcccctggactcataatgtgggaaactt
GQ377520_P_P-RF-CB      ctcgggaatctcaatgttagtatcccctggactcataaggtgggaaactt
GQ377581_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
GQ377607_P_P-RF-CB      ctcgggaatctaaatgttagtatcccttggactcataaggtgggaaactt
EU939589_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
GQ377516_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
GQ377544_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
LC279266_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
LC279267_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
LC279265_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
LC279263_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
LC279264_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
KM213033_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774258_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggacacataaggtgggaaactt
AB195940_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB195941_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB195939_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB195955_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB195956_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB195957_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ562227_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
FJ562314_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
MG893559_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ386633_P_P-RF-CB      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaattt
FJ562305_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774305_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
KC774234_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
EU916232_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964306_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964316_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964313_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964308_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964307_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964303_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964009_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964008_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964007_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964005_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964006_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964010_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964304_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964305_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964309_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964310_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964312_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964314_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964315_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964317_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964311_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AF461361_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ386593_P_P-RF-CB      ctcggggatctcaatgttagtatcccttggactcataaggtgggaaactt
KM875422_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774349_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964351_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ410520_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
AB198084_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
HM750133_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
AY167095_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774263_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774332_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774341_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaactt
KJ173299_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ173300_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KR013806_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JF436922_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
GQ377611_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JX429896_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JX661494_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU963883_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KR013816_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
GQ377548_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ386649_P_P-RF-CB      ctcgggaatctcaatgttagtatcccctggactcataaggtgggaaactt
FJ386578_P_P-RF-CB      ctcgggaatctcaatgttagtatcccctggactcataaggtgggaaactt
FJ386585_P_P-RF-CB      ctcgggaatctcaatgttagtatcccctggactcataaggtgggaaactt
GQ377633_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774328_P_P-RF-CB      ctcgggaatctcaatgttagtatcccctggactcataaggtgggaaactt
JX026887_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774317_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774322_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ562287_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU963993_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU963991_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU963990_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU963994_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU963995_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU963998_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU963999_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964001_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KU964003_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ173325_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ173326_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774230_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774183_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774186_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
MK321265_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MK720627_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MK720628_P_P-RF-CB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MG893561_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaactt
LC458432_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ787446_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ787480_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
FJ386581_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KC774294_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KY470893_P_P-RF-CB      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KJ586803_P_P-RF-AF      ctccagcttcccaatgttagtattccttggactcataaggtgggaaattt
KJ586810_P_P-RF-AF      ctccagcttcccaatgttagtattccttggactcataaggtgggaaattt
EF494378_P_P-RF-CA      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
JQ801476_P_P-RF-CG      ctcgggaatctcaatgttagtatcccttggactcacaaggtgggaagctt
HE981179_P_P-RF-FG      ctccagcttcccaatgttagtattccttggactcataaggtgggaaattt
FJ562223_P_P-RF-CD      ctcgggaaccccaatgttagtattccctggactcataaggtgggaaactt
GQ377627_P_P-RF-CD      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MF488705_P_P-RF-AD      ctcgggaatcccaatgttagtattccttggactcataaggtgggcaattt
AY233277_P_P-RF-AC      ctcgggaatctcaatgttagtattccctggactcataaggtgggaacttt
KF214656_P_P-RF-AC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggcaattt
HM146131_P_P-RF-AD      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
AY161145_P_P-RF-AD      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
AY161146_P_P-RF-AD      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
MF925404_P_P-RF-AC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
AY161140_P_P-RF-AD      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
AY161141_P_P-RF-AD      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
AB194949_P_P-RF-AE      ctcgggaacctcaatgttagtattccttggactcataaggtggggaattt
GQ331048_P_P-RF-AE      ctcgggaatcccaatgttagtatcccttggactcataaggtgggaaattt
GQ161753_P_P-RF-AE      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaattt
GQ161767_P_P-RF-AE      ctcgggaacctcaatgttagtattccttggacacataaggtgggaaattt
GQ161837_P_P-RF-AE      ctcgggaatctcaatgttagtattccttggacacataaggtgggaaattt
HF571060_P_P-RF-AE      ctcgggaacctcaatgttagtattccttggacacataaggtgggaaattt
AY236161_P_P-RF-DA      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
X65259_P_P-RF-DA        ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
X68292_P_P-RF-DA        ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
MF488699_P_P-RF-DE      ctcgggaagctcaatgttagtattccctggaggcaaaaggcgggaaactt
JN664929_P_P-RF-DE      ctcgggaatctcaatgttagtattccctggacgcataaggtgggaaactt
AB033558_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
JN664933_P_P-RF-DA      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JN664925_P_P-RF-DE      ctcgggactctcaatgttagtattccctggactcataaggtgggaaactt
KC875338_P_P-RF-DE      ctcgggactctcaatgttagtattccctggactcataaggtgggaaactt
KC875339_P_P-RF-DE      ctcgggactctcaatgttagtattccctggactcataaggtgggaaactt
JN664915_P_P-RF-DE      ctcgggactctcaatgttagtattccctggactcataaggtgggaaactt
GQ205378_P_P-RF-DE      ctcgggactctcaatgttagtattccctggactcataaggtgggaaactt
GQ205377_P_P-RF-DE      ctcgggactctcaatgttagtattccctggactcataaggtgggaaactt
GQ205387_P_P-RF-DE      ctcgggactctcaatgttagtattccctggactcataaggtgggaaactt
GQ205386_P_P-RF-DE      ctcgggactctcaatgttagtattccctggactcataaggtgggaaactt
GQ205379_P_P-RF-DE      ctcgggaatctcaatgttagtattccctggactcatacggtgggaaactt
MK516279_P_P-RF-DE      ctcgggaatcccaatgttagtattccctggactcataaggtgggaaactt
MK516280_P_P-RF-DE      ctcgggaatcccaatgttagtattccctggactcataaggtgggaaactt
MK541689_P_P-RF-DE      ctcgggaatcccaatgttaatattccctggactcataaggtgggaaactt
JN664934_P_P-RF-DE      ctcgggaatctcaatgttagtattccctggactcataaggtgggaaactt
JN664940_P_P-RF-DE      ctcgggaatctcaatgttagtattccctggactcataaggtgggaaactt
DQ315779_P_P-RF-DE      ctcgggaatctcaatgttagtattccctggactcataaggtgggaaactt
KT366505_P_P-RF-DE      ctcgggaatctcaatgttagtattccctggactcataaggtgggaaactt
MH685719_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KU736916_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KX357641_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KU736917_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KU736914_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KU736915_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KP168420_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KP168421_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaattt
FJ904397_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggacgcataaggtgggaaattt
FJ904442_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
FJ904436_P_P-RF-DE      ctagggaacctcaatgttgatattccttggactcataaggtgggaaattt
AM494716_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
GU177079_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
FJ904405_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
FJ904437_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaattt
FJ904416_P_P-RF-DE      ctagggaacctcaatgttagtattccttggactcataaggtgggaaattt
FJ904417_P_P-RF-DE      ctagggaacctcaatgttagtattccttggactcataaggtgggaaattt
FJ904398_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KP288875_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaattt
FJ904430_P_P-RF-DE      ctcggggatctcaatgttgatattccttggactcataaggtgggaaattt
FJ904414_P_P-RF-DE      ctagggaatctcaatgttagtattccttggactcataaggtgggaaattt
FJ904444_P_P-RF-DE      ctagggaaccccaatgttaatattccttggactcataaggtgggaaattt
FJ904396_P_P-RF-DE      ctcggggatctcaatgttagtattccttggactcataaggtgggaaattt
FJ904403_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggcaattt
FJ904401_P_P-RF-DE      ctcggggatctcaatgttagtattccttggactcataaggtgggaaattt
FJ904404_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
FJ904408_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
FJ904409_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggacagtt
FJ904394_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
FJ904407_P_P-RF-DE      ctcgggaatctcactgttagtattccttggactcataaggtgggaaattt
FJ904447_P_P-RF-DE      ctcggggatctcaatgttagtattccttggactcataaggtgggaaattt
KF170740_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KP168416_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KU736923_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KX357627_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaattt
KX357631_P_P-RF-DE      ctcgggaaccccaatgttagtattccttggactcataaggtgggaaattt
KX357628_P_P-RF-DE      ctcggggatctcaatgttagtattccttggactcataaggtgggaaattt
KX357632_P_P-RF-DE      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaattt
KX357626_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KX357624_P_P-RF-DE      ctcgggaatctcaatgttagtattccgtggactcataaggtgggaaattt
KX357625_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KX357629_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KX357634_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KX357630_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KX357633_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KX357623_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KX357635_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KX357636_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KP168417_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KP168418_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KU736921_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KU736922_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KU711666_P_P-RF-DE      ctcgggaatctcaatgttagtattccctggactcataaggtgggaaattt
FJ349207_P_P-RF-DE      ctagggaacctcaatgttagtattccttggactcataaggtgggaaattt
FJ904425_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
FJ904441_P_P-RF-DE      ctcggggatctcaatgttagcattccttggactcataaggtgggaaattt
FJ904400_P_P-RF-DE      ctcggggatctcaatgttagcattccttggactcataaggtgggaaattt
FJ904406_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaattt
FJ904440_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KX827299_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KM606741_P_P-RF-DE      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaattt
KP995112_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KM606750_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KM606751_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
FN594770_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
FN594771_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
FN594769_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
GQ161754_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
KU668440_P_P-RF-DE      ctcgggaacctcaatgttagtattccctggactcataaggtgggaaactt
KJ470898_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KJ470892_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KJ470897_P_P-RF-DE      ctcgggaacctcaatgttgatattccttggactcataaggtggggaattt
KJ470891_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KJ470887_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KJ470888_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KJ470890_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KJ470884_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KJ470886_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
MF618346_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
MF618347_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KF192835_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KF192840_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KF192841_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KF192833_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KF192836_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KF192837_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KF192838_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
KF192839_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaattt
FJ692536_P_P-RF-DE      ctccggaatctcaatgttagtatcccttggacccataaggtgggaaattt
KF779353_P_P-RF-DA      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700494_P_P-RF-DE      ctcgggatcctcaatgytartatcccttggactcataaggtgggaaattt
AB048702_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
AB048703_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700492_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
MH481860_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
MH481859_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
MH481862_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
MH481858_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
MH481861_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700493_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700579_P_P-RF-DE      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700585_P_P-RF-DE      ctcgggaacctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700536_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700537_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700540_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700503_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700534_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700533_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700584_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700541_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700535_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700500_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
AB033559_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700524_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700525_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700538_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700497_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700501_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700582_P_P-RF-DE      ctcggcaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700581_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
HQ700583_P_P-RF-DE      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattt
JN664935_P_P-RF-DC      ctcgggaatctcaatgttagtattccctggactcataaggtgggaaactt
KJ647351_P_P-RF-DE      ctcgggaatctcaatgttagtataccttggactcataaggtgggaaactt
KJ647356_P_P-RF-DE      ctagggaacctcaatgttagtattccttggactcataaggtgggaaactt
MF925360_P_P-RF-DB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
EF103282_P_P-RF-AD      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
EF103283_P_P-RF-AD      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MF925402_P_P-RF-BD      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaactt
JN257154_P_P-RF-DE      ctcgggaaccccaatgttagtattccttggactcataaggtgggaaactt
JN040803_P_P-RF-DE      ctcggggatctcaatgttagtattccttggactcataaggtgggaaactt
JN642160_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JN688717_P_P-RF-DE      ctcgggaatctcagtgttagtattccttggactcataaggtgggaaactt
JN257204_P_P-RF-DE      ctcgggaatcccaatgttagtattccttggactcataaggtgggaaactt
AY341335_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaagtgggtaactt
KJ803771_P_P-RF-DB      ctcgggaatctcaatgttagtattccttggactcacaaggtgggaaactt
EU594406_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MF925396_P_P-RF-DC      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaactt
JQ687532_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaagtgggtaactt
X80925_P_P-RF-DE        ctcgggaatctcaatgttagtattccttggactcataaagtgggtaactt
MF925401_P_P-RF-DB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MF925371_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MF925388_P_P-RF-DC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JN664946_P_P-RF-DA      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaactt
MF925392_P_P-RF-DB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KM524357_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KR905422_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KT366503_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
AB330368_P_P-RF-DA      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KF471643_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggacgcataaggtgggaaactt
MF925397_P_P-RF-DC      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaactt
MF925384_P_P-RF-DB      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JF754613_P_P-RF-DE      ctcggggatctcaatgttagtattccttggactcataaggtgggaaactt
AB674436_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaactt
JN040798_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JN257191_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JN642137_P_P-RF-DE      ctcgggaaccccaatgttagcattccttggactcataaggtgggaaactt
JN642141_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
JN642152_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
AB674432_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JF754616_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
AB674433_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JN257189_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JN642127_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaattt
JN257206_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JN257216_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JN257174_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JN257210_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
JN257164_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JN642139_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MK052957_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaattt
MK052969_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaattt
JN688715_P_P-RF-DE      ctcgggaacctcaatgttaatattccttggactcataaggtggggaactt
DQ464164_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
DQ464167_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaagtggggaactt
DQ464165_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
DQ464166_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
KJ586811_P_P-RF-DF      ctccagcttcccaatgttagtattccttggactcataaggtgggaaattt
JN688689_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtggggaactt
AB270538_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaactt
KC774450_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
EF103284_P_P-RF-AD      ctagggaacctcaatgttagtattccttggactcataaggtgggaaactt
AB188243_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KJ647349_P_P-RF-DE      ctcgggaacctcaatgttagtataccttggactcataaggtggggaactt
JF440017_P_P-RF-DA      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaattt
MH724239_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
KM359442_P_P-RF-DE      ctcgggaacctcaatgttagtataccttggactcacaaggtgggaaactt
KM386676_P_P-RF-DE      ctcgggaatctcaatgttagtataccttggactcataaggtggggaactt
KM577666_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MN507835_P_P-RF-DE      ctcggggatcccaatgttagtgttccttggactcataaggtgggaaactt
MF488702_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KF679991_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JN664943_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaactt
GQ183486_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
AB188245_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MK598656_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MK598654_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
MK598652_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
MK598653_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KT366504_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
EF103285_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KM577667_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
AB583679_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MN507850_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KM577665_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KM577663_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KM577664_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KT366492_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
AY373430_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
KM524359_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
AJ627217_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
EU594435_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
MK618439_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
DQ111987_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
EU594436_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
FJ349221_P_P-RF-DE      ctcggggatctcaatgttagtattccttggactcataaggtggggaactt
KX827302_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
MH464835_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggacacataaggtggggaacca
MH724243_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
EU185780_P_P-RF-AD      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
KC012653_P_P-RF-AD      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
MH724222_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
AJ627221_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtggggaactt
FJ349212_P_P-RF-DE      ctcgggaacctcaatgttagtgttccttggactcataaggtggggagctt
JF440013_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440012_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440008_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440011_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440004_P_P-RF-DE      cttgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440005_P_P-RF-DE      cttgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440001_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF439999_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440010_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440006_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440002_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440003_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440000_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF439998_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF439995_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF439994_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440009_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440007_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440015_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF439996_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JF440014_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
MK618440_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtggggaactt
MK618438_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtggggaactt
MK618444_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtggggaactt
MK618442_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
MK618445_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
AB210819_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtggggaattt
JX898698_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JX898699_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
AJ344117_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JX898690_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
MF967563_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtggggaactt
U95551_P_P-RF-DE        ctcgggaacctcaatgttagtattccttggactcataaggtggggaactt
JX898686_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JX898687_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JX898688_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JX898693_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JX898695_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
JX898696_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
MH724240_P_P-RF-DE      ctcgggaacctcaatgttagtattccttggactcataaggtggggaattt
AY233293_P_P-RF-DE      ctcggggatctcaatgttagtattccttggactcataaggtggggaattt
GU563560_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
MH464850_P_P-RF-DA      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
AY233295_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
MH464851_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
MH464846_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
MH464852_P_P-RF-DE      ctcgggaatctcaatgttagtattccttggactcataaggtggggaactt
KX765835_P_P-RF-GC      ctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactt
KF219922_P_P-RF-GH      ctccagcttcccaatgttagtattccttggactcacaaggtgggaaactt
AB222708_P_P-RF-AD      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JQ272886_P_P-RF-GF      ctccagcttcccaatgttagtattccttggactcataaggtgggaaattt
JQ272887_P_P-RF-GF      ctccagcttcccaatgttagtattccttggactcataaggtgggaaattt
EF464099_P_P-RF-AG      ctccagcttcccaatgttagtattccttggactcacaaggtgggaaactt
HE981180_P_P-RF-GF      ctccagcttcccaatgttagtattccttggactcacaaggtgggaaactt
KP274926_P_P-RF-GA      ctccagcttcccaatgttagtattccttggactcacaaggtgggaaactt
AB933279_P_P-RF-AG      ctccagcttcccaatgttagtattccttggactcacaaggtgggaaactt
AB933280_P_P-RF-AG      ctccagcttcccaatgttagtattccttggactcacaaggtgggaaactt
AB933281_P_P-RF-AG      ctccagcttcccaatgttagtattccttggactcacaaggtgggaaactt
EU833890_P_P-RF-GA      ctccagcttcccgatgttagtattccttggactcacaaggtgggaaactt
AF297619_P_P-RF-DA      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
AF297620_P_P-RF-DA      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JQ707426_P_P-RF-GA      ctccagcttcccgatgttagtattccttggactcacaaggtgggaaactt
JF439776_P_P-RF-AG      ctccagcttcccaatgttagtattccttggactcacaaggtgggaaactt
MF925386_P_P-RF-AC      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
AB453985_P_P-RF-AC      ctcgggaacctcaatgttagtattccttggactcataaggtgggaaactt
AB933282_P_P-RF-AG      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
AB933283_P_P-RF-AG      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JF440021_P_P-RF-AG      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JF440019_P_P-RF-AG      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
JF440022_P_P-RF-AG      ctcgggaatctcaatgttagtattccttggactcataaggtgggaaactt
                        **       *    **         * **    ** *  *  **      

FN594767_P_P-RF-DE      tacggggctttactcttctactatacctgtctttaatcctaactggaaaa
GQ161806_P_P-RF-EA      tacggggctttactcttctaccatacctgtcttcaatcctaactggaaaa
KJ717794_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KJ803788_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KF053179_P_P-RF-BC      tacggggctttattcttctacggtacctagctttaatcctaaatggcaaa
KJ803772_P_P-RF-BC      tacggggctttattcttctacggtacctagctttaatcctaaatggcaaa
KF873530_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873537_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU679945_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873540_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873538_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873543_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873542_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873535_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU679939_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU679940_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU679952_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873534_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873531_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873532_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873533_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873521_P_P-RF-BC      tactgggctttattcttctactgtacctgtcttcaatcctgagtggcaaa
KU679955_P_P-RF-CB      tactgggctttattcttctactgtacctgtcttcaatcctgagtggcaaa
KU679950_P_P-RF-CB      tactgggctttattcttctactgtacctgtcttcaatcctgagtggcaaa
KU679944_P_P-RF-BC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU679953_P_P-RF-BC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU679948_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KF873519_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU679946_P_P-RF-BC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873517_P_P-RF-BC      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KF873518_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KF873511_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873513_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873515_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU679954_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU679942_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU679943_P_P-RF-BC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873527_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU679956_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU679958_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873522_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873523_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF873524_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU679941_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF053166_P_P-RF-BC      tactgggctttattcttcttccgtacctgtctttaatcccgactggcaaa
KJ803827_P_P-RF-BC      tactgggctttattcttcttccgtacctgtctttaatcccgactggcaaa
FR714496_P_P-RF-CB      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
MG826145_P_P-RF-BC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
MH746813_P_P-RF-BC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
MH746811_P_P-RF-BC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
MH746812_P_P-RF-BC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
MH368022_P_P-RF-GC      taccgggctttattcttctactatacctgtctttaatcctgagtggcaaa
FR714490_P_P-RF-GB      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC172106_P_P-RF-GB      taccgggctttattcttctactgtacctatctttaatcctgagtggcaaa
KY470996_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY471004_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY470998_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY471001_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY471007_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY470997_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY470999_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY471000_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY471002_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY471003_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY471006_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY471005_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KP148441_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KP148449_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KP148447_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KP148586_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KP148442_P_P-RF-BC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KP148450_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ023659_P_P-RF-BC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ023662_P_P-RF-GC      taccgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU835240_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatccggaatggcaaa
FJ023666_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ023670_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ882611_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU833891_P_P-RF-GC      tactggactttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ882610_P_P-RF-GC      tactggactttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ882614_P_P-RF-GC      tactggactttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ882617_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ882612_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ882618_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ882613_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ023665_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ023667_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ023673_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ023664_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ023668_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AB241109_P_P-RF-CB      tacggggctttattcttctaatgtacctgtctttaaccctgagtggcaaa
FJ361772_P_P-RF-GC      tactgggctttattcttctactgtacctgtctttaatcctgactggaaaa
HQ700519_P_P-RF-CB      tactgggctttactcttctactacacctgtctttaatcctgagtggcaaa
HQ700521_P_P-RF-CB      tactggtctttattcttctactacacctgtctttaatcctgagtggcaaa
KJ803822_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF053186_P_P-RF-BC      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KJ803778_P_P-RF-BC      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KX660686_P_P-RF-DC      tactgggctttattcttcttctgtacctgtctttaatcctcagtggcaaa
DQ478890_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KX660684_P_P-RF-DC      tactgggctttattcttcttctgtacctgtctttaatcctcagtggcaaa
AY057948_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KT991427_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
FJ562263_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KT991424_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
AY817511_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KX660689_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HM750144_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HM750150_P_P-RF-DC      tactggcctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774485_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KP276253_P_P-RF-DC      tactgggctttattcttcttctgtacctgtctttaatcctcagtggcaaa
HM750146_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KP276256_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HM750145_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KX354997_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HM750148_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HM750147_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HM750143_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HM750149_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ349241_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774456_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HM750142_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774482_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774461_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY470853_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY470844_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY470843_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY470846_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY470847_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY470849_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY470850_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY470855_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY470854_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KX660685_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774475_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774433_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774431_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY629632_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774498_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KT991421_P_P-RF-DC      tactggcctttattcttctactgtacctgtctttaatcctgagtggcaaa
KT991419_P_P-RF-DC      tactggcctttattcttctactgtacctgtctttaatcctgagtggcaaa
KT991420_P_P-RF-DC      tactggcctttattcttctactgtacctgtctttaatcctgagtggcaaa
KT991423_P_P-RF-DC      tactggcctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ562278_P_P-RF-DC      tactggcctttattcttctactgtacctgtctttaatcctgagtggcaaa
KT991417_P_P-RF-DC      tactggcctttattcttctactgtacctgtctttaatcctgagtggcaaa
AB270535_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgattggcaaa
KC774486_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgattggcaaa
KC774453_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY670781_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774454_P_P-RF-DC      tactgggctttattcttctactgttcctgtctttaatcctgagtggcaaa
DQ478898_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU787435_P_P-RF-DC      tactgggctttattcttctactgtccctgtctttaatcctgagtggcaaa
KC774492_P_P-RF-DC      tactgggctttattcttctactgtccctgtctttaatcctgagtggcaaa
AY800249_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774422_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774483_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774458_P_P-RF-DC      tactggcctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU787434_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatccggagtggcaaa
KC774420_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774426_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774474_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AY817515_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774457_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774447_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774495_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AY817512_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774490_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatccagagtggcaaa
DQ478886_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774425_P_P-RF-DC      tactgggctttattcttctactatacctgtctttaatcctgagtggcaaa
KC774428_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AY862866_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AY862864_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AY862865_P_P-RF-DC      tactgggctttattcttctaccgtacctgtctttaatcctgagtggcaaa
JF491455_P_P-RF-DC      tactgggctatattcttctactgtacctgtctttaatcctgagtggcaaa
KC774481_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JF491451_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KC774478_P_P-RF-DC      tactgggctttattctactactgcacctgtctttaatcctgagtggcaaa
KC774480_P_P-RF-DC      tactgggctttattctactactgtacctgtctttaatcctgagtggcaaa
KX660674_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KX660680_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774476_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774439_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774449_P_P-RF-DC      tactggcctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774470_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JF491449_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774484_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774452_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774442_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774443_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774435_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774455_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KX660677_P_P-RF-DC      tactgggctttattcttctactgcacctgtctttaatcctgagtggcaaa
KC774479_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KX660675_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774448_P_P-RF-DC      tactgggctttactcttctactgtacctgtctttaatcctgagtggcaaa
KC774430_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KF917451_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774466_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774488_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774493_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU519422_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AY817513_P_P-RF-DC      tactgggctttattcgtctactgtacctgtctttaatcctgagtggcaaa
KC774487_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AY817509_P_P-RF-DC      tactgggctttattcttctactatacctgtctttaatcctgagtggcaaa
JF491448_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AY817510_P_P-RF-DC      tactgggctttattcttctacggtacctgtctttaatcctgagtggcaaa
KU519423_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774499_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774489_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774432_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774434_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JX429898_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KP276254_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KP276255_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JF491456_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774424_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
DQ478889_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
DQ478887_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
DQ478892_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774468_P_P-RF-DC      tactgggctttattcttccactgtacctgtctttaatcctgagtggcaaa
DQ478897_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774423_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774471_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774497_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774494_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774463_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774472_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
MG826150_P_P-RF-BC      tactggcctttattcttctactgtacctgtctttaatcctgactggcaaa
MG826151_P_P-RF-BC      tactggcccttattcttctactgtacctgtctttaatcctgactggcaaa
HQ700520_P_P-RF-CB      tactgggctttattcttctacagtacctgtctttaatcctgagtggcaaa
AB105172_P_P-RF-CB      tactgggctttattcttctactgtacccgtctttaatcctgaatggcaaa
AP011102_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatccggagtggcaaa
AB493842_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AP011103_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AB493838_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatgctgagtggcaaa
AB493847_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatgctgagtggcaaa
AB493840_P_P-RF-CB      tactgggctttattcttctactcaacctgtctttaatactgagtggcaaa
AB493837_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatactgagtggcaaa
GQ358155_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatactgagtggcaaa
GQ358156_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatactgagtggcaaa
HQ700518_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HQ700527_P_P-RF-CB      tactgggctttattcttctacggtacctgtctttaatcctgagtggcaaa
HQ700528_P_P-RF-CB      tactgggctttattcttctacggtacctgtctttaatcctgagtggcaaa
HQ700530_P_P-RF-CB      tactgggctttactcttctactgtacctgtctttaatcctgagtggcaaa
HQ700523_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HQ700531_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HQ700532_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
MF925389_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgactggcaaa
FJ386674_P_P-RF-BC      tacggggctttattcttctacggtaccttgctttaatcctgaatggcaaa
EU660227_P_P-RF-BC      tactgggctttattcttctactgtacctgtctttaatcccgagtggcaaa
MG826147_P_P-RF-CB      tactggcctttattcttctactgtacctgtctttaatcctgactggcaaa
MG826141_P_P-RF-CB      tactggcctttattcttctactgtacctgtctttaatcctgactggcaaa
MG826142_P_P-RF-CB      tactggcctttattcttctactgtacctgtctttaatcctgactggcaaa
MG826148_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KJ598675_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggaaaa
MG826146_P_P-RF-CB      tactggactttattcttctactgtacctgtctttaatcctgagtggcaaa
KT003704_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KP148352_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AP011104_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AP011105_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
LC416040_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AB031265_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgactggcaaa
KJ717832_P_P-RF-CB      tactggactttattcttctacggtacctgtctttaatcctgactggcaaa
KJ803804_P_P-RF-CB      tactgggctttactcttctactgtacctgtctttaatcctgactggcaaa
AB674504_P_P-RF-DC      tactgggctttattcttctactgtacctgtctttaatcctgactggcaaa
KJ803798_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgactggcaaa
JF436923_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgactggcaaa
KJ803785_P_P-RF-CB      tactgggctttattcttctactgttcctgtctttaatcctgactggcaaa
KJ410506_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggaaaa
MF925382_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgactggcaaa
MF925370_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgactggcaaa
MF925381_P_P-RF-CB      cactgggctttattcttctactgtacctgtctttaattctgactggcaaa
GQ924618_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgactggcaaa
JQ027310_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgattggcaaa
GQ377595_P_P-RF-BC      tacggggctttattcttctacggtacctggctttaatcctgaatggcaaa
EU882006_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC315400_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
HQ684848_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaattggcaaa
MK052976_P_P-RF-BD      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
MK052967_P_P-RF-BD      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
MK052970_P_P-RF-BD      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
MK052968_P_P-RF-BD      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
JQ801477_P_P-RF-BC      tacggggctttattcttctacggtaccttgctttaatcctaattggcaaa
MH094410_P_P-RF-BC      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
KC774414_P_P-RF-BC      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
EU939627_P_P-RF-BC      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
KJ410497_P_P-RF-BC      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
KJ717800_P_P-RF-CB      tacggggctttattcttctacggtacctagctttaatcctaaatggcaaa
KJ803791_P_P-RF-CB      tacggggctttattcttctacggtacctagctttaatcctaaatggcaaa
KJ717816_P_P-RF-CB      tactgggctttactcttctactgtacctgtctttaatcctgactggcaaa
KF053188_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
KJ803782_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
KJ717815_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
KJ803803_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
KJ717814_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
KJ803802_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
KF053160_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgactggcaaa
KJ803753_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgactggcaaa
GQ377592_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaattggcaaa
EU939623_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377556_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaattggcaaa
EU939630_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
EU939620_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377539_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
FJ562229_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377594_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377602_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
FJ562247_P_P-RF-CB      tacggggctgtattcttctacggtaccttgctttaatcctaactggcaaa
GQ377626_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377565_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377634_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
EU939621_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
FJ562328_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377573_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377613_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
JQ040174_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377604_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377590_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377549_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377564_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377596_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
GQ377614_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
HQ700542_P_P-RF-CB      tactgggctttattcttctactatacctgtctttaatcctgagtggcaaa
EU939631_P_P-RF-BC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU939629_P_P-RF-BC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
GQ377635_P_P-RF-BC      tactgggctttactcttctactgtacctgtctataatcctgagtggcaaa
GQ377630_P_P-RF-BC      cactgggctttattcttctactgtacctgtctttaattctgaatggcaaa
KC774178_P_P-RF-BC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774364_P_P-RF-BC      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC793112_P_P-RF-BC      tacgggactttattcttctacggtaccttgctttaatcctaattggcaaa
KP148337_P_P-RF-BC      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
KJ173279_P_P-RF-CB      tacggggctttattcttctacggtacctgtctttaatcctgaatggcaaa
KJ173358_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
KJ173349_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaaccctaaatggcaaa
KJ173350_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctaaatggcaaa
KJ173320_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaattctgagtggcaaa
KJ173322_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaattctgagtggcaaa
FJ386646_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
MG826149_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HQ700526_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
X75656_P_P-RF-CB        tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
HQ700580_P_P-RF-CB      tactgggctttattcttccactgtacctgtctttaatcctgaatggcaaa
HQ700498_P_P-RF-CB      tactgggctttattcttccactgtacctatctttaatcctgagtggcaaa
HQ700499_P_P-RF-CB      tactgggctttattcttccactgtacctatctttaatcctgagtggcaaa
KU695745_P_P-RF-CB      tactgggctttattcttccactgtacctgtctttaatcctgagtggcaaa
HQ700554_P_P-RF-CB      tactgggctttattcttccactgtacctgtctttaatcctgaatggcaaa
HQ700560_P_P-RF-CB      tactgggctttattcttccactgtacctgtcttcaatcctgagtggcaaa
HQ700557_P_P-RF-CB      tactgggctttattcttccactgtacctgtctttaatcctgagtggcaaa
HQ700462_P_P-RF-CB      tactgggctttattcttccactgtacctgtctttaatcctgaatggcaaa
HQ700485_P_P-RF-CB      tactgggctttattcttccactgtacctgtctttaatcctgaatggcaaa
AP011108_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatccggagtggcaaa
KU695746_P_P-RF-CB      tacggggctttattcttctactgtccctgtctttaatcctgagtggcaaa
HQ700505_P_P-RF-CB      tactgggctttattcttctaccgttcctgtctttaatcctgagtggcaaa
KU695744_P_P-RF-CB      tacggggctttattcttctactgtccctgtctttaatcctgagtggcaaa
KU695741_P_P-RF-CB      tactgggctttattcttctactgtccctgtctttaatcctgagtggcaaa
KU695743_P_P-RF-CB      tactgggctttattcttctactgtccctgtctttaatcctgagtggcaaa
HQ700509_P_P-RF-CB      tactggrctttattcttctactgtacctgtctttaatactgaatggcaaa
HQ700515_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatactgaatggcaaa
HQ700507_P_P-RF-CB      tactgggctttattcttctactgtccctgtcttcaatcctgaatggcaaa
HQ700508_P_P-RF-CB      tactgggctttattcttctactgtccctgtcttcaatcctgaatggcaaa
EU522070_P_P-RF-CB      tactgggctttattctactactgtacctgtctttaatcctgagtggcaaa
KU695742_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HQ684849_P_P-RF-BC      tactggactttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774198_P_P-RF-CB      tactgggctttattcttctactataccggtctttaatcctgagtggcaaa
KC774201_P_P-RF-CB      tactgggctttattcttctactataccggtctttaatcctgagtggcaaa
KC774307_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774323_P_P-RF-CB      tactggggcttattattctacagtacctgtctttaatcctgagtggcaaa
KC774193_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774291_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AY206374_P_P-RF-CB      tactgggctttattctcctactgcacctgtctttaatcctgagtggcaaa
GQ377560_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AB033557_P_P-RF-CB      tactgggctttattcttcttccgtacctgtctttaatcctgattggcaaa
HQ700547_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JX504540_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
MG826144_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
JF436919_P_P-RF-CB      tactgggctttactcttctactgtacctgtctttaatcctgagtggcaaa
KX096713_P_P-RF-CA      tactgggctttattcttctactgtacctgtctttaaccctgagtggcaaa
FJ562317_P_P-RF-CB      cactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
EU589337_P_P-RF-CB      tactggactttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ032343_P_P-RF-CB      tacggggctttattcttctacggtaccttgctttaatcctgaatggcaaa
KC774246_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JQ040175_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
GQ475335_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU881995_P_P-RF-CB      tactggtctttattcttctactgtacctgtctttaatcccgagtggcaaa
FJ032337_P_P-RF-CB      tactgggctttattcttctactgcacctgtctttaatcctgagtggaaaa
EF494376_P_P-RF-CA      tactgggctttattcctctacagtacctatctttaatcccgaatggcaaa
AB300369_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ562294_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU939547_P_P-RF-CB      cactgggctttactcttctactgtacctgtctttaatcctgagtggcaaa
JQ040148_P_P-RF-CB      tactgggcttkattcttctactgtacctgtctyyaatcctgagtggcaaa
JX661485_P_P-RF-CB      tactgggctttactcttctactgtacctgtctttaatcctgagtggcaaa
JQ040142_P_P-RF-CB      tactggactttactcttctactgtacctgtctttaatcctgagtggcaaa
JX661486_P_P-RF-CB      tactgggctttactcttctactgtacctgtctttaatcctgagtggcaaa
MG893554_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatccggagtggcaaa
MG893555_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatccggagtggcaaa
KR013843_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgattggcaaa
GQ377522_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaaccctgagtggcaaa
AB367800_P_P-RF-CB      tactggcctttattcttctactgtacctgtctttaatcctgagtggcaaa
AY247030_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaattctgagtggcaaa
JQ732168_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AY040627_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AB049609_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AB367400_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AB642096_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AB367419_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
AB205152_P_P-RF-CB      tactggactttattcttctactgtacctgtctttaatcctgagtggcaaa
AY123041_P_P-RF-CB      tactgggctttattcttctactgtacctgtccttaatcctgagtggcaaa
AF330110_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JF828935_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JF828936_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JF828938_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JF828933_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JF828934_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ562302_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
Y18857_P_P-RF-CB        tactgggctttattcttctactgtacctgtctttaatcctgagaggcaaa
KC774212_P_P-RF-CB      tactgggctttattcttctactgcacctgtctttaatcctgagtggcaaa
EU939668_P_P-RF-CB      tacggggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU919166_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU919167_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ386586_P_P-RF-CB      tactggcctttattcttctactgtacctgtctttaatcctgagtggcaaa
DQ089798_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963862_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963868_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963859_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963869_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963856_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963857_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963858_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963861_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963863_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963864_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963865_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963866_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963867_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963870_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963860_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU916239_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU916241_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU916240_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AB195950_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgattggcaaa
AB195951_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgattggcaaa
EU939551_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ562267_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU939577_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
Y18856_P_P-RF-CB        tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JQ040146_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774188_P_P-RF-CB      tactggactttattcttctactgtacctgtctttaatcctgattggcaaa
GU357843_P_P-RF-CB      tactggactttattcttctactgtacctgtctttagtcctgagtggcaaa
AF233236_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcccgagtggcaaa
AB367393_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU717211_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JN400086_P_P-RF-CB      tactgggctttattcttctactgtacctgtttttaatcctgagtggcaaa
AF411409_P_P-RF-CB      tactggtctttattcttctactgtacctgtctttaatcctgagtggcaaa
KJ173329_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ562226_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU871994_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
EU871995_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtgacaaa
EU871989_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
EU871991_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
EU871992_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
EU871996_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
EU871993_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagcggcaaa
EU871984_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
EU871985_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
EU871983_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
EU871999_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
EU871981_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
EU871986_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
EU871990_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
EU871987_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
EU871988_P_P-RF-CB      tactgggctttattcatctactgtacctgtctttaatcctgagtggcaaa
KC774324_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774222_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
GU385774_P_P-RF-CB      tactgggctttattcttctacggtacctgtctttaatcctgagtggcaaa
EU787444_P_P-RF-CB      tactgggctttattcttctactgtacccatctttaattctgaatggcaaa
AB670303_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY363263_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774344_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JX661498_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU939606_P_P-RF-CB      tactgggctttattcctctactgtacctatctttaatcctgattggcaaa
FJ386635_P_P-RF-CB      tactgggctttattcctctactgtacctatctttaatcctgagtggcaaa
JX661487_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY881840_P_P-RF-CB      tactgggctttattcttctactgtacctatctttaatcctgagtggcaaa
M38454_P_P-RF-CB        tactgggctttattcttctactgtacctatctttaatcctgagtggcaaa
AY123424_P_P-RF-CB      tactgggctttattcttctactgtacctatctttaatcctgagtggcaaa
EU871997_P_P-RF-CB      tactgggctttattcttctactgtacctatctttaatcctgagtggcaaa
GQ377534_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU939565_P_P-RF-CB      tactggtctttattcttctactgtacctgtctttaatcctgagtggcaaa
GQ377520_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
GQ377581_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
GQ377607_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
EU939589_P_P-RF-CB      tactggcctttattcttctactgtacctgtctttaatcctgagtggcaaa
GQ377516_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
GQ377544_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
LC279266_P_P-RF-CB      tactgggctttattcttatactgtacctgtctttaatcctgagtggcaaa
LC279267_P_P-RF-CB      tactgggctttattcttatactgtacctgtctttaatcctgagtggcaaa
LC279265_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
LC279263_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
LC279264_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KM213033_P_P-RF-CB      tactgggctttattcctctactgtacctgtctttaattctgaatggcaaa
KC774258_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AB195940_P_P-RF-CB      tactggactttattcttctactgtacctgtctttaatcctgagtggcaaa
AB195941_P_P-RF-CB      tactggactttattcttctactgtacctgtctttaatcctgagtggcaaa
AB195939_P_P-RF-CB      tactggactttattcttctactgtacctgtctttaatcctgagtggcaaa
AB195955_P_P-RF-CB      tactggactttattcttctactgtacctgtctttaatcctgagtggcaaa
AB195956_P_P-RF-CB      tactggactttattcttctactgtacctgtctttaatcctgagtggcaaa
AB195957_P_P-RF-CB      tactggactttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ562227_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ562314_P_P-RF-CB      tactgggctttattcttctaccgtacctgtctttaattctgagtggcaaa
MG893559_P_P-RF-CB      tactgggctttattcttctaccgtacctgtctttaatcctgagtggcaaa
FJ386633_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ562305_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KC774305_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774234_P_P-RF-CB      tactggtctttattcttctactgtacctgtctttaatcctgaatggcaaa
EU916232_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964306_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964316_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964313_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964308_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964307_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964303_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964009_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964008_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964007_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964005_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964006_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964010_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964304_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964305_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964309_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964310_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964312_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964314_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964315_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964317_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
KU964311_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
AF461361_P_P-RF-CB      tactgggctttattcttctactnttcctgtctttaatcctgagtggcaaa
FJ386593_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KM875422_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgattggcaaa
KC774349_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU964351_P_P-RF-CB      tactggactttattcttctactgtccctgtctttaatcctgagtggcaaa
KJ410520_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AB198084_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
HM750133_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
AY167095_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcccgagtggcaaa
KC774263_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaattctgaatggcaaa
KC774332_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaattctgaatggcaaa
KC774341_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaattctgaatggcaaa
KJ173299_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KJ173300_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KR013806_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JF436922_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
GQ377611_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgattggcaaa
JX429896_P_P-RF-CB      tactgggctttattcttctactgttcctgtctttaatcctgagtggcaaa
JX661494_P_P-RF-CB      tactgggctttattcttcttctgttcctgtctttaatcctgagtggcaaa
KU963883_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgattggcaaa
KR013816_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
GQ377548_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ386649_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ386578_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ386585_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
GQ377633_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774328_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
JX026887_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774317_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774322_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ562287_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963993_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963991_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963990_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963994_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963995_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963998_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU963999_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU964001_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KU964003_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KJ173325_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KJ173326_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774230_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774183_P_P-RF-CB      tactgggctttattcttccactgtacctgtctttaatcctgagtggcaaa
KC774186_P_P-RF-CB      tactgggctttattcttccactgtacctgtctttaatcctgagtggcaaa
MK321265_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgattggcaaa
MK720627_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgattggcaaa
MK720628_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgattggcaaa
MG893561_P_P-RF-CB      tactgggctttattcttctactgtgcctgtctttaatcctgagtggcaaa
LC458432_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatccggagtggcaaa
FJ787446_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ787480_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
FJ386581_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KC774294_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KY470893_P_P-RF-CB      tactgggctttattcttctactgtacctgtctttaatcctgagtggcaaa
KJ586803_P_P-RF-AF      tacgggactctattcctctactgttcctacttttaatcctgactggttaa
KJ586810_P_P-RF-AF      tacgggactctattcctctactgttcctacttttaatcctgactggttaa
EF494378_P_P-RF-CA      tactgggctttattcttctactgtacctgtctttaatcctgattggcaaa
JQ801476_P_P-RF-CG      tacggggctttactcttctactatacctgtctttaatcctgattggcaaa
HE981179_P_P-RF-FG      tacggggctctactcttctactgtacctgctttcaatcctcactggttaa
FJ562223_P_P-RF-CD      tacggggctttattcttctactgtacctgtctttaaccctgattggaaaa
GQ377627_P_P-RF-CD      tacggggctttattcttctactgttcctgtctttaaccctcattggaaaa
MF488705_P_P-RF-AD      tacggggctttattcttctactgtccctatctttaatcctgaatggcaaa
AY233277_P_P-RF-AC      tactgggctttattcctctactgtccctatctttaatcctgaatggcaaa
KF214656_P_P-RF-AC      tactgggctttattcttctactgtccctatctttaatcctgaatggcaaa
HM146131_P_P-RF-AD      tactgggctttattcttctactgtccctatctttaaccctgaatggcaaa
AY161145_P_P-RF-AD      tactgggccttattcttcatctgtccctatctttaatcctgaatggcaaa
AY161146_P_P-RF-AD      tactgggccttattcttcatctgtccctatctttaatcctgaatggcaaa
MF925404_P_P-RF-AC      tactgggctttattcttctactgtccctatctttaatcctgaatggcaaa
AY161140_P_P-RF-AD      cactgggctttattcttctactgtccctatcctcaatcctgaatggcaaa
AY161141_P_P-RF-AD      cactgggctttattcttctactgtccctatcctcaatcctgaatggcaaa
AB194949_P_P-RF-AE      tactgggctttattcttctactgtacctatctttaatcctgaatggcaaa
GQ331048_P_P-RF-AE      tactgggctttattctactactgtacctacctttaatcctgattggcaaa
GQ161753_P_P-RF-AE      tactgggctttattcttctactgtacctgtctttaatcctgaatggcaaa
GQ161767_P_P-RF-AE      taccggtctttattcctctactgtacctatctttaatcctgaatggcaaa
GQ161837_P_P-RF-AE      tactggtctttattcctctactgtacctatctttaatcctgaatggcaaa
HF571060_P_P-RF-AE      tactggtctttattcctctactgtacctatttttaatcctgaatggcaaa
AY236161_P_P-RF-DA      tactgggctttattcttctactgtacctgtctttaatcctcattggaaaa
X65259_P_P-RF-DA        tacggggctttattcttctactgttcctgtctttaatcctcattggaaaa
X68292_P_P-RF-DA        tactgggctttattcttctactgtacctgtctttaatcctcattggaaaa
MF488699_P_P-RF-DE      taccgtgctttattcttctactgtacctgtctttaaccctcattggaaaa
JN664929_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
AB033558_P_P-RF-DE      tacggggctttattcttcttctgtacctgtatttaaccctcattggaaaa
JN664933_P_P-RF-DA      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
JN664925_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KC875338_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KC875339_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
JN664915_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
GQ205378_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
GQ205377_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
GQ205387_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
GQ205386_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
GQ205379_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
MK516279_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
MK516280_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
MK541689_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
JN664934_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
JN664940_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
DQ315779_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KT366505_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
MH685719_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KU736916_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357641_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KU736917_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KU736914_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KU736915_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KP168420_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KP168421_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FJ904397_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FJ904442_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaacactcattggaaaa
FJ904436_P_P-RF-DE      tacggggctttattcttccactgtacctgtttttaactctcagtggaaaa
AM494716_P_P-RF-DE      tacggggctttattcttctactgcacctgtctttaaccctcagtggaaaa
GU177079_P_P-RF-DE      tacggggctttattcttctactgcacctgtctttaaccctcattggaaaa
FJ904405_P_P-RF-DE      cacggggctttattcttatactgtacctgtctttaaccctcattggaaaa
FJ904437_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FJ904416_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FJ904417_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FJ904398_P_P-RF-DE      tacagggctttattcttctactgtacctgtctttaaccctcattggaaaa
KP288875_P_P-RF-DE      tacggggctttattcttcttctgtacctgtctttaaccctcattggagaa
FJ904430_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FJ904414_P_P-RF-DE      cacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FJ904444_P_P-RF-DE      tacggggctttattcttctactgtacccgtatttaaccctcattggaaaa
FJ904396_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FJ904403_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaacccccattggaaaa
FJ904401_P_P-RF-DE      tacggggctttattcttctaatgtacctgtctttaaccctcattggaaaa
FJ904404_P_P-RF-DE      tacggggctttattcttcttctgtacctgtctttaaccctcattggaaaa
FJ904408_P_P-RF-DE      tacggggttttattcttctactgtacctgtctttaaccctcattggaaaa
FJ904409_P_P-RF-DE      tacggggctttattcttctactgaacctgtctttaaccctcattggaaaa
FJ904394_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FJ904407_P_P-RF-DE      tacggggctttactcttctactgtacctgtctttaaccctcattggaaaa
FJ904447_P_P-RF-DE      tacggggatttattcttctactgtacccgtctttaaccctcattggaaaa
KF170740_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KP168416_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KU736923_P_P-RF-DE      tacggggttgtattcttctactgtacctgtctttaatcctcattggaaaa
KX357627_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357631_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357628_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357632_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357626_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357624_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357625_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357629_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357634_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357630_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357633_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357623_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357635_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX357636_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaatcctcattggaaaa
KP168417_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KP168418_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KU736921_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcagtggaaaa
KU736922_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcagtggaaaa
KU711666_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FJ349207_P_P-RF-DE      tacggggctttattcttctactgcacctgtctttaaccctcattggaaaa
FJ904425_P_P-RF-DE      tacggggctttattcttctactctacctgtctttaacccgcattggaaaa
FJ904441_P_P-RF-DE      tacggggctttattcttctactgcacctgtctttaaccctcattggaaga
FJ904400_P_P-RF-DE      cacggggctttactcttctactgtacctgtctttaaccctcattggaaaa
FJ904406_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FJ904440_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KX827299_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KM606741_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KP995112_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KM606750_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KM606751_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FN594770_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FN594771_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FN594769_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
GQ161754_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KU668440_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KJ470898_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KJ470892_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KJ470897_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaatcctcattggaaaa
KJ470891_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KJ470887_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KJ470888_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KJ470890_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KJ470884_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KJ470886_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaatcctcattggaaaa
MF618346_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
MF618347_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KF192835_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KF192840_P_P-RF-DE      tactgggctttattcttctactgtacctgtctttaatcctcattggaaaa
KF192841_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KF192833_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KF192836_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KF192837_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KF192838_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KF192839_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
FJ692536_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KF779353_P_P-RF-DA      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
HQ700494_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
AB048702_P_P-RF-DE      tactgggctttattcttctactgtacctgtctttaaccctcattggaaaa
AB048703_P_P-RF-DE      tactgggctttattcttctactgtacctgtctttaaccctcattggaaaa
HQ700492_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
MH481860_P_P-RF-DE      tactgggctttattcttctactgtacctgtctttaaccctcattggaaaa
MH481859_P_P-RF-DE      tactgggctttattcttctactgtacctgtctttaaccctcattggaaaa
MH481862_P_P-RF-DE      tactgggctttattcttctactgtacctgtctttaaccctcattggaaaa
MH481858_P_P-RF-DE      tactgggctttattcttctactgtacctgtctttaaccctcattggaaaa
MH481861_P_P-RF-DE      tactgggctttattcttctactgtacctgtctttaaccctcattggaaaa
HQ700493_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700579_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700585_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700536_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700537_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700540_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700503_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700534_P_P-RF-DE      tactgggctttattctactactgtacctgtctttaaccctcattggaaaa
HQ700533_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700584_P_P-RF-DE      tactgggctttattctgttactgtacctgtctttaaccctcattggaaaa
HQ700541_P_P-RF-DE      tactgggctttattctgctactgtacctatctttaaccctcattggaaaa
HQ700535_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700500_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
AB033559_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700524_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700525_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700538_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700497_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700501_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700582_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700581_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
HQ700583_P_P-RF-DE      tactgggctttattctgctactgtacctgtctttaaccctcattggaaaa
JN664935_P_P-RF-DC      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KJ647351_P_P-RF-DE      tactgggctttattcttctactgtacctgtctttaatcctmactggaaaa
KJ647356_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
MF925360_P_P-RF-DB      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
EF103282_P_P-RF-AD      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
EF103283_P_P-RF-AD      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
MF925402_P_P-RF-BD      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
JN257154_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcactggaaaa
JN040803_P_P-RF-DE      tacggggctttattcttctactgtacctgtttttaaccctcattggaaaa
JN642160_P_P-RF-DE      tacggggctttattcttctaccgtacctgtctttaaccctcattggaaaa
JN688717_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
JN257204_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggcaaa
AY341335_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
KJ803771_P_P-RF-DB      tacggggctttattcttctactgcacctgtctttaaccctcattggaaaa
EU594406_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
MF925396_P_P-RF-DC      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
JQ687532_P_P-RF-DE      tacggggctttattcttctactgtacctgtctttaaccctcattggaaaa
X80925_P_P-RF-DE