HBVdb

Dataset for nucleotide sequence C of genotype RF

[Download (right click)] [Edit] [Sequences] [Repertoires]

1427 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


KF219922_C_P-RF-GH      ctggaywgmamaacttgcccatattgcctttttggcttagacattgaccc
JQ272886_C_P-RF-GF      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
HE981179_C_P-RF-FG      atg------------------------------------gacattgaccc
HE981180_C_P-RF-GF      atg------------------------------------gacattgaccc
JQ272887_C_P-RF-GF      atggatagcacaactttgccatatggcctttttggcttagacattgaccc
KJ586803_C_P-RF-AF      atg------------------------------------gacattgaccc
MK534665_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774323_C_P-RF-CB      atg------------------------------------gacattgacac
HQ700580_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873530_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ803771_C_P-RF-DB      atg------------------------------------gacattgaccc
EF494378_C_P-RF-CA      atg------------------------------------gacattgaccc
MG826150_C_P-RF-BC      atg------------------------------------gacattgaccc
FJ032343_C_P-RF-CB      atg------------------------------------gacatcgaccc
FJ386674_C_P-RF-BC      atg------------------------------------gacatcgaccc
KJ803785_C_P-RF-CB      atg------------------------------------gacattgaccc
EU939623_C_P-RF-CB      atg------------------------------------gacattgacac
MK534590_C_P-RF-BC      atg------------------------------------gacattgaccc
GQ377592_C_P-RF-CB      atg------------------------------------gacattgaccc
KR013948_C_P-RF-CB      atg------------------------------------gacattgacac
EU939620_C_P-RF-CB      atg------------------------------------gacattgacac
KJ803822_C_P-RF-CB      atg------------------------------------gacattgacac
FJ562328_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534668_C_P-RF-BC      atg------------------------------------gacattgacca
MK534555_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534728_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534700_C_P-RF-BC      atg------------------------------------gacattgacac
KJ803782_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ803798_C_P-RF-CB      atg------------------------------------gacattgaccc
EU882006_C_P-RF-CB      atg------------------------------------gacattgaccc
MG826151_C_P-RF-BC      atg------------------------------------gacattgaccc
EU660227_C_P-RF-BC      atg------------------------------------gacattgaccc
KJ803791_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534715_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534686_C_P-RF-BC      atg------------------------------------gacattgaccc
EU939621_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534701_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534583_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534615_C_P-RF-BC      atg------------------------------------gacattgaccc
EU939630_C_P-RF-CB      atg------------------------------------gacattgacac
MK534635_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534653_C_P-RF-BC      atg------------------------------------gacattgaccc
GQ377604_C_P-RF-CB      atg------------------------------------gacattgaccc
EU939631_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534641_C_P-RF-BC      atg------------------------------------gacattgaccc
KM213033_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534725_C_P-RF-CB      atg------------------------------------gacattgacac
KX774505_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534724_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534714_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534721_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534559_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534620_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534637_C_P-RF-BC      atg------------------------------------gacattgaccc
GQ377556_C_P-RF-CB      atg------------------------------------gacattgacac
MK052970_C_P-RF-BD      atg------------------------------------gacattgaccc
MT645045_C_P-RF-BC      atg------------------------------------gacattgacac
MK534632_C_P-RF-CB      atg------------------------------------gacattgaccc
JF436919_C_P-RF-CB      atg------------------------------------gacattgaccc
MT645056_C_P-RF-BC      atg------------------------------------gacattgaccc
FJ562229_C_P-RF-CB      atg------------------------------------gacattgacac
KJ410497_C_P-RF-BC      atg------------------------------------gacattgacac
GQ377595_C_P-RF-BC      atg------------------------------------gacattgaccc
EU939627_C_P-RF-BC      atg------------------------------------gacattgacmc
MK534734_C_P-RF-BC      atg------------------------------------gacattgaccc
EU939632_C_P-RF-CB      atg------------------------------------gacattgacac
MK534569_C_P-RF-BC      atg------------------------------------gacattgaccc
KJ803803_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534651_C_P-RF-BC      atg------------------------------------gacattgaccc
GQ377626_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534561_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534630_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534584_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534706_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534594_C_P-RF-BC      atg------------------------------------gacattgaccc
KC774414_C_P-RF-BC      atg------------------------------------gacattgaccc
FJ032337_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534713_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377590_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ173279_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ173280_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534712_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534585_C_P-RF-CB      atg------------------------------------gacattgacac
MK534574_C_P-RF-CB      atg------------------------------------gacattgaccc
JX661498_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ684848_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377594_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534660_C_P-RF-BC      atg------------------------------------gacattgaccc
FJ562247_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534731_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534648_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534563_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534726_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534655_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534681_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534670_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534695_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534718_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534729_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534730_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534716_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534568_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534617_C_P-RF-BC      atg------------------------------------gacattgaccc
MK052968_C_P-RF-BD      atg------------------------------------gacattgaccc
KJ803802_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ173358_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377614_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377602_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377573_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377565_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377564_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377539_C_P-RF-CB      atg------------------------------------gacattgaccc
KC315400_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534646_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534609_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534616_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534607_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534567_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534579_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534580_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534625_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534639_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534560_C_P-RF-CB      atg------------------------------------gacattgaccc
MG826146_C_P-RF-CB      atg------------------------------------gacattgaccc
MG826147_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534564_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534685_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534675_C_P-RF-BC      atg------------------------------------gacattgacgt
GQ377596_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377549_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534562_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534598_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534722_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534717_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534690_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534689_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534688_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534684_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534672_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534664_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534633_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534736_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534618_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534558_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534556_C_P-RF-BC      atg------------------------------------gacattgaccc
MK052967_C_P-RF-BD      atg------------------------------------gacattgaccc
GQ377613_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377634_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534623_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534654_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534723_C_P-RF-BC      atg------------------------------------gacattgaccc
KP148337_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534662_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534687_C_P-RF-BC      atg------------------------------------gacattgaccc
MF925382_C_P-RF-CB      atg------------------------------------gacattgaccc
KU679952_C_P-RF-CB      atg------------------------------------gacatygaccc
KY470865_C_P-RF-GC      atg------------------------------------gacattgaccc
KY470858_C_P-RF-GC      atg------------------------------------gacattgaccc
KY470871_C_P-RF-GC      atg------------------------------------gacattgaccc
JQ027310_C_P-RF-CB      atg------------------------------------gacattgaccc
EU787444_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700554_C_P-RF-CB      atg------------------------------------gacattgacca
KJ803827_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534679_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ475335_C_P-RF-CB      atg------------------------------------gacattgaccc
KU576102_C_P-RF-CB      atg------------------------------------gacattgaccc
KU576103_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ598675_C_P-RF-CB      atg------------------------------------gacattgaccc
KU576384_C_P-RF-CB      atg------------------------------------gacattgacgt
KY363262_C_P-RF-CB      atg------------------------------------gacattgacac
KY363263_C_P-RF-CB      atg------------------------------------gacattgacac
KC774305_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534589_C_P-RF-BC      atg------------------------------------gacattgaccc
MN683730_C_P-RF-DC      atg------------------------------------gacattgaccc
DQ089798_C_P-RF-CB      atg------------------------------------gacattgaccc
KY363272_C_P-RF-CB      atg------------------------------------gacattgaccc
KY363273_C_P-RF-CB      atg------------------------------------gacattgaccc
MN683712_C_P-RF-DC      atg------------------------------------gacattgaccc
EU589339_C_P-RF-CB      atg------------------------------------gacattaacac
MZ439673_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ361772_C_P-RF-GC      atg------------------------------------gacattgaccc
EU939577_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534719_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ386646_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ386586_C_P-RF-CB      atg------------------------------------gacatcgaccc
KY470845_C_P-RF-DC      atg------------------------------------gacattgaccc
KY470848_C_P-RF-DC      atg------------------------------------gacattgaccc
KY470851_C_P-RF-DC      atg------------------------------------gacattgaccc
KY470852_C_P-RF-DC      atg------------------------------------gacattgaccc
KY470853_C_P-RF-DC      atg------------------------------------gacattgaccc
KY470844_C_P-RF-DC      atg------------------------------------gacattgaccc
KY470843_C_P-RF-DC      atg------------------------------------gacattgaccc
KY470846_C_P-RF-DC      atg------------------------------------gacattgaccc
KY470847_C_P-RF-DC      atg------------------------------------gacattgaccc
KY470849_C_P-RF-DC      atg------------------------------------gacattgaccc
KY470850_C_P-RF-DC      atg------------------------------------gacattgaccc
KY470855_C_P-RF-DC      atg------------------------------------gacattgaccc
KY470854_C_P-RF-DC      atg------------------------------------gacattgaccc
KY470856_C_P-RF-DC      atg------------------------------------gacattgaccc
KJ803772_C_P-RF-BC      atg------------------------------------gacattgaccc
EU939547_C_P-RF-CB      atg------------------------------------gacattgaccc
JQ040142_C_P-RF-CB      atg------------------------------------gacattgaccc
JX661486_C_P-RF-CB      atg------------------------------------gacattgaccc
JQ040148_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377635_C_P-RF-BC      atg------------------------------------gacattgaccc
JX661485_C_P-RF-CB      atg------------------------------------gacattgaccc
MG893554_C_P-RF-CB      atg------------------------------------gacattgaccc
MG893555_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534613_C_P-RF-CB      atg------------------------------------gacattgacca
KX765835_C_P-RF-GC      atg------------------------------------gacattgaccc
JQ801477_C_P-RF-BC      atg------------------------------------gacattgaccc
KJ803753_C_P-RF-CB      atg------------------------------------gacattgacca
JQ801476_C_P-RF-CG      atg------------------------------------gacattgaccc
MF925370_C_P-RF-CB      atg------------------------------------gacattgaccc
JN664935_C_P-RF-DC      atg------------------------------------gacattgaccc
MF925381_C_P-RF-CB      atg------------------------------------gacattgaccc
MT645015_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ803804_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534610_C_P-RF-BC      atg------------------------------------gacattgaccc
GQ924618_C_P-RF-CB      atg------------------------------------gacattgaccc
AB674504_C_P-RF-DC      atg------------------------------------gacattgaccc
MK534606_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534735_C_P-RF-CB      atg------------------------------------gacattgaccc
MG826148_C_P-RF-CB      atg------------------------------------gacattgaccc
JF436923_C_P-RF-CB      atg------------------------------------gacattgaccc
JN104438_C_P-RF-CB      atg------------------------------------gacattgaccc
JN104442_C_P-RF-CB      atg------------------------------------gacattgaccc
MF925389_C_P-RF-DC      atg------------------------------------gacattgaccc
KJ410506_C_P-RF-CB      atg------------------------------------gacattgaccc
AB031265_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534682_C_P-RF-CB      atg------------------------------------gacattgaccc
AB367419_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964366_C_P-RF-DC      atg------------------------------------gacattgacac
KU964367_C_P-RF-DC      atg------------------------------------gacattgacac
KU964370_C_P-RF-DC      atg------------------------------------gacattgacac
KU964372_C_P-RF-DC      atg------------------------------------gacattgacac
KU964374_C_P-RF-DC      atg------------------------------------gacattgacac
KU964379_C_P-RF-DC      atg------------------------------------gacattgacac
KU964380_C_P-RF-DC      atg------------------------------------gacattgacac
FJ562263_C_P-RF-DC      atg------------------------------------gacattgaccc
KT991424_C_P-RF-DC      atg------------------------------------gacattgaccc
KT991427_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650068_C_P-RF-DC      atg------------------------------------gacattgaccc
MT645039_C_P-RF-CB      atg------------------------------------gacattgacac
AB205152_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774193_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774291_C_P-RF-CB      atg------------------------------------gacattgacac
KC774307_C_P-RF-CB      atg------------------------------------gacattgacac
KC774449_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650079_C_P-RF-DC      atg------------------------------------gacattgaccc
AY057948_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683680_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683580_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683678_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683721_C_P-RF-DC      atg------------------------------------gacattgaccc
KP276253_C_P-RF-DC      atg------------------------------------gacattgaccc
HM750148_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683725_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683703_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650083_C_P-RF-DC      atg------------------------------------gacattgaccc
KX354997_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774482_C_P-RF-DC      atg------------------------------------gacattgaccc
HM750142_C_P-RF-DC      atg------------------------------------gacattgaccc
DQ478890_C_P-RF-DC      atg------------------------------------gacattgaccc
AY817511_C_P-RF-DC      atg------------------------------------gacattgaccc
KX660689_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683711_C_P-RF-DC      atg------------------------------------gacattgaccc
KX660684_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683706_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650087_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650080_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650081_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650082_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650084_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650077_C_P-RF-DC      atg------------------------------------gacattgaccc
KP276256_C_P-RF-DC      atg------------------------------------gacattgaccc
HM750150_C_P-RF-DC      atg------------------------------------gacattgaccc
HM750147_C_P-RF-DC      atg------------------------------------gacattgaccc
HM750145_C_P-RF-DC      atg------------------------------------gacattgaccc
HM750144_C_P-RF-DC      atg------------------------------------gacattgaccc
FJ349241_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683700_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683699_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683697_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683696_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683687_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683688_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683686_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683724_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650072_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650073_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650074_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650075_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650078_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650085_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650086_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683723_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650069_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774456_C_P-RF-DC      atg------------------------------------gacattgaccc
HM750143_C_P-RF-DC      atg------------------------------------gacattgaccc
HM750149_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683694_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683695_C_P-RF-DC      atg------------------------------------gacattgaccc
HM750146_C_P-RF-DC      atg------------------------------------gacattgaccc
EU787435_C_P-RF-DC      atg------------------------------------gacatcgaccc
KC774453_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774481_C_P-RF-DC      atg------------------------------------gacattgaccc
KY629632_C_P-RF-DC      atg------------------------------------gacattgacct
FJ562226_C_P-RF-CB      atg------------------------------------gacattgacca
MN683722_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683634_C_P-RF-DC      atg------------------------------------gacattgaccc
KU519423_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683674_C_P-RF-DC      atg------------------------------------gacattgaccc
JF491451_C_P-RF-DC      atg------------------------------------gacattgaccc
JF491455_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683574_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683579_C_P-RF-DC      atg------------------------------------gacattgaccc
JQ040174_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377607_C_P-RF-CB      atg------------------------------------gacattgaccc
EU919166_C_P-RF-CB      atg------------------------------------gacattgaccc
EU919167_C_P-RF-CB      atg------------------------------------gacattgacac
KC774178_C_P-RF-BC      atg------------------------------------gacattgaccc
KC774364_C_P-RF-BC      atg------------------------------------gacattgaccc
KC774428_C_P-RF-DC      atg------------------------------------gacattgaccc
AB270535_C_P-RF-DC      atg------------------------------------gacattgaccc
DQ478898_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774442_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774422_C_P-RF-DC      atg------------------------------------gacattgaccc
KU963856_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963857_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963858_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963859_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963860_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963861_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963863_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963864_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963865_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963866_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963867_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963868_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963869_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963870_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963862_C_P-RF-CB      atg------------------------------------gacattgaccc
EU916239_C_P-RF-CB      atg------------------------------------gacattgaccc
EU916241_C_P-RF-CB      atg------------------------------------gacattgaccc
EU916240_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774455_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774452_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774435_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774443_C_P-RF-DC      atg------------------------------------gacattgacac
KC774484_C_P-RF-DC      atg------------------------------------gacatcgaccc
KC774498_C_P-RF-DC      atg------------------------------------gacattgaccc
EU787434_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774466_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774439_C_P-RF-DC      atg------------------------------------gacattgaccc
HQ700520_C_P-RF-CB      atg------------------------------------gacattgaccc
EU916228_C_P-RF-CB      atg------------------------------------gacattgacac
FJ562267_C_P-RF-CB      atg------------------------------------gacattgaccc
AB014375_C_P-RF-CB      atg------------------------------------gacattgaccc
EU939668_C_P-RF-CB      atg------------------------------------gacattgacct
KU576837_C_P-RF-BC      atg------------------------------------gacattgaccc
KU577083_C_P-RF-BC      atg------------------------------------gacattgaccc
FJ562227_C_P-RF-CB      atg------------------------------------gacattgaccc
GU385774_C_P-RF-CB      atg------------------------------------gacattgaccc
EU589337_C_P-RF-CB      atg------------------------------------gacattgaccc
AF461361_C_P-RF-CB      atg------------------------------------gacattgacac
KU964351_C_P-RF-CB      atg------------------------------------gacattgacac
KU963930_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963931_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963932_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963933_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963934_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963935_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963936_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963938_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963939_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963940_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963941_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963942_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963943_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963944_C_P-RF-CB      atg------------------------------------gacattgaccc
JQ040130_C_P-RF-CB      atg------------------------------------gacattgacac
FJ386593_C_P-RF-CB      atg------------------------------------gacattgacac
MG826149_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ562287_C_P-RF-CB      atg------------------------------------ggccttgaccc
FJ562277_C_P-RF-CB      atg------------------------------------gacattgaccc
EU939602_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ562305_C_P-RF-CB      atg------------------------------------gacattgacac
EU939629_C_P-RF-BC      atg------------------------------------gacattgacac
GQ377633_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871994_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871995_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871992_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871993_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871996_C_P-RF-CB      atg------------------------------------gacattgaccc
EU872014_C_P-RF-CB      atg------------------------------------gacattgaccc
EU872015_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871985_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871981_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871983_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871986_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871999_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871984_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871987_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871988_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871989_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871990_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871991_C_P-RF-CB      atg------------------------------------gacattgaccc
MT645071_C_P-RF-CB      atg------------------------------------gacattgaccc
AB642096_C_P-RF-CB      atg------------------------------------gacattgaccc
AB198084_C_P-RF-CB      atg------------------------------------gacattgaccc
GU357843_C_P-RF-CB      atg------------------------------------gacatcgaccc
FJ562336_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ562271_C_P-RF-CB      atg------------------------------------gacattgaccc
EU939589_C_P-RF-CB      atg------------------------------------gacattgacgt
EU939565_C_P-RF-CB      atg------------------------------------gacattgaccc
KR013806_C_P-RF-CB      atg------------------------------------gacattgaccc
AF411409_C_P-RF-CB      atg------------------------------------gacattgaccc
EU939581_C_P-RF-CB      atg------------------------------------gacattgacac
KU963883_C_P-RF-CB      atg------------------------------------gacattgaccc
KM875422_C_P-RF-CB      atg------------------------------------gacattgaccc
AB367393_C_P-RF-CB      atg------------------------------------gacattgaccc
MT645069_C_P-RF-CB      atg------------------------------------gacattgaccc
M38454_C_P-RF-CB        atg------------------------------------gacattgaccc
AY123424_C_P-RF-CB      atg------------------------------------gacattgaccc
KY881840_C_P-RF-CB      atg------------------------------------gacattgaccc
EU871997_C_P-RF-CB      atg------------------------------------gacattgaccc
JQ040146_C_P-RF-CB      atg------------------------------------gacattgaccc
JX429896_C_P-RF-CB      atg------------------------------------gacattgaccc
JX661494_C_P-RF-CB      atg------------------------------------gacattgaccc
MT645029_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ173299_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ173300_C_P-RF-CB      atg------------------------------------gacattgaccc
JX026887_C_P-RF-CB      atg------------------------------------gacattgacac
FJ386633_C_P-RF-CB      atg------------------------------------gacattgaccc
KY470893_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774188_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774294_C_P-RF-CB      atg------------------------------------gacattgaccc
MG893561_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ173325_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ173326_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ787446_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ787480_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426501_C_P-RF-CB      atg------------------------------------gaccttgaccc
MT426531_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426561_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426506_C_P-RF-CB      ctg------------------------------------gacattgaacc
MT426553_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426457_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426491_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426547_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426563_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426545_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426482_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426490_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426514_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426515_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426523_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426527_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426551_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426463_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426539_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426510_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426504_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426503_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426535_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426461_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426455_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426483_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426459_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426460_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426462_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426464_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426469_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426470_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426473_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426475_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426476_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426477_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426478_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426479_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426481_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426486_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426487_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426489_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426492_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426507_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426544_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426574_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426568_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426555_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426550_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426546_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426542_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426564_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426540_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426537_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426562_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426573_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426533_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426532_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426528_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426499_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426494_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426472_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426468_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426465_C_P-RF-CB      atg------------------------------------gacattgaccc
MK321265_C_P-RF-CB      atg------------------------------------gacattgaccc
MK720627_C_P-RF-CB      atg------------------------------------gacattgaccc
MK720628_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426456_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426466_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426467_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426471_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426480_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426484_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426485_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426488_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426493_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426495_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426496_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426497_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426498_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426500_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426502_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426505_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426508_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426509_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426511_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426512_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426513_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426517_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426518_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426519_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426520_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426521_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426522_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426524_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426525_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426526_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426529_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426530_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426534_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426536_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426538_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426541_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426543_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426549_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426554_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426556_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426557_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426558_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426559_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426560_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426565_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426566_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426567_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426569_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426570_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426571_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426572_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426575_C_P-RF-CB      atg------------------------------------gacattgaccc
MT426576_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ562314_C_P-RF-CB      atg------------------------------------gacattgaccc
MG893559_C_P-RF-CB      atg------------------------------------gacattgaccc
MT645035_C_P-RF-CB      atg------------------------------------gacattgaccc
KR013816_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774183_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774186_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774246_C_P-RF-CB      atg------------------------------------gacattgaccc
AY167095_C_P-RF-CB      atg------------------------------------gacattgaccc
AB367400_C_P-RF-CB      atg------------------------------------gacattgaccc
JQ040175_C_P-RF-CB      atg------------------------------------gacattgaccc
LC458432_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ562302_C_P-RF-CB      atg------------------------------------gacattgacac
FJ562294_C_P-RF-CB      atg------------------------------------gacattgaccc
LC279263_C_P-RF-CB      atg------------------------------------gacattgaccc
LC279264_C_P-RF-CB      atg------------------------------------gacattgaccc
LC279265_C_P-RF-CB      atg------------------------------------gacattgaccc
LC279266_C_P-RF-CB      atg------------------------------------gacattgaccc
LC279267_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377516_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377544_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377581_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377520_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377534_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774258_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ173320_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ173322_C_P-RF-CB      atg------------------------------------gacattgaccc
MW887644_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ173329_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ173330_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774324_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774230_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963990_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963991_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963993_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963994_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963995_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963998_C_P-RF-CB      atg------------------------------------gacattgaccc
KU963999_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964001_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964003_C_P-RF-CB      atg------------------------------------gacattgaccc
KJ173350_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774328_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774317_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774322_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377548_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ386578_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ386585_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ386649_C_P-RF-CB      atg------------------------------------gacattgaccc
AB105172_C_P-RF-CB      atg------------------------------------gacattgaccc
AP011102_C_P-RF-CB      atg------------------------------------gacattgaccc
AB493842_C_P-RF-CB      atg------------------------------------gacattgaccc
AP011103_C_P-RF-CB      atg------------------------------------gacattgaccc
AB493840_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ358155_C_P-RF-CB      atg------------------------------------gacattgaccc
AB493837_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ358156_C_P-RF-CB      atg------------------------------------gacattgaccc
AB493838_C_P-RF-CB      atg------------------------------------gacattgaccc
AB493847_C_P-RF-CB      atg------------------------------------gacattgaccc
KU679945_C_P-RF-CB      atg------------------------------------gacattgacmc
KF873537_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873540_C_P-RF-CB      atg------------------------------------gacattgaccm
KF873538_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873543_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873542_C_P-RF-CB      atg------------------------------------gacattgaccc
AP011108_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700557_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700542_C_P-RF-CB      atg------------------------------------gacattgaccc
KU695745_C_P-RF-CB      atg------------------------------------gacattgaccc
X75656_C_P-RF-CB        atg------------------------------------gacattgaccc
HQ700462_C_P-RF-CB      atg------------------------------------gacatygaccc
HQ700485_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700498_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700499_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700560_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873533_C_P-RF-CB      atg------------------------------------gacattgaccm
KF873534_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873531_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873532_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873535_C_P-RF-CB      atg------------------------------------gacattgaccc
KU679939_C_P-RF-CB      atg------------------------------------gacattgaccc
KU679940_C_P-RF-CB      atg------------------------------------gacattgaccc
KU679956_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873527_C_P-RF-CB      atg------------------------------------gacattgaccc
KU679954_C_P-RF-CB      atg------------------------------------gacattgaccc
KU679942_C_P-RF-CB      atg------------------------------------gacattgaccc
KU679943_C_P-RF-BC      atg------------------------------------gacattgaccm
HQ700518_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700527_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700528_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700523_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700530_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700531_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700532_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700519_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700521_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873521_C_P-RF-BC      atg------------------------------------gacattgaccc
KU679955_C_P-RF-CB      atg------------------------------------gacattgaccc
KU679950_C_P-RF-CB      atg------------------------------------gacattgaccc
KU679944_C_P-RF-BC      atg------------------------------------gacatcgaccc
KU679948_C_P-RF-CB      atg------------------------------------gacattgaccm
KU679953_C_P-RF-BC      atg------------------------------------gacatcgaccc
KU679946_C_P-RF-BC      atg------------------------------------gacattgaccc
KF873519_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873517_C_P-RF-BC      atg------------------------------------gacattgaccc
KF873518_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873515_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873511_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873513_C_P-RF-CB      atg------------------------------------gacattgaccm
KU679958_C_P-RF-CB      atg------------------------------------gacattgaccc
KU679941_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873522_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873523_C_P-RF-CB      atg------------------------------------gacattgaccc
KF873524_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700509_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700515_C_P-RF-CB      atg------------------------------------gacatttaccc
HQ700507_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700508_C_P-RF-CB      atg------------------------------------gacattgaccc
KU695744_C_P-RF-CB      atg------------------------------------gacattgaccc
KU695746_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700505_C_P-RF-CB      atg------------------------------------gacattgaccc
KU695741_C_P-RF-CB      atg------------------------------------gacattgaccc
KU695743_C_P-RF-CB      atg------------------------------------gacattgaccc
MG826142_C_P-RF-CB      atg------------------------------------gacattgacac
MG826141_C_P-RF-CB      atg------------------------------------gacattgacac
KT003704_C_P-RF-CB      atg------------------------------------gacattgaccc
KP148352_C_P-RF-CB      atg------------------------------------gacattgaccc
AP011104_C_P-RF-CB      atg------------------------------------gacattgaccc
AP011105_C_P-RF-CB      atg------------------------------------gacattgaccc
LC416040_C_P-RF-CB      atg------------------------------------gacattgacca
MN683618_C_P-RF-DC      atg------------------------------------gacattgaccc
FJ386643_C_P-RF-CB      atg------------------------------------gacatcgaccc
KU695742_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ562317_C_P-RF-CB      atg------------------------------------gacatcgaccc
FJ386635_C_P-RF-CB      atg------------------------------------gacattgacac
MT645070_C_P-RF-DC      atg------------------------------------gacattgaccc
KJ803788_C_P-RF-CB      atg------------------------------------gacattgaccc
HQ700526_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534582_C_P-RF-BC      atg------------------------------------gacattgaccc
AB241109_C_P-RF-CB      atg------------------------------------gacattgaccc
MN683669_C_P-RF-DC      atg------------------------------------gacattgaccc
EU717211_C_P-RF-CB      atg------------------------------------gacattgacac
AB300369_C_P-RF-CB      atg------------------------------------gacattgaccc
MT645048_C_P-RF-CB      atg------------------------------------gacattgaccc
JX504540_C_P-RF-CB      atg------------------------------------gacatcgacca
KJ803778_C_P-RF-BC      atg------------------------------------gacattgaccc
Y18856_C_P-RF-CB        atg------------------------------------gacatcgaccc
KX660686_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683707_C_P-RF-DC      atg------------------------------------gacattgaccc
AY206374_C_P-RF-CB      atg------------------------------------gacattgaccc
EU939551_C_P-RF-CB      atg------------------------------------gacattgacac
AB670303_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774234_C_P-RF-CB      atg------------------------------------gacattgaccc
EU916232_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964315_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964308_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964010_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964005_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964007_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964008_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964009_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964303_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964304_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964305_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964306_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964307_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964309_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964310_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964311_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964312_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964313_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964314_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964316_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964317_C_P-RF-CB      atg------------------------------------gacattgaccc
KU964006_C_P-RF-CB      atg------------------------------------gacattgaccc
KX096713_C_P-RF-CA      atg------------------------------------gacattgaccc
KY670781_C_P-RF-DC      atg------------------------------------gacattgacmc
MG826144_C_P-RF-CB      atg------------------------------------gacattgaccc
KX660685_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683641_C_P-RF-DC      atg------------------------------------gacattgaccc
AB367800_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ715345_C_P-RF-CB      atg------------------------------------gacatcgaccc
FJ715346_C_P-RF-CB      atg------------------------------------gacatcgaccc
FJ715347_C_P-RF-CB      atg------------------------------------gacatcgaccc
HQ684849_C_P-RF-BC      atg------------------------------------gacattgaccc
AB049609_C_P-RF-CB      atg------------------------------------gacattgaccc
KR013843_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534587_C_P-RF-BC      atg------------------------------------gacattgaccc
KC774485_C_P-RF-DC      atg------------------------------------gacattgatcc
MN683716_C_P-RF-DC      atg------------------------------------gacattgaccc
MK534577_C_P-RF-BC      atg------------------------------------gacattgaccc
KC774212_C_P-RF-CB      atg------------------------------------gacattgaccc
EU939606_C_P-RF-CB      atg------------------------------------gacattgaccc
AY040627_C_P-RF-CB      atg------------------------------------gacattgaccc
MT645063_C_P-RF-DC      atg------------------------------------gacattgacac
MN683620_C_P-RF-DC      atg------------------------------------gacattgaccc
HQ700547_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377560_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774198_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774201_C_P-RF-CB      atg------------------------------------gacattgaccc
EU522070_C_P-RF-CB      atg------------------------------------gacattgaccc
EU881995_C_P-RF-CB      atg------------------------------------gacattgaccc
KT991420_C_P-RF-DC      atg------------------------------------gacattgacca
FJ562278_C_P-RF-DC      atg------------------------------------gacattgacca
KT991417_C_P-RF-DC      atg------------------------------------gacattgacca
KT991423_C_P-RF-DC      atg------------------------------------gacattgacca
KT991419_C_P-RF-DC      atg------------------------------------gacattgacca
MN683627_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683581_C_P-RF-DC      atg------------------------------------gacattgaccc
MH094410_C_P-RF-BC      atg------------------------------------gacattgaccc
JX661487_C_P-RF-CB      atg------------------------------------gacattgaccc
JQ732168_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377611_C_P-RF-CB      atg------------------------------------gacattgaccc
AB195939_C_P-RF-CB      atg------------------------------------gacattgaccc
AB195940_C_P-RF-CB      atg------------------------------------gacattgaccc
AB195941_C_P-RF-CB      atg------------------------------------gacattgaccc
AB195955_C_P-RF-CB      atg------------------------------------gacattgaccc
AB195956_C_P-RF-CB      atg------------------------------------gacattgaccc
AB195957_C_P-RF-CB      atg------------------------------------gacattgaccc
AB033557_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774263_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774332_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774341_C_P-RF-CB      atg------------------------------------gacattgaccc
KX660682_C_P-RF-DC      atg------------------------------------gacattgacac
JF436922_C_P-RF-CB      atg------------------------------------gacattgaccc
MT645062_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683717_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774490_C_P-RF-DC      atg------------------------------------gacattgatcc
JN400086_C_P-RF-CB      atg------------------------------------gacattgaccc
HM750133_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377522_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ386581_C_P-RF-CB      atg------------------------------------gacattgaccc
DQ478886_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683588_C_P-RF-DC      atg------------------------------------gacattgaccc
AY817509_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774447_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774486_C_P-RF-DC      atg------------------------------------gacattgaccc
MN650076_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683720_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683718_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683719_C_P-RF-DC      atg------------------------------------gacattgaccc
KX660674_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683664_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683665_C_P-RF-DC      atg------------------------------------gacattgaccc
KX660680_C_P-RF-DC      atg------------------------------------gacattgaccc
MT645060_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683677_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683675_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683655_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683619_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683611_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683603_C_P-RF-DC      atg------------------------------------gacattgaccc
KJ410520_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774489_C_P-RF-DC      atg------------------------------------gacatcgaccc
KC774479_C_P-RF-DC      atg------------------------------------gacatcgaccc
KC774475_C_P-RF-DC      atg------------------------------------gacattgatcc
KC774470_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774461_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774434_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774432_C_P-RF-DC      atg------------------------------------gacattgaccc
JQ707714_C_P-RF-CB      atg------------------------------------gacattgaccc
GQ377630_C_P-RF-BC      atg------------------------------------gacattgaccc
AB195950_C_P-RF-CB      atg------------------------------------gacattgaccc
AB195951_C_P-RF-CB      atg------------------------------------gacattgaccc
JF828933_C_P-RF-CB      atg------------------------------------gacattgaccc
JF828934_C_P-RF-CB      atg------------------------------------gacattgaccc
JF828935_C_P-RF-CB      atg------------------------------------gacattgaccc
JF828936_C_P-RF-CB      atg------------------------------------gacattgaccc
JF828938_C_P-RF-CB      atg------------------------------------gacattgaccc
AY862864_C_P-RF-DC      atg------------------------------------gacattgaccc
AY862865_C_P-RF-DC      atg------------------------------------gacattgaccc
AY862866_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683657_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683617_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683636_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683637_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683638_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683651_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774349_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774488_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774493_C_P-RF-DC      atg------------------------------------gacattgaccc
Y18857_C_P-RF-CB        atg------------------------------------gacattgaccc
MT645067_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683691_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683676_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683673_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683670_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683654_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683582_C_P-RF-DC      atg------------------------------------gacattgaccc
KX660677_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683668_C_P-RF-DC      atg------------------------------------gacattgaccc
KX660675_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683613_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683614_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683615_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683666_C_P-RF-DC      atg------------------------------------gacattgaccc
KT991421_C_P-RF-DC      atg------------------------------------gacattgaccc
KP276255_C_P-RF-DC      atg------------------------------------gacattgaccc
KP276254_C_P-RF-DC      atg------------------------------------gacattgaccc
KF917451_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774499_C_P-RF-DC      atg------------------------------------gacatcgaccc
KC774497_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774494_C_P-RF-DC      atg------------------------------------gacatcgaccc
KC774487_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774454_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774430_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774431_C_P-RF-DC      atg------------------------------------gacattgaccc
JX429898_C_P-RF-DC      atg------------------------------------gacattgaccc
JF491449_C_P-RF-DC      atg------------------------------------gacattgaccc
DQ478892_C_P-RF-DC      atg------------------------------------gacattgaccc
DQ478889_C_P-RF-DC      atg------------------------------------gacattgaccc
MN657317_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774458_C_P-RF-DC      atg------------------------------------gacattgaccc
AF330110_C_P-RF-CB      atg------------------------------------gacattgaccc
MN683684_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683622_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683625_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683596_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683623_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683683_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683660_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683640_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774463_C_P-RF-DC      atg------------------------------------gacattgaccc
AY817512_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683597_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683621_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683642_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683650_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774425_C_P-RF-DC      atg------------------------------------gacattgaccc
FJ715387_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ715384_C_P-RF-CB      atg------------------------------------gacattgaccc
AY247030_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ715385_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ715411_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ715412_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ715413_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ715414_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774474_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683605_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774495_C_P-RF-DC      atg------------------------------------gacattgatcc
KC774492_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774476_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774483_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774222_C_P-RF-CB      atg------------------------------------gacattgaccc
MN683610_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774344_C_P-RF-CB      atg------------------------------------gacattgaccc
MN683639_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774468_C_P-RF-DC      atg------------------------------------gacattgaccc
DQ144601_C_P-RF-BC      atg------------------------------------gacattgaccc
MN683571_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683592_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683594_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774457_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774420_C_P-RF-DC      atg------------------------------------gacattgacac
AY800249_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774426_C_P-RF-DC      atg------------------------------------gacattgaccc
AY817515_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774480_C_P-RF-DC      atg------------------------------------gacattgatcc
EU835240_C_P-RF-GC      atg------------------------------------gacattgaccc
KC774478_C_P-RF-DC      atg------------------------------------gacattgaccc
MN657316_C_P-RF-DC      atg------------------------------------gacattgaccc
MT645066_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683586_C_P-RF-DC      atg------------------------------------gacattgaccc
MT645049_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683689_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683690_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683645_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683635_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683658_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683659_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683713_C_P-RF-DC      atg------------------------------------gacattgaccc
MT645065_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683632_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683628_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683624_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683612_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683616_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683587_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683692_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683693_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683715_C_P-RF-DC      atg------------------------------------gacattgaccc
KJ173349_C_P-RF-CB      atg------------------------------------gacattgaccc
KC774471_C_P-RF-DC      atg------------------------------------gacattgaccc
DQ478897_C_P-RF-DC      atg------------------------------------gacattgaccc
AY817510_C_P-RF-DC      atg------------------------------------gacattgaccc
DQ478887_C_P-RF-DC      atg------------------------------------gacattgaccc
JF491448_C_P-RF-DC      atg------------------------------------gacattgaccc
JF491456_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774423_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774424_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774433_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774448_C_P-RF-DC      atg------------------------------------gacattgaccc
KC774472_C_P-RF-DC      atg------------------------------------gacattgaccc
KU519422_C_P-RF-DC      atg------------------------------------gacattgaccc
MN657315_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683572_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683584_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683590_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683607_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683609_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683626_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683630_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683643_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683644_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683647_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683649_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683652_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683653_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683656_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683661_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683662_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683663_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683671_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683672_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683679_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683685_C_P-RF-DC      atg------------------------------------gacattgaccc
MN683714_C_P-RF-DC      atg------------------------------------gacattgaccc
AY817513_C_P-RF-DC      atg------------------------------------gacattgaccc
KF214680_C_P-RF-GC      atg------------------------------------gacattgaccc
MH368022_C_P-RF-GC      atg------------------------------------gacattgaccc
MZ439768_C_P-RF-GC      atg------------------------------------gacattgacac
MZ439798_C_P-RF-GC      atg------------------------------------gacattgacac
FJ023665_C_P-RF-GC      atg------------------------------------gacattgaccc
FJ882613_C_P-RF-GC      atg------------------------------------gacattgaccc
EU833891_C_P-RF-GC      atg------------------------------------gacattgaccc
FJ882617_C_P-RF-GC      atg------------------------------------gacattgaccc
FJ882612_C_P-RF-GC      atg------------------------------------gacattgaccc
FJ882618_C_P-RF-GC      atg------------------------------------gacattgaccc
FJ023666_C_P-RF-GC      atg------------------------------------gacattgaccc
FJ882611_C_P-RF-GC      atg------------------------------------gacattgaccc
FJ023670_C_P-RF-GC      atg------------------------------------gacattgaccc
FJ023664_C_P-RF-GC      atg------------------------------------gacattgaccc
FJ023667_C_P-RF-GC      atg------------------------------------gacattgaccc
FJ023673_C_P-RF-GC      atg------------------------------------gacattgaccc
FJ882610_C_P-RF-GC      atg------------------------------------gacattgaccc
FJ882614_C_P-RF-GC      atg------------------------------------gacattgaccc
MK534669_C_P-RF-CB      atg------------------------------------gacattgaccc
MK534566_C_P-RF-BC      atg------------------------------------gacattgaccc
MK534663_C_P-RF-CB      atg------------------------------------gacattgaccc
FJ023659_C_P-RF-BC      atg------------------------------------gacattgaccc
FR714496_C_P-RF-CB      atg------------------------------------gacattgaccc
KP148442_C_P-RF-BC      atg------------------------------------gacattgaccc
MH746811_C_P-RF-BC      atg------------------------------------gacattgaccc
FR714490_C_P-RF-GB      atg------------------------------------gacattgaccc
KC172106_C_P-RF-GB      atg------------------------------------gacattgaccc
MG826145_C_P-RF-BC      atg------------------------------------gacattgaccc
MH746813_C_P-RF-BC      atg------------------------------------gacattgaccc
MH746812_C_P-RF-BC      atg------------------------------------gacattgaccc
MF488699_C_P-RF-DE      atg------------------------------------gaccttgaccc
AB933283_C_P-RF-AG      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JF440019_C_P-RF-AG      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB933282_C_P-RF-AG      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JF440021_C_P-RF-AG      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JF440022_C_P-RF-AG      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
EU833890_C_P-RF-GA      atggatagaataactttgccgtatggcttttttggcttagacattgaccc
EU833889_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707468_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707426_C_P-RF-GA      atggatagaataactttgccatatggccttcttggcttagacattgaccc
JQ707424_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707459_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707473_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgactc
JQ707465_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707464_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707463_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707441_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB933281_C_P-RF-AG      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB933279_C_P-RF-AG      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707457_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707458_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707460_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707461_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707462_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707466_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707467_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707469_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707470_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707448_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707474_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
KP274926_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
EF464099_C_P-RF-AG      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707421_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707430_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707432_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707445_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707450_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707456_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707471_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707472_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707475_C_P-RF-GA      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB933280_C_P-RF-AG      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
MZ097814_C_P-RF-DE      atg------------------------------------gacattgaccc
GQ161806_C_P-RF-EA      atg------------------------------------gacattgaccc
JN664933_C_P-RF-DA      atg------------------------------------gacatcgaccc
JN664946_C_P-RF-DA      atg------------------------------------gacattgaccc
JF440017_C_P-RF-DA      atg------------------------------------gacatcgaccc
AY230115_C_P-RF-DA      atg------------------------------------gacattgacac
X68292_C_P-RF-DA        atg------------------------------------gacattgaccc
JF439776_C_P-RF-AG      atg------------------------------------gacattgaccc
AB453985_C_P-RF-AC      atg------------------------------------gacattgaccc
MF925386_C_P-RF-AC      atg------------------------------------gacattgaccc
KF779353_C_P-RF-DA      atg------------------------------------gacattgaccc
AB222708_C_P-RF-AD      atg------------------------------------gacattgaccc
AB330368_C_P-RF-DA      atg------------------------------------gacattgaccc
EF494376_C_P-RF-CA      atg------------------------------------gacattgaccc
AF297619_C_P-RF-DA      atg------------------------------------gacattgaccc
AF297620_C_P-RF-DA      atg------------------------------------gacattgaccc
AB194949_C_P-RF-AE      atg------------------------------------gacattgaccc
MF488705_C_P-RF-AD      atg------------------------------------gacattgaccc
MH464850_C_P-RF-DA      nnn------------------------------------nnnnntgaccc
HM146131_C_P-RF-AD      atg------------------------------------gacattgaccc
MT426089_C_P-RF-AB      atg------------------------------------gacattgaccc
GQ331048_C_P-RF-AE      atg------------------------------------gacattgaccc
AY161147_C_P-RF-DA      atg------------------------------------gacattgaccc
KJ586810_C_P-RF-AF      atg------------------------------------gacattgaccc
AY233277_C_P-RF-AC      atg------------------------------------gacattgaccc
KF214656_C_P-RF-AC      atg------------------------------------gacattgaccc
MF925404_C_P-RF-AC      atg------------------------------------gacattgaccc
FJ349221_C_P-RF-DE      atg------------------------------------gacattgaccc
AB674412_C_P-RF-DE      atg------------------------------------gacatcgaccc
JN688717_C_P-RF-DE      atg------------------------------------gacattgaccc
KJ647356_C_P-RF-DE      atg------------------------------------gacatcgaccc
DQ464167_C_P-RF-DE      atg------------------------------------gacatcgaccc
DQ464165_C_P-RF-DE      atg------------------------------------gacatcgaccc
DQ464166_C_P-RF-DE      atg------------------------------------gacatcgaccc
DQ464164_C_P-RF-DE      atg------------------------------------gacatcgaccc
KJ647349_C_P-RF-DE      atg------------------------------------gaccttgaccc
MZ097766_C_P-RF-DE      atg------------------------------------gacattgaccc
MK052976_C_P-RF-BD      atg------------------------------------gacattgaccc
KJ647351_C_P-RF-DE      atg------------------------------------gacattgaccc
MT426112_C_P-RF-DE      atg------------------------------------gacatcgaccc
JN688689_C_P-RF-DE      atg------------------------------------gacattgaccc
JN688715_C_P-RF-DE      atg------------------------------------gacattgaccc
KM359442_C_P-RF-DE      atg------------------------------------gacatcgaccc
MW601310_C_P-RF-DE      atg------------------------------------gacattgaccc
MZ097777_C_P-RF-DE      atg------------------------------------gacattgaccc
KJ586811_C_P-RF-DF      atg------------------------------------gacattgaccc
AB270538_C_P-RF-DE      atg------------------------------------gacattgaccc
KF679991_C_P-RF-DE      atg------------------------------------gacatcgaccc
MG877711_C_P-RF-DE      atg------------------------------------gacatcgaccc
KM577666_C_P-RF-DE      atg------------------------------------gacattgaccc
MH724243_C_P-RF-DE      atg------------------------------------gacattgaccc
MN507835_C_P-RF-DE      atg------------------------------------gacattgaccc
MW601317_C_P-RF-DE      atg------------------------------------gacattgaccc
MZ097806_C_P-RF-DE      atg------------------------------------gacattgaccc
X65259_C_P-RF-DA        atg------------------------------------gacattgaccc
MH724240_C_P-RF-DE      atg------------------------------------gacattgaccc
MF488702_C_P-RF-DE      atg------------------------------------gacattgacac
KX827302_C_P-RF-DE      atg------------------------------------gacattgaccc
MW601296_C_P-RF-DE      atg------------------------------------gacatcgaccc
MZ097767_C_P-RF-DE      atg------------------------------------gacatcgaccc
MH724239_C_P-RF-DE      atg------------------------------------gacatcgaccc
JN257204_C_P-RF-DE      atg------------------------------------gacatcgaccc
MW601264_C_P-RF-DE      atg------------------------------------gacatcgaccc
MZ097745_C_P-RF-DE      atg------------------------------------gacatcgaccc
AY341335_C_P-RF-DE      atg------------------------------------gacattgaccc
JQ687532_C_P-RF-DE      atg------------------------------------gacattgaccc
MZ097850_C_P-RF-DE      atg------------------------------------gacattgaccc
X80925_C_P-RF-DE        atg------------------------------------gacattgaccc
EF103284_C_P-RF-AD      atg------------------------------------gacatcgaccc
MH464835_C_P-RF-DE      atg------------------------------------gacattgaccc
KC774450_C_P-RF-DE      atg------------------------------------gacattgaccc
AJ627221_C_P-RF-DE      atg------------------------------------gacatcgaccc
MW601227_C_P-RF-DE      atg------------------------------------gacattgaccc
MZ097716_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ349212_C_P-RF-DE      atg------------------------------------gacatcgaccc
MW601284_C_P-RF-DE      atg------------------------------------gacattgaccc
MZ097758_C_P-RF-DE      atg------------------------------------gacattgaccc
AB188243_C_P-RF-DE      atg------------------------------------gacattgaccc
AB188245_C_P-RF-DE      atg------------------------------------gacattgaccc
MW601260_C_P-RF-DE      atg------------------------------------gacattgaccc
MZ097740_C_P-RF-DE      atg------------------------------------gacattgaccc
KM577667_C_P-RF-DE      atg------------------------------------gacattgaccc
EU594406_C_P-RF-DE      atg------------------------------------gacattgaccc
AB210819_C_P-RF-DE      atg------------------------------------gacatcgaccc
MW601235_C_P-RF-DE      atg------------------------------------gacatcgaccc
MZ097721_C_P-RF-DE      atg------------------------------------gacatcgaccc
KM386676_C_P-RF-DE      atg------------------------------------gacattgaccc
KM577665_C_P-RF-DE      atg------------------------------------gacattgaccc
AJ627217_C_P-RF-DE      atg------------------------------------gacattgaccc
AY373430_C_P-RF-DE      atg------------------------------------gacattgaccc
KM524359_C_P-RF-DE      atg------------------------------------gacattgaccc
KT366492_C_P-RF-DE      atg------------------------------------gacattgaccc
MK598656_C_P-RF-DE      atg------------------------------------gacattgaccc
MW601241_C_P-RF-DE      atg------------------------------------gacattgaccc
MZ097724_C_P-RF-DE      atg------------------------------------gacattgaccc
MK598654_C_P-RF-DE      atg------------------------------------gacattgaccc
DQ111987_C_P-RF-DE      atg------------------------------------gacattgaccc
EU594435_C_P-RF-DE      atg------------------------------------gacattgaccc
EU594436_C_P-RF-DE      atg------------------------------------gacattgaccc
MK618439_C_P-RF-DE      atg------------------------------------gacattgaccc
GQ183486_C_P-RF-DE      atg------------------------------------gacattgaccc
MK598652_C_P-RF-DE      atg------------------------------------gacattgaccc
MK598653_C_P-RF-DE      atg------------------------------------gacattgaccc
JF440012_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440007_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440004_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440005_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440013_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440011_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440001_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF439995_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF439996_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF439998_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440000_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440002_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440003_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440006_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440008_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440009_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440010_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440014_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF440015_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF439999_C_P-RF-DE      atg------------------------------------gacatcgaccc
MH724222_C_P-RF-DE      atg------------------------------------gacattgaccc
AY236161_C_P-RF-DA      atg------------------------------------gacatcgaccc
MZ097667_C_P-RF-DE      atg------------------------------------gacatcgaccc
MT426110_C_P-RF-DE      atg------------------------------------gacatcgaccc
EU185780_C_P-RF-AD      atg------------------------------------gacatcgaccc
KC012653_C_P-RF-AD      atg------------------------------------gacatcgaccc
MF967563_C_P-RF-DE      atg------------------------------------gacatcgaccc
MK618438_C_P-RF-DE      atg------------------------------------gacatcgaccc
MK618440_C_P-RF-DE      atg------------------------------------gacatcgaccc
MK618444_C_P-RF-DE      atg------------------------------------gacatcgaccc
MT426111_C_P-RF-DE      atg------------------------------------gacatcgaccc
U95551_C_P-RF-DE        atg------------------------------------gacatcgaccc
MT426113_C_P-RF-DE      atg------------------------------------gacatcgaccc
AJ344117_C_P-RF-DE      atg------------------------------------gacatcgaccc
JX898686_C_P-RF-DE      atg------------------------------------gacatcgaccc
JX898690_C_P-RF-DE      atg------------------------------------gacatcgaccc
JX898693_C_P-RF-DE      atg------------------------------------gacatcgaccc
JX898695_C_P-RF-DE      atg------------------------------------gacatcgaccc
JX898696_C_P-RF-DE      atg------------------------------------gacatcgaccc
JX898698_C_P-RF-DE      atg------------------------------------gacatcgaccc
JX898699_C_P-RF-DE      atg------------------------------------gacatcgaccc
MK618442_C_P-RF-DE      atg------------------------------------gacatcgaccc
MK618445_C_P-RF-DE      atg------------------------------------gacatcgaccc
JX898687_C_P-RF-DE      atg------------------------------------gacatcgaccc
JX898688_C_P-RF-DE      atg------------------------------------gacatcgaccc
DQ315777_C_P-RF-DE      atg------------------------------------gacattgatcc
KM524337_C_P-RF-DE      atg------------------------------------gacattgatcc
KM524336_C_P-RF-DE      atg------------------------------------gacattgatcc
LK995391_C_P-RF-ED      atg------------------------------------gacattgaccc
AB583679_C_P-RF-DE      atg------------------------------------gacattgaccc
KM577663_C_P-RF-DE      atg------------------------------------gacattgaccc
KM577664_C_P-RF-DE      atg------------------------------------gacattgaccc
MN507850_C_P-RF-DE      atg------------------------------------gacattgaccc
EF103285_C_P-RF-DE      atg------------------------------------gacattgaccc
KT366504_C_P-RF-DE      atg------------------------------------gacattgaccc
AY233293_C_P-RF-DE      atg------------------------------------gacattgaccc
AY233295_C_P-RF-DE      atg------------------------------------gacattgaccc
MT210033_C_P-RF-DE      atg------------------------------------gacattgaccc
GU563560_C_P-RF-DE      atg------------------------------------gacattgaccc
MH464846_C_P-RF-DE      atg------------------------------------gacattgaccc
MH464852_C_P-RF-DE      atg------------------------------------gacattgaccc
MH464851_C_P-RF-DE      atg------------------------------------gacattgaccc
JN664943_C_P-RF-DE      atg------------------------------------gacattgaccc
KU668440_C_P-RF-DE      atg------------------------------------gacatcgaccc
JN664929_C_P-RF-DE      atg------------------------------------gacattgaccc
JN664934_C_P-RF-DE      atg------------------------------------gacattgaccc
JN664915_C_P-RF-DE      atg------------------------------------gacatcgaccc
JN664925_C_P-RF-DE      atg------------------------------------gacatcgaccc
GQ205377_C_P-RF-DE      atg------------------------------------gacattgaccc
KC875338_C_P-RF-DE      atg------------------------------------gacattgaccc
KC875339_C_P-RF-DE      atg------------------------------------gacattgaccc
GQ205378_C_P-RF-DE      atg------------------------------------gacattgaccc
GQ205387_C_P-RF-DE      atg------------------------------------gacattgaccc
GQ205379_C_P-RF-DE      atg------------------------------------gacattgaccc
AB033558_C_P-RF-DE      atg------------------------------------gacattgaccc
MK516279_C_P-RF-DE      atg------------------------------------gacattgaccc
MK516280_C_P-RF-DE      atg------------------------------------gacattgaccc
MK541689_C_P-RF-DE      atg------------------------------------gacattgaccc
DQ315780_C_P-RF-DE      atg------------------------------------gacattgaccc
KT366505_C_P-RF-DE      atg------------------------------------gacattgaccc
DQ315779_C_P-RF-DE      atg------------------------------------gacattgaccc
JN664940_C_P-RF-DE      atg------------------------------------gacattgaccc
MK052957_C_P-RF-DE      atg------------------------------------gacattgaccc
MK052969_C_P-RF-DE      atg------------------------------------gacattgaccc
KJ470898_C_P-RF-DE      atg------------------------------------gacatcgaccc
KJ470897_C_P-RF-DE      atg------------------------------------gacattgaccc
KF192835_C_P-RF-DE      atg------------------------------------gacatcgaccc
KJ470891_C_P-RF-DE      atg------------------------------------gacattgaccc
KF192833_C_P-RF-DE      atg------------------------------------gacatcgaccc
MF618346_C_P-RF-DE      atg------------------------------------gacatcgaccc
KF192840_C_P-RF-DE      atg------------------------------------gaccttgaccc
KF192836_C_P-RF-DE      atg------------------------------------gacattgaccc
KF192838_C_P-RF-DE      atg------------------------------------gacattgaccc
KF192837_C_P-RF-DE      atg------------------------------------gaccttgaccc
KF192839_C_P-RF-DE      atg------------------------------------gaccttgaccc
KF192841_C_P-RF-DE      atg------------------------------------gaccttgaccc
MF618347_C_P-RF-DE      atg------------------------------------gaccttgaccc
KJ470892_C_P-RF-DE      atg------------------------------------gacattgaccc
KJ470888_C_P-RF-DE      atg------------------------------------gacattgaccc
KJ470890_C_P-RF-DE      atg------------------------------------gacattgaccc
KJ470884_C_P-RF-DE      atg------------------------------------gacattgaccc
KJ470886_C_P-RF-DE      atg------------------------------------gacattgaccc
KJ470887_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700494_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ692536_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700492_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700579_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700585_C_P-RF-DE      atg------------------------------------gacattgaccc
AB048702_C_P-RF-DE      atg------------------------------------gacattgaccc
AB048703_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700493_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700534_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700533_C_P-RF-DE      atg------------------------------------gacattgaccc
MH481860_C_P-RF-DE      atg------------------------------------gacattgaccc
J02202_C_P-RF-DE        atg------------------------------------gacattgaccc
MH481862_C_P-RF-DE      atg------------------------------------gacagtgaccc
MH481859_C_P-RF-DE      atg------------------------------------gacattgaccc
MH481858_C_P-RF-DE      atg------------------------------------gacattgaccc
MH481861_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700536_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700541_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700581_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700503_C_P-RF-DE      atg------------------------------------gacattgaccc
AB033559_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700497_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700501_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700524_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700525_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700582_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700583_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700584_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700535_C_P-RF-DE      atg------------------------------------gacattgaycc
HQ700537_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700538_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700500_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700539_C_P-RF-DE      atg------------------------------------gacattgaccc
HQ700540_C_P-RF-DE      atg------------------------------------gacattgaccc
JN040803_C_P-RF-DE      atg------------------------------------gacattgatcc
JF754613_C_P-RF-DE      atg------------------------------------gacattgaccc
JN257154_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ562223_C_P-RF-CD      atg------------------------------------gacattgaccc
MZ097826_C_P-RF-DE      atg------------------------------------gacatcgaccc
MF925401_C_P-RF-DB      atg------------------------------------gacattgaccc
MF925360_C_P-RF-DB      atg------------------------------------gacattgaccc
MF925396_C_P-RF-DC      atg------------------------------------gacattgaccc
EF103283_C_P-RF-AD      atg------------------------------------gacattgaccc
EF103282_C_P-RF-AD      atg------------------------------------gacattgaccc
KM524357_C_P-RF-DE      atg------------------------------------gacattgaccc
KT366503_C_P-RF-DE      atg------------------------------------gacattgaccc
KR905422_C_P-RF-DE      atg------------------------------------gacattgaccc
MF925371_C_P-RF-DC      atg------------------------------------gacattgaccc
MF925388_C_P-RF-DC      atg------------------------------------gacattgaccc
MF925392_C_P-RF-DB      atg------------------------------------gacattgaccc
MF925402_C_P-RF-BD      atg------------------------------------gacattgaccc
AB674436_C_P-RF-DE      atg------------------------------------gacattgaccc
MZ097838_C_P-RF-DE      atg------------------------------------gacattgaccc
MZ097680_C_P-RF-DE      atg------------------------------------gacattgaccc
MZ097703_C_P-RF-DE      atg------------------------------------gacattgaccc
MF925397_C_P-RF-DC      atg------------------------------------gacattgaccc
MF925384_C_P-RF-DB      atg------------------------------------gacattgatcc
AY161145_C_P-RF-AD      atg------------------------------------gacattgatcc
AY161146_C_P-RF-AD      atg------------------------------------gacattgatcc
GQ377627_C_P-RF-CD      atg------------------------------------gacattgatcc
AY161140_C_P-RF-AD      atg------------------------------------gacattgatcc
AY161141_C_P-RF-AD      atg------------------------------------gacattgatcc
JN642141_C_P-RF-DE      atg------------------------------------gacatcgaccc
JN642152_C_P-RF-DE      atg------------------------------------gacatcgatcc
AB674434_C_P-RF-DE      atg------------------------------------gacatcgaccc
JN642137_C_P-RF-DE      atg------------------------------------gacattgaccc
JN642160_C_P-RF-DE      atg------------------------------------gacattgaccc
MZ097652_C_P-RF-DE      atg------------------------------------gacattgaccc
KF471643_C_P-RF-DE      atg------------------------------------gacattgatcc
MW887645_C_P-RF-CD      atg------------------------------------gacattgaccc
MZ097822_C_P-RF-DE      atg------------------------------------gacattgaccc
JN040798_C_P-RF-DE      atg------------------------------------gaccttgatcc
JN642127_C_P-RF-DE      atg------------------------------------gacatcgaccc
JF754616_C_P-RF-DE      atg------------------------------------gacattgaccc
MW601230_C_P-RF-DE      atg------------------------------------gacatcgaccc
MZ097719_C_P-RF-DE      atg------------------------------------gacatcgaccc
JN257210_C_P-RF-DE      atg------------------------------------gacattgaccc
JN257174_C_P-RF-DE      atg------------------------------------gacattgaccy
MZ097687_C_P-RF-DE      atg------------------------------------gacattgaccc
JN257206_C_P-RF-DE      atg------------------------------------gacatcgaccc
JN257207_C_P-RF-DE      atg------------------------------------gacatcgaccc
JN257191_C_P-RF-DE      atg------------------------------------gacatygaccc
JN257216_C_P-RF-DE      atg------------------------------------gacattgaccc
JN642139_C_P-RF-DE      atg------------------------------------gacattgaccc
AB674432_C_P-RF-DE      atg------------------------------------gacatcgaccc
AB674433_C_P-RF-DE      atg------------------------------------gacattgaccc
JN257164_C_P-RF-DE      atg------------------------------------gacattgaccc
JN257189_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904405_C_P-RF-DE      atg------------------------------------gacattgatcc
FN594767_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904436_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904409_C_P-RF-DE      atg------------------------------------gacattgaccc
KP168421_C_P-RF-DE      atg------------------------------------gacatcgaccc
FJ904408_C_P-RF-DE      atg------------------------------------gacatcgaccc
FJ349207_C_P-RF-DE      atg------------------------------------gacatcgaccc
FJ904416_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904417_C_P-RF-DE      atg------------------------------------gacatcgaccc
FJ904414_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904407_C_P-RF-DE      atg------------------------------------gacatcgaccc
FJ904430_C_P-RF-DE      atg------------------------------------gacatcgatcc
FJ904425_C_P-RF-DE      atg------------------------------------gacatcgaccc
FJ904400_C_P-RF-DE      atg------------------------------------gacattgaccc
DQ991753_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904398_C_P-RF-DE      atg------------------------------------gacatcgaccc
GQ161788_C_P-RF-AE      atg------------------------------------gacattgaccc
FJ904394_C_P-RF-DE      atg------------------------------------gacattgatcc
FN594769_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904440_C_P-RF-DE      atg------------------------------------gacatcgaccc
KX357628_C_P-RF-DE      atg------------------------------------gacattgaccc
GQ161767_C_P-RF-AE      atg------------------------------------gacattgaccc
HF571060_C_P-RF-AE      atg------------------------------------gacattgaccc
GQ161837_C_P-RF-AE      atg------------------------------------gacattgaccc
GQ161838_C_P-RF-AE      atg------------------------------------gacattgaccc
FJ904444_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904396_C_P-RF-DE      atg------------------------------------gacatcgaccc
GQ161753_C_P-RF-AE      atg------------------------------------gacattgaccc
FJ904428_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904404_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357631_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904442_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357627_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357626_C_P-RF-DE      atg------------------------------------gacatcgaccc
MT591274_C_P-RF-DE      atg------------------------------------gacattgaccc
MT591275_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904401_C_P-RF-DE      atg------------------------------------gacatcgaccc
KU736921_C_P-RF-DE      atg------------------------------------gacattgaccc
KU736922_C_P-RF-DE      atg------------------------------------gacattgaccc
KP288875_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357632_C_P-RF-DE      atg------------------------------------gacattgaccc
KP168417_C_P-RF-DE      atg------------------------------------gacattgaccc
KP168418_C_P-RF-DE      atg------------------------------------gacattgaccc
KP168420_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904437_C_P-RF-DE      atg------------------------------------gacattgaccc
KP168416_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904447_C_P-RF-DE      atg------------------------------------gacattgaccc
MT591280_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904441_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904397_C_P-RF-DE      atg------------------------------------gacattgaccc
KF170740_C_P-RF-DE      atg------------------------------------gacattgaccc
KM606741_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904406_C_P-RF-DE      atg------------------------------------gacattgaccc
KM606750_C_P-RF-DE      atg------------------------------------gacattgaccc
KP995112_C_P-RF-DE      atg------------------------------------gacattgaccc
KM606751_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357636_C_P-RF-DE      atg------------------------------------gacattgaccc
KX827299_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357630_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357625_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357629_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357634_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357624_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357623_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357633_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357635_C_P-RF-DE      atg------------------------------------gacattgaccc
FJ904403_C_P-RF-DE      atg------------------------------------gacattgaccc
KX357641_C_P-RF-DE      atg------------------------------------gacattgaccc
KU736917_C_P-RF-DE      atg------------------------------------gacattgaccc
KU736914_C_P-RF-DE      atg------------------------------------gacattgaccc
KU736915_C_P-RF-DE      atg------------------------------------gacattgaccc
KU736916_C_P-RF-DE      atg------------------------------------gacattgaccc
KU736923_C_P-RF-DE      atg------------------------------------gacattgaccc
MH685719_C_P-RF-DE      atg------------------------------------gacattgaccc
MT426114_C_P-RF-DE      atg------------------------------------gacattgaccc
KU711666_C_P-RF-DE      atg------------------------------------gacattgaccc
FN594771_C_P-RF-DE      atg------------------------------------gacattgaccc
AM494716_C_P-RF-DE      atg------------------------------------gacattgaccc
GU177079_C_P-RF-DE      atg------------------------------------gacattgaccc
FN594770_C_P-RF-DE      atg------------------------------------gacatcgaccc
GQ161754_C_P-RF-DE      atg------------------------------------gacattgaccc
                                                                      *   

KF219922_C_P-RF-GH      ttataaagaatttggagcttctgtggagttactctcatttttgccttctg
JQ272886_C_P-RF-GF      ttataaagaatttggagctactgtggagttgctctcktttttgccttctg
HE981179_C_P-RF-FG      ttataaagaatttggagcttctgtggaattgctctcttttttgccttctg
HE981180_C_P-RF-GF      ttataaagaatttggagcttctgtggaattgctctcttttttgccttctg
JQ272887_C_P-RF-GF      ttataaagaatttggagctactgtggagttactctcttttttgccttctg
KJ586803_C_P-RF-AF      ttataaagaatttggagcttctgtggaattactctcttttttgccttctg
MK534665_C_P-RF-CB      gtataaagaatttggagcttctgtggagttaatctcttttttgcctgctg
KC774323_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700580_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873530_C_P-RF-CB      ttataaagaatttggagcgtctgtggagttactctcgtttttgccttccg
KJ803771_C_P-RF-DB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EF494378_C_P-RF-CA      gtataaagaatttggagcttctgtgcagttactctcatttttgccttctg
MG826150_C_P-RF-BC      gtataaagaatttggagcttctgcggagttaatctcttttttgccttctg
FJ032343_C_P-RF-CB      gtataaagaatttggagcctctgcggagttaatctcttttttgccttctg
FJ386674_C_P-RF-BC      gtataaagaatttggagcctctgcggagttaatctcttttttgccttctg
KJ803785_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU939623_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534590_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377592_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgcctgctg
KR013948_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU939620_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgcctactg
KJ803822_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ562328_C_P-RF-CB      gtataaagaatttggagcttctacagagttactctcttttttgccttctg
MK534668_C_P-RF-BC      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534555_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534728_C_P-RF-BC      gtataaagaatttggagcttctgcggagttactctcttttttgccttctg
MK534700_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ803782_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ803798_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU882006_C_P-RF-CB      gtataaagaatttggagcttctgcagagttactctcttttttgccttctg
MG826151_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU660227_C_P-RF-BC      gtataaagaatttggagcttctgcgcctttactctcttttttgccttcgg
KJ803791_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534715_C_P-RF-BC      gtataaagaatttggagcttctgcggagttactctcttttttgccttctg
MK534686_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU939621_C_P-RF-CB      gtataaagaatttggagcttctggagagttactctcttttttgccttctg
MK534701_C_P-RF-BC      gtataaagaatttggagcttctacggagttactctcttttttgccttctg
MK534583_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534615_C_P-RF-BC      gtataaagaatttggagcttctgcggagttaatctcttttttgcctgctg
EU939630_C_P-RF-CB      gtataaagaatttggagcctctgtggagttactctcttttttgccttctg
MK534635_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534653_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377604_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgcctaatg
EU939631_C_P-RF-BC      gtataaagaatttggagcttctatggagttactctcttttttgccttctg
MK534641_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KM213033_C_P-RF-CB      gtataaagaatttggagcttctgcggagttactctcttttttgccttctg
MK534725_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KX774505_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534724_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534714_C_P-RF-BC      gtataaagaatttggagcttctgcggagttactctcttttttgccttctg
MK534721_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534559_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534620_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534637_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377556_C_P-RF-CB      gtataaagaatttggaggctctgtggagttactctcttttttgccttctg
MK052970_C_P-RF-BD      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT645045_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534632_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JF436919_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT645056_C_P-RF-BC      gtataaagaatttggagcttctgtggaattactctcttttttgccttctg
FJ562229_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ410497_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377595_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttaccttctg
EU939627_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534734_C_P-RF-BC      gtataaagaatttggagcttctgcggagttactctcttttttgccttctg
EU939632_C_P-RF-CB      gtataaagaatttggagcctctgtggagttactctcttttttgccttctg
MK534569_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ803803_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534651_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377626_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534561_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534630_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534584_C_P-RF-BC      tcataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534706_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534594_C_P-RF-BC      gtataaagaatttggagcttctatggagttactctcttttttgccttctg
KC774414_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ032337_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534713_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377590_C_P-RF-CB      gtataaagaatttggagcttctatggagttactctcttttttgccttctg
KJ173279_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ173280_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534712_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534585_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534574_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JX661498_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ684848_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377594_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534660_C_P-RF-BC      gtataaagaatttggagcctctgcggagttactctcttttttaccttctg
FJ562247_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534731_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534648_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534563_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534726_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctctttttcgccttctg
MK534655_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534681_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534670_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534695_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534718_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534729_C_P-RF-BC      gtataaagaatttggagcttctgcggagttactctcttttttgccttctg
MK534730_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534716_C_P-RF-BC      gtataaagaatttggagcttctatggagttactctcttttttgccttctg
MK534568_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534617_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK052968_C_P-RF-BD      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ803802_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ173358_C_P-RF-CB      gtataaagaatttggagcttttgtggagttactttcttttttgccttctg
GQ377614_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377602_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377573_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377565_C_P-RF-CB      gtataaagaatttggagcttctgtggaattactctcttttttgccttctg
GQ377564_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377539_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC315400_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534646_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534609_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534616_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534607_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534567_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534579_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534580_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534625_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534639_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534560_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MG826146_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MG826147_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534564_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534685_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534675_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377596_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377549_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534562_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534598_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534722_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534717_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534690_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534689_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534688_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534684_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534672_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534664_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534633_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534736_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534618_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534558_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534556_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK052967_C_P-RF-BD      gtataaagaatttggagcttctgtggagttactctcttctttgccttctg
GQ377613_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377634_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534623_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534654_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534723_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KP148337_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534662_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534687_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MF925382_C_P-RF-CB      gtataaagaatttggagctacttctgagttactctcttttttgccttctg
KU679952_C_P-RF-CB      ttataaagaatttggagcttytgcggagttactctcttttttgccttytg
KY470865_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgcctaatg
KY470858_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgcctactg
KY470871_C_P-RF-GC      ttttaaagaatttggagcttctgtggagttactctcttttttgcctactg
JQ027310_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU787444_C_P-RF-CB      gaataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700554_C_P-RF-CB      ttataaagaatttggcgcttctgtggagttactctcttttttgccttctg
KJ803827_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534679_C_P-RF-CB      gtataaagaatttggcgcttcaacggagttactctcttttttgccttatg
GQ475335_C_P-RF-CB      gtataaagaatttggagcttctttggagttactctcttttttgccgtctg
KU576102_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU576103_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ598675_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU576384_C_P-RF-CB      atataaagaatttggagcctctgtggagttactctcttttttgccttctg
KY363262_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcgtttttgccttctg
KY363263_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcgtttttgccttctg
KC774305_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534589_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcctttttgccttctg
MN683730_C_P-RF-DC      gtataaagaatttggagcttctgcggagttactctcttttttgcctaatg
DQ089798_C_P-RF-CB      atataaagaattgggagcttccggggagttactctctttttggccttctg
KY363272_C_P-RF-CB      atataaagaatttggcgcttcagcggagttactctcttttttgcctactg
KY363273_C_P-RF-CB      atataaagaatttggcgcttcagcggagttactctcttttttgcctactg
MN683712_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU589339_C_P-RF-CB      atataaagaatttggagcttccgtggagttactctcttttttgccttctg
MZ439673_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ361772_C_P-RF-GC      gtataaagaatttggagcttctgtggagttactctctttcttgccttctg
EU939577_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534719_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ386646_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ386586_C_P-RF-CB      atataaagaatttggagcttctgcagagttactctcttttttgccttctg
KY470845_C_P-RF-DC      gtataaagaatttggagcttctttggagttactctcttttttgccttctg
KY470848_C_P-RF-DC      gtataaagaatttggagcttctttggagttactctcttttttgccttctg
KY470851_C_P-RF-DC      gtataaagaatttggagcttctttggagttactctcttttttgccttctg
KY470852_C_P-RF-DC      gtataaagaatttggagcttctttggagttactctcttttttgccttctg
KY470853_C_P-RF-DC      gtataaagaatttggagcttctttggagttactctcttttttgccttctg
KY470844_C_P-RF-DC      gtataaagaatttggagcttccttggagttactctcttttttgccttctg
KY470843_C_P-RF-DC      gtataaagaatttggagcttctttggagttactctcttttttgccttctg
KY470846_C_P-RF-DC      gtataaagaatttggagcttctttggagttactctcttttttgccttctg
KY470847_C_P-RF-DC      gtataaagaatttggagcttctttggagttactctcttttttgccttctg
KY470849_C_P-RF-DC      gtataaagaatttggagcttctttggagttactctcttttttgccttctg
KY470850_C_P-RF-DC      gtataaagaatttggagcttctttggagttactctcttttttgccttctg
KY470855_C_P-RF-DC      gtataaagaatttggagcttctttggagttactctcttttttgccttctg
KY470854_C_P-RF-DC      gtataaagaatttggagcttctttggagttactctcttttttgccttctg
KY470856_C_P-RF-DC      gtataaagaatttggagcttctttggagttactctcttttttgccttctg
KJ803772_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU939547_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JQ040142_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JX661486_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JQ040148_C_P-RF-CB      gtataaagaatttggagcttctgkggagttactytcttttttgccttctg
GQ377635_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JX661485_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MG893554_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
MG893555_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534613_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KX765835_C_P-RF-GC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JQ801477_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ803753_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
JQ801476_C_P-RF-CG      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MF925370_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JN664935_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MF925381_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT645015_C_P-RF-CB      gtataaagaatttggagctactgtggagttactctcttttttgccttctg
KJ803804_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534610_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ924618_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB674504_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534606_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534735_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MG826148_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JF436923_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JN104438_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JN104442_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MF925389_C_P-RF-DC      gtataaagaatttggagcttctatggagttactctcttttttgccttctg
KJ410506_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB031265_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534682_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB367419_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU964366_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU964367_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU964370_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU964372_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU964374_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU964379_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU964380_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ562263_C_P-RF-DC      gtataaagaatttggagcttctgyggagttactctcgtttttgccttctg
KT991424_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcgtttttgccttctg
KT991427_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcgtttttgccttctg
MN650068_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT645039_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcgtttttgccttctg
AB205152_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774193_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774291_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774307_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774449_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650079_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY057948_C_P-RF-DC      gtataaagaatttggagcttctgtggaggtactctcttttttgccttctg
MN683680_C_P-RF-DC      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683580_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683678_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683721_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KP276253_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
HM750148_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgcctgctg
MN683725_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683703_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttaccgtctg
MN650083_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KX354997_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774482_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
HM750142_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
DQ478890_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY817511_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KX660689_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683711_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KX660684_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683706_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650087_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650080_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650081_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650082_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650084_C_P-RF-DC      gtataaagaatttggagcttctgaggagttactctcttttttgccttctg
MN650077_C_P-RF-DC      gtataaagaatgtggagcttctgtggagttactctcttttttgccttctg
KP276256_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
HM750150_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
HM750147_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
HM750145_C_P-RF-DC      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
HM750144_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ349241_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683700_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683699_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683697_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683696_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683687_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683688_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683686_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683724_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650072_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650073_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650074_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650075_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650078_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650085_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650086_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683723_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650069_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774456_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
HM750143_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
HM750149_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683694_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683695_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
HM750146_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU787435_C_P-RF-DC      atataaagaatttggagcttctctggagttactctcttttttgccttctg
KC774453_C_P-RF-DC      gtataaagaatttggagcttctgcggagttactctcttttttgccttctg
KC774481_C_P-RF-DC      ttataaagaatttggagcgtctttggagttactctcttttttgccttctg
KY629632_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ562226_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683722_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683634_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU519423_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683674_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JF491451_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JF491455_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683574_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683579_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JQ040174_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377607_C_P-RF-CB      atataaagaatttggagcttccgtggagttactctcttttttgccttctg
EU919166_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU919167_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774178_C_P-RF-BC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774364_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774428_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB270535_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
DQ478898_C_P-RF-DC      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774442_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774422_C_P-RF-DC      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963856_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963857_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963858_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963859_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963860_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963861_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963863_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963864_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963865_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963866_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963867_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963868_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963869_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963870_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963862_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttaccttctg
EU916239_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU916241_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU916240_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774455_C_P-RF-DC      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774452_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774435_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774443_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774484_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774498_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU787434_C_P-RF-DC      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774466_C_P-RF-DC      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774439_C_P-RF-DC      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700520_C_P-RF-CB      ttataaagaatttggagcttctgcggagttactctcatttttgccttctg
EU916228_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctctttttttgcctctg
FJ562267_C_P-RF-CB      gtataaagaatttggagcttcagtggagttactctcttttttgccttctg
AB014375_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU939668_C_P-RF-CB      gtataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU576837_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU577083_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ562227_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccgtctg
GU385774_C_P-RF-CB      gtataaagaatttggagcatctacggagttactctcttttttgccttctg
EU589337_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AF461361_C_P-RF-CB      ctataaagaatttggagcctctgtggagttactctcttttttgccttctg
KU964351_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgcctgctg
KU963930_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963931_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963932_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963933_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963934_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963935_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963936_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963938_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963939_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963940_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963941_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963942_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963943_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963944_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JQ040130_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ386593_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcttttttgccttccg
MG826149_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ562287_C_P-RF-CB      gtataaagaatttggagcttttggggagttacttttttttttgccttttg
FJ562277_C_P-RF-CB      gtataaagaatttggagcttctgtggagttaatctcttttttgccttctg
EU939602_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ562305_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU939629_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377633_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU871994_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU871995_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU871992_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU871993_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU871996_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU872014_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU872015_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU871985_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU871981_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttaccttctg
EU871983_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttaccttctg
EU871986_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttaccttctg
EU871999_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttaccttctg
EU871984_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU871987_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU871988_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU871989_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU871990_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU871991_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT645071_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB642096_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgcctactg
AB198084_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttatgccttctg
GU357843_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ562336_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ562271_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU939589_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcgtttttgccttctg
EU939565_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KR013806_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgcctgctg
AF411409_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU939581_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963883_C_P-RF-CB      gtataaagaatttggagcttccgtggagttactctcttttttgcctgctg
KM875422_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttcgg
AB367393_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT645069_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
M38454_C_P-RF-CB        gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY123424_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KY881840_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU871997_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JQ040146_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JX429896_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttccg
JX661494_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttccg
MT645029_C_P-RF-CB      gtataaagaatttggagcttctgtggaattactctcttttttgccttctg
KJ173299_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ173300_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JX026887_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttctgccttctg
FJ386633_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KY470893_C_P-RF-CB      gtataaagaatttggaacttctgtggagttactctcttttttgccttctg
KC774188_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774294_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MG893561_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ173325_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ173326_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ787446_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ787480_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426501_C_P-RF-CB      gtataaagaattgggagcttctgtggagttactctcttttttgccttctg
MT426531_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426561_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426506_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttcccttctg
MT426553_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426457_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426491_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426547_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426563_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426545_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426482_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426490_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426514_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426515_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426523_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426527_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426551_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426463_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426539_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426510_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426504_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426503_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426535_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426461_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgcctcctg
MT426455_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426483_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426459_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426460_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426462_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426464_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426469_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426470_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426473_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426475_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426476_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426477_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426478_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426479_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426481_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426486_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426487_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426489_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426492_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426507_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426544_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426574_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426568_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426555_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426550_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426546_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426542_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426564_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426540_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426537_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426562_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426573_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426533_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426532_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426528_C_P-RF-CB      gtataaagaattcggagcttctgtggagttactctcttttttgccttctg
MT426499_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426494_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426472_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426468_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426465_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK321265_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK720627_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK720628_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426456_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426466_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426467_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426471_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426480_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426484_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426485_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426488_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426493_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426495_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426496_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426497_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426498_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426500_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426502_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426505_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426508_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426509_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426511_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426512_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426513_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426517_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426518_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426519_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426520_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426521_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426522_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426524_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426525_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426526_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426529_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426530_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426534_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426536_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426538_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426541_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426543_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426549_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426554_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426556_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426557_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426558_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426559_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426560_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426565_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426566_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426567_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426569_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426570_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426571_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426572_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426575_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT426576_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ562314_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MG893559_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT645035_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KR013816_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774183_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774186_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774246_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccgtctg
AY167095_C_P-RF-CB      gtataaagaatttggagcatctgtggagttactctcttttttgccttctg
AB367400_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgcctgctg
JQ040175_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
LC458432_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ562302_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ562294_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
LC279263_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
LC279264_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
LC279265_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
LC279266_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
LC279267_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377516_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377544_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377581_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377520_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377534_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774258_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ173320_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ173322_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MW887644_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ173329_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ173330_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774324_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774230_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963990_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963991_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963993_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963994_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963995_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963998_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU963999_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU964001_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU964003_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ173350_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774328_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774317_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774322_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377548_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ386578_C_P-RF-CB      gtataaagaatttggagcttcagtggagttactctcttttttgccttctg
FJ386585_C_P-RF-CB      gtataaagaatttggagcttcagtggagttactctcttttttgccttctg
FJ386649_C_P-RF-CB      gtataaagaatttggagcttcagtggagttactctcttttttgccttctg
AB105172_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
AP011102_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB493842_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
AP011103_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB493840_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ358155_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB493837_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ358156_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB493838_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB493847_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU679945_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873537_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873540_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873538_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873543_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873542_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
AP011108_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcatttttgccttctg
HQ700557_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700542_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU695745_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
X75656_C_P-RF-CB        ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700462_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700485_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700498_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700499_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700560_C_P-RF-CB      ttataaagaatttggagcttccgtggagttactctcttttttgccttctg
KF873533_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873534_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873531_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873532_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873535_C_P-RF-CB      ttataaagaatttggagcttcagtggaattactctcttttttgccttctg
KU679939_C_P-RF-CB      ttataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU679940_C_P-RF-CB      ttataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU679956_C_P-RF-CB      ttataaagaatttggagcttccgtggagttactctcttttttgcctkctg
KF873527_C_P-RF-CB      ttataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU679954_C_P-RF-CB      ttataaagaatttggagcttccgtcgagttactctcttttttgccttctg
KU679942_C_P-RF-CB      ttataaagaatttggagcttccgtcgagttactctcttttttgccttctg
KU679943_C_P-RF-BC      ttataaagaatttggagcttccgtcgagttactctcttttttgccttctg
HQ700518_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcatttttgccttctg
HQ700527_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcatttttgccttctg
HQ700528_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcatttttgccttctg
HQ700523_C_P-RF-CB      ttataaagaatttggagcttccgtggagttactctcatttttgccttctg
HQ700530_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcatttttgccttctg
HQ700531_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcatttttgccttctg
HQ700532_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcatttttgccttctg
HQ700519_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700521_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873521_C_P-RF-BC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU679955_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgcctwctg
KU679950_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU679944_C_P-RF-BC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU679948_C_P-RF-CB      ttayaaagaatttggagcttctgtggagttactctcttttttgccttctg
KU679953_C_P-RF-BC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU679946_C_P-RF-BC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873519_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873517_C_P-RF-BC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873518_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873515_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873511_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873513_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU679958_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU679941_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873522_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873523_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF873524_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700509_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700515_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700507_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ700508_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU695744_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU695746_C_P-RF-CB      ttataaagaatttggagcttccgtggagttactctcttttttgccttctg
HQ700505_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU695741_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU695743_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MG826142_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcttttttgccttcgg
MG826141_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
KT003704_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KP148352_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AP011104_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
AP011105_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
LC416040_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683618_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgcctgctg
FJ386643_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU695742_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ562317_C_P-RF-CB      atataaagaatttggagcctcagcgcagttactctcttttttgcctactg
FJ386635_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT645070_C_P-RF-DC      gtataaagaatttggagcctctgcggagttactctcttttttgccttctg
KJ803788_C_P-RF-CB      gtataaagaatttggagcttctgtggagatacctttttttttgccttctg
HQ700526_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534582_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB241109_C_P-RF-CB      gtataaagaatttggagcttccgtggagttactctcttttttgccttctg
MN683669_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgcctacgg
EU717211_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcttttctgccttctg
AB300369_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT645048_C_P-RF-CB      gtataaagaatttggaacttctgtggagttactctcttttttgccttctg
JX504540_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ803778_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
Y18856_C_P-RF-CB        gtataaagaatttggagcttctgcggagttactctcttttttgccttctg
KX660686_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683707_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY206374_C_P-RF-CB      gtataaagaatttggagcttctctggagttactctcttttttgccttctg
EU939551_C_P-RF-CB      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB670303_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774234_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU916232_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU964315_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgcctgctg
KU964308_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964010_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964005_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964007_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964008_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964009_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964303_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964304_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964305_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964306_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964307_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964309_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964310_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964311_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964312_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964313_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964314_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964316_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964317_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KU964006_C_P-RF-CB      atataaagaatttggagcttcagtggagttactctcttttttgccttctg
KX096713_C_P-RF-CA      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KY670781_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MG826144_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KX660685_C_P-RF-DC      gtataaagaatttggagcttctgcggagttactctcttttttgccttctg
MN683641_C_P-RF-DC      gtataaagaatttggagcttctgcggagttactctcttttttgccttctg
AB367800_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ715345_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ715346_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ715347_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
HQ684849_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB049609_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KR013843_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534587_C_P-RF-BC      gtataaagaatttggagcctctgtggagttaatctcttttttgccttctg
KC774485_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683716_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534577_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774212_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU939606_C_P-RF-CB      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY040627_C_P-RF-CB      gtataaagaatttggagcttccgtggagttactctcttttttgccttctg
MT645063_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683620_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccatctg
HQ700547_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttaccttctg
GQ377560_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774198_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774201_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU522070_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU881995_C_P-RF-CB      ttataaagaatttggcgcatctgtggagttactctcttttttgccttctg
KT991420_C_P-RF-DC      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ562278_C_P-RF-DC      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
KT991417_C_P-RF-DC      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
KT991423_C_P-RF-DC      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
KT991419_C_P-RF-DC      ctatgaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683627_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683581_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MH094410_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JX661487_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JQ732168_C_P-RF-CB      gtataaagaatttggagcttccgtggagttactctcttttttgccttctg
GQ377611_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB195939_C_P-RF-CB      ttataaagaatttggagcatccgtggagttactctcttttttgccttctg
AB195940_C_P-RF-CB      ttataaagaatttggagcatccgtggagttactctcttttttgccttctg
AB195941_C_P-RF-CB      ttataaagaatttggagcatccgtggagttactctcttttttgccttctg
AB195955_C_P-RF-CB      ttataaagaatttggagcatccgtggagttactctcttttttgccttctg
AB195956_C_P-RF-CB      ttataaagaatttggagcatccgtggagttactctcttttttgccttctg
AB195957_C_P-RF-CB      ttataaagaatttggagcatccgtggagttactctcttttttgccttctg
AB033557_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774263_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774332_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774341_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KX660682_C_P-RF-DC      ctataaagaatttggagcttctgtggagttactctcttttttgccttctg
JF436922_C_P-RF-CB      gtataaagaatttggagcttctgtggagttaatctcttttttgcctttgg
MT645062_C_P-RF-DC      gtataaagaatttggagcttctgcggagttactctcttttttgccttctg
MN683717_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgcctcctg
KC774490_C_P-RF-DC      ttataaagaatttggagcttctgtggaattactctcttttttgccttctg
JN400086_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
HM750133_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcgtttttgccttctg
GQ377522_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ386581_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
DQ478886_C_P-RF-DC      ctataaagaatttggagcttctgcggagttactctcttttttgccttctg
MN683588_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY817509_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774447_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774486_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN650076_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683720_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683718_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683719_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KX660674_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683664_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683665_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KX660680_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT645060_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683677_C_P-RF-DC      gtataaagaatttgtagcttctgtggagttactctcttttttgccttctg
MN683675_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683655_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683619_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccctctg
MN683611_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683603_C_P-RF-DC      atataaagaatttggagcttctatggagttactctcttttttgccttctg
KJ410520_C_P-RF-CB      gtataaagaatttggagcatctgtggagttactctcttttttgccttctg
KC774489_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774479_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774475_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774470_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774461_C_P-RF-DC      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774434_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccgtctg
KC774432_C_P-RF-DC      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
JQ707714_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
GQ377630_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB195950_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AB195951_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JF828933_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgcctgctg
JF828934_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgcctgctg
JF828935_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgcctgctg
JF828936_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgcctgctg
JF828938_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgcctgctg
AY862864_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY862865_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY862866_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683657_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgcctactg
MN683617_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683636_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683637_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683638_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683651_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774349_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774488_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774493_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
Y18857_C_P-RF-CB        gtataaagaatttggagcttctgtggagttactctcttttttgcctgctg
MT645067_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683691_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683676_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683673_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683670_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683654_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683582_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KX660677_C_P-RF-DC      gtataaagaatttggagcttctatggagttactctcttttttgccttctg
MN683668_C_P-RF-DC      gtataaagaatttggagcttctatggagttactctcttttttgccttctg
KX660675_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683613_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683614_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683615_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683666_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KT991421_C_P-RF-DC      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KP276255_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KP276254_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF917451_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774499_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774497_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774494_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774487_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774454_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774430_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774431_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JX429898_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JF491449_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
DQ478892_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
DQ478889_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN657317_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774458_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AF330110_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683684_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683622_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683625_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683596_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683623_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683683_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683660_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683640_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774463_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY817512_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683597_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683621_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683642_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683650_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774425_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ715387_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ715384_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY247030_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ715385_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ715411_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ715412_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ715413_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ715414_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774474_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683605_C_P-RF-DC      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774495_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774492_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774476_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774483_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774222_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683610_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774344_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683639_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774468_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
DQ144601_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683571_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683592_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683594_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774457_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774420_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY800249_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774426_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY817515_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774480_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU835240_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774478_C_P-RF-DC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN657316_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT645066_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683586_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT645049_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683689_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683690_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683645_C_P-RF-DC      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683635_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683658_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683659_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683713_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MT645065_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683632_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683628_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683624_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683612_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683616_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683587_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683692_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683693_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683715_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ173349_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774471_C_P-RF-DC      atataaagaatttggagcttctgtggagttactctcttttttgccttctg
DQ478897_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY817510_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
DQ478887_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JF491448_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
JF491456_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774423_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774424_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774433_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774448_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC774472_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KU519422_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN657315_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683572_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683584_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683590_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683607_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683609_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683626_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683630_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683643_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683644_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683647_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683649_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683652_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683653_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683656_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683661_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683662_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683663_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683671_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683672_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683679_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683685_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MN683714_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
AY817513_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF214680_C_P-RF-GC      ttataaagaatttggagcttctttggagttactctcttttttgccttctg
MH368022_C_P-RF-GC      ttataaagaatttggcgcttctgtggagttactctcttttttgccttctg
MZ439768_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgcgttctg
MZ439798_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ023665_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ882613_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
EU833891_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ882617_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ882612_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ882618_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ023666_C_P-RF-GC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ882611_C_P-RF-GC      ttataaagaatttggagcttctgcggagttactctcttttttgccttctg
FJ023670_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ023664_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ023667_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ023673_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ882610_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ882614_C_P-RF-GC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534669_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534566_C_P-RF-BC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MK534663_C_P-RF-CB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ023659_C_P-RF-BC      ctataaagaatttggagcttccgtggagttactctcttttttgccttctg
FR714496_C_P-RF-CB      ttataaagaatttggagcttctgtggagttactctccattttgccttctg
KP148442_C_P-RF-BC      ttataaagaatttggagcttctgtggcgttactctcttttttgccttctg
MH746811_C_P-RF-BC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FR714490_C_P-RF-GB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KC172106_C_P-RF-GB      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MG826145_C_P-RF-BC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MH746813_C_P-RF-BC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MH746812_C_P-RF-BC      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MF488699_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AB933283_C_P-RF-AG      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JF440019_C_P-RF-AG      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB933282_C_P-RF-AG      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JF440021_C_P-RF-AG      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JF440022_C_P-RF-AG      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
EU833890_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
EU833889_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707468_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707426_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707424_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttccg
JQ707459_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707473_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707465_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccctctg
JQ707464_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707463_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707441_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB933281_C_P-RF-AG      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB933279_C_P-RF-AG      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707457_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707458_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707460_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707461_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707462_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707466_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707467_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707469_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707470_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707448_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707474_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
KP274926_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
EF464099_C_P-RF-AG      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707421_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707430_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707432_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707445_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707450_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707456_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707471_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707472_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707475_C_P-RF-GA      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB933280_C_P-RF-AG      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
MZ097814_C_P-RF-DE      ttataaagaatttggagctwctgtggagttactctcgtttttgcctgctg
GQ161806_C_P-RF-EA      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JN664933_C_P-RF-DA      ttataaagaatttggagctactgtggagttactctcgtttttgcctcctg
JN664946_C_P-RF-DA      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440017_C_P-RF-DA      ttataaagaatttggagctactgtggagttactctcatttttgccttctg
AY230115_C_P-RF-DA      ttataaagaatttggagctactgtggagttgctctcttttttgcctggtg
X68292_C_P-RF-DA        ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF439776_C_P-RF-AG      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AB453985_C_P-RF-AC      gtataaagaatttggagcttctgtggagttaatctcgtttttgcctcctg
MF925386_C_P-RF-AC      gtataaagaatttggagctactgtggagttactctcttttttgccttctg
KF779353_C_P-RF-DA      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AB222708_C_P-RF-AD      ttataaagaatttggagcgactgtggagttactctcgtttttgccttctg
AB330368_C_P-RF-DA      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
EF494376_C_P-RF-CA      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AF297619_C_P-RF-DA      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AF297620_C_P-RF-DA      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AB194949_C_P-RF-AE      ttataaagaatttggagctactgtggagttactctcatttttgccttctg
MF488705_C_P-RF-AD      ttataaagaatttggagcgactgtggagttactctcgtttttgccttctg
MH464850_C_P-RF-DA      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HM146131_C_P-RF-AD      ttataaagaatttggagcttctgtggagttactctcatttttgccttctg
MT426089_C_P-RF-AB      ttataaagaatttggagctactgtggagttactctcgtttttgcctcatg
GQ331048_C_P-RF-AE      ctataaagaatttggagctactgtggagttactctcatttttgccttctg
AY161147_C_P-RF-DA      ttataaagaatttggagctactgtggagttactctcatttttgccttctg
KJ586810_C_P-RF-AF      ttataaagaatttggagctactgtggagttactctcatttttgccttctg
AY233277_C_P-RF-AC      gtataaagaatttggagcttctgtggagttactctcgtttttgccttctg
KF214656_C_P-RF-AC      ttataaagaatttggagctactgtggagttactctcatttttgccttctg
MF925404_C_P-RF-AC      ttataaagaatttggagctactgtggagttactctcatttttgccttctg
FJ349221_C_P-RF-DE      ttataaagaatttggagcttctgtggagttgctctcgtttttgccttctg
AB674412_C_P-RF-DE      atataaagaatttggagctactgtggagttactctcgtttttgcctgctg
JN688717_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttcccttctg
KJ647356_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcttttttgcctcagg
DQ464167_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
DQ464165_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcatttttgccgtctg
DQ464166_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcatttttgccgtctg
DQ464164_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcatttttgccgtctg
KJ647349_C_P-RF-DE      ttataaagaatttggagcttcagtggagttactctcgtttttgcctaatg
MZ097766_C_P-RF-DE      ttataaagaatttggagcttctgtgsagttactctcgtttttgcctkctg
MK052976_C_P-RF-BD      ttataaagaatttggagcttccgtggagttactctcgtttttgccttctg
KJ647351_C_P-RF-DE      ttataaagaatttggagcttccgtggagttactctcgtttttgcctactg
MT426112_C_P-RF-DE      ttataaagaatttggagcttctgttgagttactctcgtttttgcctgctg
JN688689_C_P-RF-DE      ttataaagaattgggagcttccgtggagttactctcgtttttgccttctg
JN688715_C_P-RF-DE      ttataaagaatttggagcttccgtggagttactctcgtttttgccttctg
KM359442_C_P-RF-DE      ttataaagaatttggcgctacygtggagttactctcgtttttgcctcagg
MW601310_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctgttg
MZ097777_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctgttg
KJ586811_C_P-RF-DF      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AB270538_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KF679991_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
MG877711_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctymtg
KM577666_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MH724243_C_P-RF-DE      ttataaagaatttggagcttccgtggagttactctcgtttttgccttctg
MN507835_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MW601317_C_P-RF-DE      ttataaagaatttggagcttccgtggagttactctcgtttttgccttctg
MZ097806_C_P-RF-DE      ttataaagaatttggagctaccgtggacttactctcgtttttgccttctg
X65259_C_P-RF-DA        ttataaacaatttggagctactgtggagttactcccgtatttgccttctg
MH724240_C_P-RF-DE      ttataaagaatttggagcttcngtggagttactctcgtttttgccttctg
MF488702_C_P-RF-DE      ttataaagaatttggagcgactgtggagatactctcatttttgtctcctg
KX827302_C_P-RF-DE      ttataaagaatttggagctaccttggagttactctcgtttttgccttctg
MW601296_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
MZ097767_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
MH724239_C_P-RF-DE      ttataaagaatttggagcttccgtggagttactctcgtttttgccttctg
JN257204_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MW601264_C_P-RF-DE      ttataaagaatttggagcttccgtggagttactctcgtttttgccttctg
MZ097745_C_P-RF-DE      ttataaagaatttggagcttccgtggagttactctcgtttttgcctsvtg
AY341335_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
JQ687532_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcatttttgccttctg
MZ097850_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcatttttgccttctg
X80925_C_P-RF-DE        ttataaagaatttggagctactgtggagttactctcatttttgccttctg
EF103284_C_P-RF-AD      ttataaagaatttggagctaccgtggagttactctcttttttgccttctg
MH464835_C_P-RF-DE      gtataaagaatttggagctaccgtggagttactctcgtttttgccttctg
KC774450_C_P-RF-DE      atataaagaatttggagctaccgtggagttactctcttttttgccttctg
AJ627221_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
MW601227_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
MZ097716_C_P-RF-DE      ttataaagaatttggagctwctgtggagttactctcttttttgccttctg
FJ349212_C_P-RF-DE      ttataaagaatttggcgcttctgtggagttactctcgtttttgccttctg
MW601284_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctactg
MZ097758_C_P-RF-DE      ttataaagaatttggagcttcygtggagttactctcgtttttgcctactg
AB188243_C_P-RF-DE      ttataaagaatttggagcttccgtggagttactctcgtttttgccttctg
AB188245_C_P-RF-DE      ttataaagaatttggagcttccgtggagttactctcgtttttgccttctg
MW601260_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
MZ097740_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
KM577667_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgcctgctg
EU594406_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AB210819_C_P-RF-DE      ttataaagaatttggagctactgtgcagttactctcgtttttgccttctg
MW601235_C_P-RF-DE      ctataaagaatttggagctaccgtggagttactctcgtttttgccttctg
MZ097721_C_P-RF-DE      ctataaagaatttggagctaccgtggagttactctcgtttttgccttctg
KM386676_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
KM577665_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctactg
AJ627217_C_P-RF-DE      ttataaagaatttggagcttccgtggagttactctcgtttttgccttctg
AY373430_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
KM524359_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
KT366492_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
MK598656_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
MW601241_C_P-RF-DE      ttataaagaatttggagctacagtggagttactctcgtttttgccttctg
MZ097724_C_P-RF-DE      ttataaagaatttggagctacagtggagttactctcgtttttgccttctg
MK598654_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
DQ111987_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
EU594435_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
EU594436_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
MK618439_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
GQ183486_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
MK598652_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
MK598653_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
JF440012_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgcctactg
JF440007_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440004_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440005_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440013_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgcctactg
JF440011_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440001_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF439995_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF439996_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF439998_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440000_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440002_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440003_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440006_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440008_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440009_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440010_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440014_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF440015_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JF439999_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MH724222_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
AY236161_C_P-RF-DA      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MZ097667_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MT426110_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
EU185780_C_P-RF-AD      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KC012653_C_P-RF-AD      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MF967563_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MK618438_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MK618440_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MK618444_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MT426111_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
U95551_C_P-RF-DE        ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MT426113_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AJ344117_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JX898686_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JX898690_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JX898693_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JX898695_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JX898696_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JX898698_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JX898699_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MK618442_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MK618445_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JX898687_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JX898688_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
DQ315777_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KM524337_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KM524336_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
LK995391_C_P-RF-ED      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AB583679_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KM577663_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KM577664_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MN507850_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
EF103285_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KT366504_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
AY233293_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
AY233295_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
MT210033_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
GU563560_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
MH464846_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
MH464852_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
MH464851_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttctg
JN664943_C_P-RF-DE      ttataaagaatttggagcgactgtggagttactctcatttttgcctactg
KU668440_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JN664929_C_P-RF-DE      ttataaagaatttggagcgactgtggagttactctcatttttgccttctg
JN664934_C_P-RF-DE      ttataaagaatttggagcgactgtggagttactctcttttttgcctactg
JN664915_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JN664925_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttccg
GQ205377_C_P-RF-DE      ttataaagaatttggagcaactgtggagttactctcatttttgccttccg
KC875338_C_P-RF-DE      ttataaagaatttggagcaactgtggagttactctcatttttgccttccg
KC875339_C_P-RF-DE      ttataaagaatttggagcaactgtggagttactctcatttttgccttccg
GQ205378_C_P-RF-DE      ttataaagaatttggagcaactgtggagttactctcatttttgccttccg
GQ205387_C_P-RF-DE      ttataaagaatttggagcaactgtggagttactctcatttttgccttccg
GQ205379_C_P-RF-DE      ttataaagaatttggagcgactgtggagttactctcatttttgccttctg
AB033558_C_P-RF-DE      ttataaagaatttggagcgactgtggagttactctcatttttgccttctg
MK516279_C_P-RF-DE      ttataaagaatttggagcgactgtggagttactctcatttttgccttctg
MK516280_C_P-RF-DE      ttataaagaatttggagcgactgtggagttactctcatttttgccttctg
MK541689_C_P-RF-DE      ttataaagaatttggagcgactgtggagttactctcatttttgccttctg
DQ315780_C_P-RF-DE      ttataaagaatttggagcaactgtggagttactctcatttttgccttctg
KT366505_C_P-RF-DE      ttataaagaatttggagcgactgtggagttactctcatttttgccttctg
DQ315779_C_P-RF-DE      ttataaagaatttggagcgactgtggagttactctcatttttgccttctg
JN664940_C_P-RF-DE      ttataaagaatttggagcgactgtggagttactctcatttttgccttctg
MK052957_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
MK052969_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KJ470898_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcttttttgcctactg
KJ470897_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
KF192835_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KJ470891_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KF192833_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MF618346_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KF192840_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KF192836_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KF192838_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KF192837_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KF192839_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KF192841_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MF618347_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KJ470892_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KJ470888_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KJ470890_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KJ470884_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KJ470886_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KJ470887_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700494_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
FJ692536_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700492_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctcatg
HQ700579_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctggtg
HQ700585_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctggtg
AB048702_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AB048703_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700493_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700534_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700533_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MH481860_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
J02202_C_P-RF-DE        ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MH481862_C_P-RF-DE      ttataaagaatttggagctactatggagttactctcgtttttgccttctg
MH481859_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MH481858_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MH481861_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700536_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700541_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700581_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700503_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AB033559_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700497_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700501_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700524_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700525_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700582_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700583_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700584_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700535_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700537_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700538_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700500_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700539_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
HQ700540_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JN040803_C_P-RF-DE      ttataaagaatttggagctagtgtggagttactctcgtttttgccttctg
JF754613_C_P-RF-DE      gtataaagaatttggagcttctgtggagttactctcttttttgcctgctg
JN257154_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctactg
FJ562223_C_P-RF-CD      ttataaagaatttggagctactgtggagttactctcttttttgccttcta
MZ097826_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MF925401_C_P-RF-DB      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MF925360_C_P-RF-DB      ttataaagaatttggagctactgtggagttactctcgtttttgcctgctg
MF925396_C_P-RF-DC      ttataaagaatttggagctactgtggagttactctcgtttttgcctactg
EF103283_C_P-RF-AD      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
EF103282_C_P-RF-AD      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KM524357_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KT366503_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KR905422_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MF925371_C_P-RF-DC      gtataaagaatttggagctactgtggagttactctcgtttttgccttctg
MF925388_C_P-RF-DC      gtataaagaatttggagctactgtggagttactctcttttttgccttctg
MF925392_C_P-RF-DB      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MF925402_C_P-RF-BD      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AB674436_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
MZ097838_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
MZ097680_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctgctg
MZ097703_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctgctg
MF925397_C_P-RF-DC      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
MF925384_C_P-RF-DB      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AY161145_C_P-RF-AD      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AY161146_C_P-RF-AD      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
GQ377627_C_P-RF-CD      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AY161140_C_P-RF-AD      tcataaagaatttggagctactgtggagttactctcgtttttgccttctg
AY161141_C_P-RF-AD      tcataaagaaattggagctactgtggagttactctcgtttttgccttctg
JN642141_C_P-RF-DE      ttaaaagaaatttggagcttctgtggagttactctcgtttttgcctgttg
JN642152_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttttg
AB674434_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgcctactg
JN642137_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
JN642160_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttctgccttctg
MZ097652_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgcctgctg
KF471643_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctcagg
MW887645_C_P-RF-CD      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
MZ097822_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JN040798_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JN642127_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcatttttgccttctg
JF754616_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctgctg
MW601230_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcatttttgccttctg
MZ097719_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcatttttgccttctg
JN257210_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JN257174_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MZ097687_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctkctg
JN257206_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JN257207_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JN257191_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JN257216_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JN642139_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AB674432_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AB674433_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
JN257164_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
JN257189_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
FJ904405_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctcaag
FN594767_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctcatg
FJ904436_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgcctaatg
FJ904409_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgcctcatg
KP168421_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
FJ904408_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgcctgctg
FJ349207_C_P-RF-DE      ttataaagaatttggagctactgttgagttactctcgtttttgcctgctg
FJ904416_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgcctgctg
FJ904417_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgcctgctg
FJ904414_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctactg
FJ904407_C_P-RF-DE      ttataaagaatttggagctactgtsgagttactctcgtttttgccttctg
FJ904430_C_P-RF-DE      ttataaagaatttggagctactgtgcagttactctcgtttttgccttctg
FJ904425_C_P-RF-DE      ttataaagaatttggagctactgtgcagttactctcgtttttgccttctg
FJ904400_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
DQ991753_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgcctactg
FJ904398_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
GQ161788_C_P-RF-AE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
FJ904394_C_P-RF-DE      ttataaagaatttggagctactgtgcagttactctcttttttgcctgttg
FN594769_C_P-RF-DE      ttataaagaatttggagctwstgtgkagttactctcgtttttgccttctg
FJ904440_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcttttttgccttctg
KX357628_C_P-RF-DE      ttataaagaatttggagcttctgtgcagttactctcgtttttgcctgctg
GQ161767_C_P-RF-AE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
HF571060_C_P-RF-AE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
GQ161837_C_P-RF-AE      ttataaagaatttggagctactgtggagttactctcggttttgccctttg
GQ161838_C_P-RF-AE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
FJ904444_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
FJ904396_C_P-RF-DE      ttataaagagtttggagctactgtggagttactctcgtttttgccttctg
GQ161753_C_P-RF-AE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
FJ904428_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctcagg
FJ904404_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctgttg
KX357631_C_P-RF-DE      atataaagaatttggagcctctgtggagttactctcgtttttgccttctg
FJ904442_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KX357627_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcatttttgccttctg
KX357626_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctcagg
MT591274_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctactg
MT591275_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgcctactg
FJ904401_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
KU736921_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcttttttgccttctg
KU736922_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcttttttgccttctg
KP288875_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgcctactg
KX357632_C_P-RF-DE      ttataaagaatttggagctactgtgcagttactctcgtttttgccttctg
KP168417_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcttttttgccttctg
KP168418_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcttttttgccttctg
KP168420_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
FJ904437_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
KP168416_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
FJ904447_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
MT591280_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
FJ904441_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttmtg
FJ904397_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
KF170740_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KM606741_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttccg
FJ904406_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgcctactg
KM606750_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KP995112_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KM606751_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KX357636_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KX827299_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KX357630_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KX357625_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KX357629_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KX357634_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KX357624_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KX357623_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KX357633_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KX357635_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
FJ904403_C_P-RF-DE      ttataaagaatttggagcttctgtggagttactctcgtttttgccttctg
KX357641_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KU736917_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KU736914_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KU736915_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KU736916_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KU736923_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
MH685719_C_P-RF-DE      ttataaagaatttggagctaccgtggagttactctcgtttttgccttccg
MT426114_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
KU711666_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
FN594771_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AM494716_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
GU177079_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
FN594770_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
GQ161754_C_P-RF-DE      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
                             *  *    *               *                    

KF219922_C_P-RF-GH      actttttcccgtctgttcgtgaycttctcgacaccgcttcagctytstac
JQ272886_C_P-RF-GF      actttttcccgtcwgttcgggayctwctcgacaccgcttcagccttstac
HE981179_C_P-RF-FG      atttcttcccgtcggttcgggacctactcgacaccgcttcagccctctac
HE981180_C_P-RF-GF      atttcttcccgtcggttcgggacctactcgacaccgcttcagccctctac
JQ272887_C_P-RF-GF      actttttcccgtcagttcgggacctactcgacaccgcttcagccctctac
KJ586803_C_P-RF-AF      actttttcccgtcagttcgggacctactcgacaccgcttcagccctctac
MK534665_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgctacagctctctat
KC774323_C_P-RF-CB      acttctttccttctattcgagatcttctcgacaccgcctcagctctgtat
HQ700580_C_P-RF-CB      atttctttccgtctgttcgagatctcctcgacaccgcctcagctctgtac
KF873530_C_P-RF-CB      atttctttccatctattcgtgatctcctcgacacggcctccgctctctat
KJ803771_C_P-RF-DB      acttctttccttctattcgagatctcctcgacaccgcccttgctctgtat
EF494378_C_P-RF-CA      acttctttccttctattcgagatcttctcgacaccgcctctgctctgtac
MG826150_C_P-RF-BC      acttctttcctactattcgagatctcctcgacaccgcctctgctctgtat
FJ032343_C_P-RF-CB      acttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
FJ386674_C_P-RF-BC      acttctttcctaatattcragatctcctcgacaccgcctctgctctgtat
KJ803785_C_P-RF-CB      acttctttccgtctattcgggaccttctcgacaccgcctctgctctgtgt
EU939623_C_P-RF-CB      acttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
MK534590_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgccactgctatgtat
GQ377592_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KR013948_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgccactgctctgcat
EU939620_C_P-RF-CB      acttctatccttctgttcgagatcttctcgacaccgccgctgctctgtat
KJ803822_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562328_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgtctctgctctgcat
MK534668_C_P-RF-BC      acttctttccttccattcgagatcttctcgacaccgcctctgctctgtat
MK534555_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtac
MK534728_C_P-RF-BC      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK534700_C_P-RF-BC      acttctttccttctattcgagatcttctcgacaccgcctctgctctgcat
KJ803782_C_P-RF-CB      acttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KJ803798_C_P-RF-CB      acttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
EU882006_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtac
MG826151_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU660227_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgccactgccctgtat
KJ803791_C_P-RF-CB      acttttttccttctgttcgggatctcctcgacaccgcctctgctttgtat
MK534715_C_P-RF-BC      acttctttccttccattcgtgatctcctcgacaccgcctctgctctgtat
MK534686_C_P-RF-BC      acttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU939621_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534701_C_P-RF-BC      acttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK534583_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534615_C_P-RF-BC      acttctttccttctgttcgagatcttctcgacaccgcctctgctctgtat
EU939630_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgccactgctctgtat
MK534635_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534653_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
GQ377604_C_P-RF-CB      acttctttccttctgctcgagatctcctcgacaccgcctctgctctgtat
EU939631_C_P-RF-BC      acttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
MK534641_C_P-RF-BC      acttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KM213033_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534725_C_P-RF-CB      acttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KX774505_C_P-RF-BC      acttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK534724_C_P-RF-CB      acttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK534714_C_P-RF-BC      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK534721_C_P-RF-BC      acttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK534559_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534620_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534637_C_P-RF-BC      acttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
GQ377556_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK052970_C_P-RF-BD      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT645045_C_P-RF-BC      acttctttccttctattcgagacctactcgacacagccactgctctgtat
MK534632_C_P-RF-CB      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
JF436919_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctctgctctgtat
MT645056_C_P-RF-BC      acttctttccttctgttcgagatctcctcgacaccgcctctgctctgtac
FJ562229_C_P-RF-CB      acttctttccttctattcgagatcttctcgacaccgcctctgctctgcat
KJ410497_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377595_C_P-RF-BC      acttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU939627_C_P-RF-BC      acttctttccttctattcgagatctgctcgacaccgcctctgctctgcat
MK534734_C_P-RF-BC      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
EU939632_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
MK534569_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KJ803803_C_P-RF-CB      acttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK534651_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
GQ377626_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
MK534561_C_P-RF-BC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534630_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534584_C_P-RF-BC      atttctttccatctattcgagatctcctcgacaccgcctcagctctgtat
MK534706_C_P-RF-CB      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK534594_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774414_C_P-RF-BC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtac
FJ032337_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
MK534713_C_P-RF-CB      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
GQ377590_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173279_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173280_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534712_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgcgctgtat
MK534585_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcctctgctctctat
MK534574_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX661498_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
HQ684848_C_P-RF-CB      acttctttccttctgttcgagatctcctcgacaccgcatctgctctgtat
GQ377594_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK534660_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562247_C_P-RF-CB      acttctttccttctattcgagatctactcgacaccgcctctgctctgtat
MK534731_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534648_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534563_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534726_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534655_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534681_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534670_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctccgctctgtat
MK534695_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534718_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534729_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534730_C_P-RF-BC      actcttttccttctattcacgatctcctcgacaccgcctctgctctgtat
MK534716_C_P-RF-BC      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK534568_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534617_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK052968_C_P-RF-BD      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ803802_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KJ173358_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377614_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtac
GQ377602_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377573_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377565_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377564_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377539_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC315400_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534646_C_P-RF-BC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534609_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534616_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534607_C_P-RF-BC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534567_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534579_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534580_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534625_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534639_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
MK534560_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG826146_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG826147_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534564_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534685_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534675_C_P-RF-BC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377596_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377549_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgcgctgtat
MK534562_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534598_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534722_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534717_C_P-RF-CB      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK534690_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534689_C_P-RF-BC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534688_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534684_C_P-RF-BC      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK534672_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK534664_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534633_C_P-RF-BC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534736_C_P-RF-BC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534618_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534558_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534556_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK052967_C_P-RF-BD      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377613_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377634_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534623_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534654_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534723_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148337_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534662_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534687_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF925382_C_P-RF-CB      acttctttccgtctattcgggatctcctcgacaccgccaatgctttgttt
KU679952_C_P-RF-CB      acttttttccgtctattcgagatcttctcgacactgcatccgctctatat
KY470865_C_P-RF-GC      acttctttccgtctattcaagacctcttcgacaccgcaacagctctgtat
KY470858_C_P-RF-GC      atttctttccgtctattcaagatcttatcgacacagcaacagctctgtat
KY470871_C_P-RF-GC      atttctttccgtctattcaagaccttatcgacacagcaacagctctgtat
JQ027310_C_P-RF-CB      acttctttccttctgttcgagatctcctcgacaccgcctctgctctatat
EU787444_C_P-RF-CB      acttctttccttctattcgagatctcctcaacaccgcctctgctctgtat
HQ700554_C_P-RF-CB      atttctttccgtctattcgagacctcctcgacaccgccacagctctgtac
KJ803827_C_P-RF-BC      acttctttccttctattcgagacctcctcgacaccgccactgctttgtat
MK534679_C_P-RF-CB      acttctttccttctatgcgagatctcctcgacaccgcttctgctttgtat
GQ475335_C_P-RF-CB      acttctttccttccattcgagatctccttgacaccgcctctgctatgtat
KU576102_C_P-RF-CB      acttctttccttcggttcgagatctcctcgacaccgcctctgctccgtgt
KU576103_C_P-RF-CB      acttctttccttcggttcgagatctcctcgacaccgcctctgctctgtgt
KJ598675_C_P-RF-CB      acttctttccttccattcgtgatctcctcgacaccgcctctgccctgtat
KU576384_C_P-RF-CB      acttctttccttctattcgagatcccctcgacaccgcctcagctctatat
KY363262_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KY363263_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KC774305_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcctcagctctctat
MK534589_C_P-RF-BC      acttttttccttctattcgagatctcctcgacaccgcctcagctctatat
MN683730_C_P-RF-DC      acttctttcctaatatgcgagatctcctcgataccgcctctgctctgtat
DQ089798_C_P-RF-CB      acttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KY363272_C_P-RF-CB      acttcttcccttctattcgagatcttctcgacaccgcctctgctttgtat
KY363273_C_P-RF-CB      acttctttccttctattcgagatcttctcgacaccgcctctgctttgtat
MN683712_C_P-RF-DC      acttctttccgtctgttcgggatctcctcgacacagcctctgctctgtat
EU589339_C_P-RF-CB      acttctttccttctatccgagatctcctcgacaccgccactgctctgcat
MZ439673_C_P-RF-CB      acttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtat
FJ361772_C_P-RF-GC      acttttttccttctattcgagatctcctcgacaccgccgctgctctatat
EU939577_C_P-RF-CB      acttctttccttctattcgagacctccttgacaccgcctctgctctgtat
MK534719_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386646_C_P-RF-CB      acttctttccttctattcaagatctcctcgacaccgcctctgctctgtat
FJ386586_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctatgttt
KY470845_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KY470848_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KY470851_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KY470852_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KY470853_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KY470844_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KY470843_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KY470846_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KY470847_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KY470849_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KY470850_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KY470855_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KY470854_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KY470856_C_P-RF-DC      acttctttccttctattcgcgatctcctcgacaccgccgctgctctgtat
KJ803772_C_P-RF-BC      acttctttccttctattcgtgatctcctcgacaccgcctctgctctgtat
EU939547_C_P-RF-CB      acttctttccatctattcgagatctcctcgacaccgcctctgctctctat
JQ040142_C_P-RF-CB      acttctttccatctattcgagatctcctcgacaccgcctctgctctctat
JX661486_C_P-RF-CB      acttctttccatctattcgagatctcctcgacaccgcctctgctctctat
JQ040148_C_P-RF-CB      acttctttccatctattcgagatctcctcgacaccgcctctgctctctat
GQ377635_C_P-RF-BC      acttctttccatctattcgagatctcctcgacaccgcctctgctctctat
JX661485_C_P-RF-CB      acttctttccatctattcgagatctcctcgacaccgcctctgctctctat
MG893554_C_P-RF-CB      acttctttccatctattcgagatctcctcgacaccgcctctgctctctat
MG893555_C_P-RF-CB      acttctttccatctattcgagatctcctcgacaccgcctctgctctctat
MK534613_C_P-RF-CB      atttctttccgtctattcgagacctcatcgacaccgcatcagctctgtat
KX765835_C_P-RF-GC      acttctttccttccattcgagatctcctcgacaccgcctctgctctacat
JQ801477_C_P-RF-BC      acttctttccgtctattcgggatctcctcgacaccgcctcagctctgtat
KJ803753_C_P-RF-CB      acttctttccgtctattcgggatctcctcgacaccgcctctgctctgtat
JQ801476_C_P-RF-CG      acttctttccgtctattcgggatctcctcgacaccgcctctgctctgtat
MF925370_C_P-RF-CB      acttctttccgtctattcgggatctcctcgacaccgcctctgctctgtat
JN664935_C_P-RF-DC      acttctttccgtctattcgggatctcctcgacaccgcctctgctctgtat
MF925381_C_P-RF-CB      acttctttccgtctattcgggatctcctcgacaccgcctctgctctgtat
MT645015_C_P-RF-CB      acttttttccttctattcgtgatctcctcgacaccgcctctgctctgtat
KJ803804_C_P-RF-CB      acttctttccttctattcgtgatctcctcgacaccgcctctgctctgtat
MK534610_C_P-RF-BC      acttttttccttctattcgagatctcctcgacactgcctctgctttgtat
GQ924618_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
AB674504_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK534606_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK534735_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MG826148_C_P-RF-CB      acttctttccttctattcgtgatctcctcgacaccgcctctgctctgtat
JF436923_C_P-RF-CB      acttctttccttctattcgtgatctcctcgacaccgcctctgctctgtat
JN104438_C_P-RF-CB      acttctttccttctattcgtgatctcctcgacaccgcctctgctctgtat
JN104442_C_P-RF-CB      acttctttccttctattcgtgatctcctcgacaccgcctctgctctgtat
MF925389_C_P-RF-DC      acttctttccttctattcgtgatctcctcgacaccgcctctgctctgtat
KJ410506_C_P-RF-CB      acttctttccttctactcgtgatctcctcgacaccgcctctgctctgtat
AB031265_C_P-RF-CB      acttctttccttctattcgtgatctcctcgacaccgcctctgctctgtat
MK534682_C_P-RF-CB      acttctttccttctattcgtgatctcctcgacaccgcctctgctctgtat
AB367419_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgccgctgctctgtat
KU964366_C_P-RF-DC      acttctttccttctattcgggatctcatcgacaccgcctctgctctgcat
KU964367_C_P-RF-DC      acttctttccttctattcgggatctcatcgacaccgcctctgctctgcat
KU964370_C_P-RF-DC      acttctttccttctattcgggatctcatcgacaccgcctctgctctgcat
KU964372_C_P-RF-DC      acttctttccttctattcgggatctcatcgacaccgcctctgctctgcat
KU964374_C_P-RF-DC      acttctttccttctattcgggatctcatcgacaccgcctctgctctgcat
KU964379_C_P-RF-DC      acttctttccttctattcgggatctcatcgacaccgcctctgctctgcat
KU964380_C_P-RF-DC      acttctttccttctattcgggatctcatcgacaccgcctctgctctgcat
FJ562263_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
KT991424_C_P-RF-DC      acttctttccttctatacgggatctcctcgacaccgcctctgctctgtat
KT991427_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN650068_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT645039_C_P-RF-CB      acttctttccttctattcgagatcttctcgacaccgccgctgctctgtat
AB205152_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcctctgctctatat
KC774193_C_P-RF-CB      acttctttccttctattcgagatcttctcgacaccgcctcagctctgtat
KC774291_C_P-RF-CB      acttctttccttctattcgagatcttctcgacaccgcctcagctctgtat
KC774307_C_P-RF-CB      acttctttccttctattcgagatcttctcgacaccgcctcagctctgtat
KC774449_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN650079_C_P-RF-DC      atttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
AY057948_C_P-RF-DC      acttctttccttccaatcgggatctcctcgacaccgcctctgctctggat
MN683680_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683580_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683678_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683721_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
KP276253_C_P-RF-DC      acttttttccttctattcgggatcttctcgacaccgcctctgctctatat
HM750148_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcttctgctctgtat
MN683725_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683703_C_P-RF-DC      acttctttccttctattcgggatcttattgacaccgcctctgctctgtat
MN650083_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
KX354997_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
KC774482_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
HM750142_C_P-RF-DC      acttctttccttctattcgggatctcatcgacaccgcctctgctctgtat
DQ478890_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctttgtat
AY817511_C_P-RF-DC      atttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
KX660689_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683711_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
KX660684_C_P-RF-DC      acttctttccttctattcgggatcttctcgacaccgcctctgctctgtat
MN683706_C_P-RF-DC      acttctttccttctattcgggatcttctcgacaccgcctctgctctgtat
MN650087_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgcactgtat
MN650080_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN650081_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN650082_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN650084_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN650077_C_P-RF-DC      acttctttccttctattcgggatatcctcgacaccgcctctgctctgtat
KP276256_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
HM750150_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
HM750147_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
HM750145_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
HM750144_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
FJ349241_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgcat
MN683700_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683699_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683697_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683696_C_P-RF-DC      acttctttccttctattcgggatcttctcgacaccgcctctgctctgtat
MN683687_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683688_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683686_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683724_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN650072_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN650073_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN650074_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN650075_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN650078_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN650085_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN650086_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683723_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN650069_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgccactgctctgtat
KC774456_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
HM750143_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
HM750149_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683694_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683695_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
HM750146_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
EU787435_C_P-RF-DC      acttttttccttctatacgagatctcctcgacaccgcctctgctctgtat
KC774453_C_P-RF-DC      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KC774481_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY629632_C_P-RF-DC      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
FJ562226_C_P-RF-CB      acttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MN683722_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
MN683634_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU519423_C_P-RF-DC      acttctttccttctatccgagatctcctcgacaccgcctcagctctgtat
MN683674_C_P-RF-DC      acttctttccttctatccgagatctcctcgacaccgcctcagctctgtat
JF491451_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JF491455_C_P-RF-DC      acttctttccttctatacgagatctcctcgacaccgcctctgctctgtat
MN683574_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683579_C_P-RF-DC      acttctttccttctatacgagatctcctcgacaccgcctctgctctgtat
JQ040174_C_P-RF-CB      acttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377607_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
EU919166_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU919167_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgccgctgctctgtat
KC774178_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KC774364_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KC774428_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
AB270535_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ478898_C_P-RF-DC      acttctttccttctatacgagatctcctcgacaccgcctctgctctgtat
KC774442_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774422_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963856_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963857_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963858_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963859_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963860_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963861_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963863_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963864_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963865_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963866_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963867_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963868_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963869_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963870_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963862_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU916239_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU916241_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU916240_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774455_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774452_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774435_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774443_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774484_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774498_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU787434_C_P-RF-DC      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KC774466_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774439_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
HQ700520_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcttcagctttgtat
EU916228_C_P-RF-CB      acctttttccttctgttcgtgatctacttgacaccgccactgctctgtat
FJ562267_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
AB014375_C_P-RF-CB      acttctttccttccattcgggatctcctcgacaccgcctccgctctgtat
EU939668_C_P-RF-CB      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576837_C_P-RF-BC      acttttttccttctattcgggagctcctcgacaccgcctcagctctgtat
KU577083_C_P-RF-BC      acttttttccttctattcgggagctcctcgacaccgcctcagctctgtat
FJ562227_C_P-RF-CB      acttctttccttcaattcgagatctcctcgacactgcctctgctctatat
GU385774_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcctcagctctgtat
EU589337_C_P-RF-CB      acttttttccttctatccgggatctcctcgacaccgcctctgctctgtat
AF461361_C_P-RF-CB      acttttttccgtctattcgagatctccttgacaccgcctcagctctgtat
KU964351_C_P-RF-CB      acttctttccttctattagagatctcctcgacaccgcctctgcattgtat
KU963930_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU963931_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU963932_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU963933_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU963934_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU963935_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU963936_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU963938_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU963939_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU963940_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU963941_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU963942_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU963943_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU963944_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
JQ040130_C_P-RF-CB      acttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
FJ386593_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG826149_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562287_C_P-RF-CB      acttttttccttccattcgagatctcctcgacaccgcctccgctctgtat
FJ562277_C_P-RF-CB      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
EU939602_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562305_C_P-RF-CB      acttctttccttccattcgagatctcctcgacaccgcctcagctctgtat
EU939629_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
GQ377633_C_P-RF-CB      acttctttccgtctattcgagatctccttgacaccgcctcagctctgtat
EU871994_C_P-RF-CB      acttctttccgtctattcaagatctccgcgacaccgcctcagctctgtat
EU871995_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU871992_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU871993_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU871996_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU872014_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU872015_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU871985_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtgt
EU871981_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU871983_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU871986_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU871999_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU871984_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU871987_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU871988_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU871989_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU871990_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
EU871991_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
MT645071_C_P-RF-CB      acttttttccttccattcgagatctcctcgacaccgcctcagctctgtat
AB642096_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
AB198084_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
GU357843_C_P-RF-CB      acttctttccttctatccgggatctcctcgacaccgcctctgctctgtat
FJ562336_C_P-RF-CB      acttctttccttctgttcgagatctcgtcgacaccgccacagctctgtat
FJ562271_C_P-RF-CB      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
EU939589_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcctcagctctgtat
EU939565_C_P-RF-CB      acttctttccttctgttcgrgatctcctcgacaccgcctcagctctgtat
KR013806_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
AF411409_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
EU939581_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
KU963883_C_P-RF-CB      acttctttccttctattcgagatcttctcgacaccgcctcagctctgtat
KM875422_C_P-RF-CB      acttctttccttccgttcgggatctcctcgacaccgcctcagctctgtat
AB367393_C_P-RF-CB      acttctttccttccattcgagatctcctcgacaccgcctcagctctgtat
MT645069_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgccgctgctctgtat
M38454_C_P-RF-CB        acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
AY123424_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KY881840_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
EU871997_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
JQ040146_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
JX429896_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
JX661494_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcctcggctctgtat
MT645029_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgcat
KJ173299_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173300_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX026887_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgccaccgctctgcat
FJ386633_C_P-RF-CB      acttctttccttctattcaagatctcctcgacaccgcctctgctctgtat
KY470893_C_P-RF-CB      acttttttccttctattcgagatctccttgacaccgcctctgctctgtat
KC774188_C_P-RF-CB      acttctttccttctgttcgagatctcctcgacaccgcctcagctctgtat
KC774294_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG893561_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173325_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173326_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ787446_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
FJ787480_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
MT426501_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426531_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctcagctttgtat
MT426561_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgaat
MT426506_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426553_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctcagctttgtat
MT426457_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426491_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426547_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426563_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426545_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctcagctttgtat
MT426482_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctcagctttgtat
MT426490_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctcagctttgtat
MT426514_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctcagctttgtat
MT426515_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctcagctttgtat
MT426523_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctcagctttgtat
MT426527_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctcagctttgtat
MT426551_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctcagctttgtat
MT426463_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426539_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426510_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426504_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426503_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctcagctttgtat
MT426535_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctcagctttgtat
MT426461_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426455_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426483_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426459_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426460_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426462_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426464_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426469_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426470_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426473_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426475_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426476_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426477_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426478_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426479_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426481_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426486_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426487_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426489_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426492_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426507_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426544_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426574_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426568_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426555_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426550_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426546_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426542_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426564_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426540_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426537_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426562_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426573_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426533_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426532_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426528_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426499_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426494_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426472_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426468_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426465_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MK321265_C_P-RF-CB      acttctttccttctattcgagatctcctcgacactgcctcagctttgtat
MK720627_C_P-RF-CB      acttctttccttctattcgagatctcctcgacactgcctcagctttgtat
MK720628_C_P-RF-CB      acttctttccttctattcgagatctcctcgacactgcctcagctttgtat
MT426456_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426466_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426467_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426471_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426480_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426484_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426485_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426488_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426493_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426495_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426496_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426497_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426498_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426500_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426502_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426505_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426508_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426509_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426511_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426512_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426513_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426517_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426518_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426519_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426520_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426521_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426522_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426524_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426525_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426526_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426529_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426530_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426534_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426536_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426538_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426541_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426543_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426549_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426554_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426556_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426557_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426558_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426559_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426560_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426565_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426566_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426567_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426569_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426570_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426571_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426572_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426575_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
MT426576_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctttgtat
FJ562314_C_P-RF-CB      acttcttcccttctattcgagacctcctcgacaccgcctctgctctgtat
MG893559_C_P-RF-CB      acttcttcccgtctattcgagatctcctcgacaccgcctctgctctgtat
MT645035_C_P-RF-CB      acttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
KR013816_C_P-RF-CB      acttctttccttccatccgagatctccttgacaccgcctctgctctgtat
KC774183_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KC774186_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KC774246_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY167095_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
AB367400_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ040175_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
LC458432_C_P-RF-CB      acttctttccttccattcgagatctcctcgacaccgcctcagctctgtat
FJ562302_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562294_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
LC279263_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
LC279264_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
LC279265_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
LC279266_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
LC279267_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
GQ377516_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
GQ377544_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
GQ377581_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
GQ377520_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
GQ377534_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KC774258_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173320_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173322_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MW887644_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173329_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173330_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774324_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774230_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963990_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KU963991_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KU963993_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KU963994_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KU963995_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KU963998_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KU963999_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KU964001_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KU964003_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KJ173350_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774328_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774317_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KC774322_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
GQ377548_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386578_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386585_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386649_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB105172_C_P-RF-CB      atttctttccatctattcgagatctcctcgacaccgcatcagctttgtac
AP011102_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcctcggctttgtat
AB493842_C_P-RF-CB      atttctttccatctattcgagatctcctcgacaccgcatcagctttgtat
AP011103_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcctcagcgttgtat
AB493840_C_P-RF-CB      atttctttccgtctattcgggacctccttgacaccgcctcagctttgtat
GQ358155_C_P-RF-CB      atttctttccgtctattcgagacctcctcgacaccgcctcagccttgtat
AB493837_C_P-RF-CB      atttctttccgtctattcgagacctcctcgacaccgcctcagccttgtat
GQ358156_C_P-RF-CB      atttctttccgtctattcgagacctcctcgacaccgcctcagccttgtat
AB493838_C_P-RF-CB      atttctttccgtctattcgagacctcctcgacaccgcctcagccttgtat
AB493847_C_P-RF-CB      atttctttccgtctattcgagacctcctcgacaccgcctcagccttgtat
KU679945_C_P-RF-CB      atttctttccgtctattcgagatctccttgacactgccttggctctatat
KF873537_C_P-RF-CB      atttctttccgtctattcgagatctccttgayactgccwycgctctatat
KF873540_C_P-RF-CB      atttctttccgtctattcgagatctccttgacactgcctccgctctatat
KF873538_C_P-RF-CB      atttctttccgtctattcgagatctccttgacactgcctccgctctatat
KF873543_C_P-RF-CB      atttctttccgtctattcgagatctccttgacactgcctccgctctatat
KF873542_C_P-RF-CB      atttctttccgtctattcgagatctccttgacactgcctccgctctatat
AP011108_C_P-RF-CB      acttctttccgtctattcgagatctcctagataccgcctcagctttgtat
HQ700557_C_P-RF-CB      atttcttcccatcgattcgagatctcctcgacaccgcctcagctctgtac
HQ700542_C_P-RF-CB      atttctttccatctattcgagatctcctcgacaccgcctcagctctgtat
KU695745_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
X75656_C_P-RF-CB        atttctttccatctattcgagacctcctcgacaccgcctcagctctgtat
HQ700462_C_P-RF-CB      atttctttccatctattcgagacctcctcgacaccgcctcagctctgtac
HQ700485_C_P-RF-CB      atttctttccatctattcgagacctccttgacaccgcckcagctctgtac
HQ700498_C_P-RF-CB      atttctttccgtctattcgagatcttctcgacaccgcctcagctctgtat
HQ700499_C_P-RF-CB      atttctttccgtctattcgagatcttctcgacaccgcctcagctctgtat
HQ700560_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcctcagctctgtac
KF873533_C_P-RF-CB      atttttttccgtctattcgagatcttctcgacactgcatccgctctatat
KF873534_C_P-RF-CB      atttttttccgtctattcgagatcttctcgacactgcatccgctctatat
KF873531_C_P-RF-CB      atttttttccgtctattcgagatcttctcgacactgcatccgctctatat
KF873532_C_P-RF-CB      atttttttccgtctattcgagatcttctcgacactgcatccgctctatat
KF873535_C_P-RF-CB      atttctttccatctattcgagatcttctcgacaccgccgccgctctatat
KU679939_C_P-RF-CB      atttctttccatctattcgagatcttctcgacaccgccgccgctctatat
KU679940_C_P-RF-CB      atttctttccatctattcgagatcttctcgacaccgccgccgctctatat
KU679956_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctccgctctgtat
KF873527_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcctccgctctgtat
KU679954_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcctccgctctgtat
KU679942_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcctccgctctgtat
KU679943_C_P-RF-BC      atttctttccgtctattcgagatctcctcgacaccgccwccgctctgtat
HQ700518_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcctctgctttgtat
HQ700527_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcttcagctttgtat
HQ700528_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcttcagctttgtat
HQ700523_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctttatat
HQ700530_C_P-RF-CB      atttctttccctcgattcgagatctcctcgacaccgcctcagctttgtat
HQ700531_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctttgtat
HQ700532_C_P-RF-CB      acttctttccgtctattcgagatctcctcgacaccgcctcagctttgtat
HQ700519_C_P-RF-CB      atttctttccatctattcgagatctcctcgacaccgcctcagctctgtat
HQ700521_C_P-RF-CB      atttctttccatctattcgagatctcctcgacaccgcctcagctctgtat
KF873521_C_P-RF-BC      atttctttccgtctattcgcgatctcctcgacaccgccgccgctctgtat
KU679955_C_P-RF-CB      atttctttccgtctattcgcgatctcctcgacaccgccgccgctctgtat
KU679950_C_P-RF-CB      atttctttccgtctattcgtgatctcctcgacaccgctgccgctctgtat
KU679944_C_P-RF-BC      atttctttccgtctattcgtgatctcctcgacaccgccgccgctctgtat
KU679948_C_P-RF-CB      atttctttccgtctattcgtgatctcctcgacaccgctgccgctctgtat
KU679953_C_P-RF-BC      atttctttccgtctattcgtgatctcctcgacaccgctgccgctctgtat
KU679946_C_P-RF-BC      atttctttccgtctattcgtgatctcctcgacaccgctgccgctctgtat
KF873519_C_P-RF-CB      atttctttccgtctattcgtgatctcctcgacaccgccaccgctctgtat
KF873517_C_P-RF-BC      atttctttccgtctattcgtgatctcctcgacaccgctgccgctctgtat
KF873518_C_P-RF-CB      atttctttccgtctattcgtgatctcctcgacaccgctgccgctctgtat
KF873515_C_P-RF-CB      atttctttccgtctattcgtgatctcctcgacacagccgccgctctgtat
KF873511_C_P-RF-CB      atttctttccgtctattcgtgatctcctcgacaccgccgccgctctgtat
KF873513_C_P-RF-CB      atttctttccgtctattcgtgatctcctcgacaccgccgccgctctgtat
KU679958_C_P-RF-CB      rtttctttccgtctattcgagatctcctcgacaccgcatccgctctgtat
KU679941_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcatccgctctgtat
KF873522_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcatccgctctgtat
KF873523_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcatccgctctgtat
KF873524_C_P-RF-CB      atttctttccgtctattcgagatctcctcgacaccgcatccgctctgtat
HQ700509_C_P-RF-CB      atttctttccatctattcgggatctactcgacaccgcctcagctctgtat
HQ700515_C_P-RF-CB      atttctttccatctattcgggatctactcgacaccgcctcagctctgtat
HQ700507_C_P-RF-CB      atttctttccgtctattcgagatcttctcgacaccgcctcagctctgtat
HQ700508_C_P-RF-CB      atttctttccgtctattcgagatcttctcgacaccgcctcagctctgtat
KU695744_C_P-RF-CB      atttctttccgtccattcgagatctcctcgacaccgcctcagctctgtat
KU695746_C_P-RF-CB      atttctttccgtccattcgggatctcctcgacaccgcctcagctctgtat
HQ700505_C_P-RF-CB      atttctttccgtccattcgggatctcctcgacaccgcctcagctctgtat
KU695741_C_P-RF-CB      atttctttccgtccattcgagatctcctcgacaccgcctcagctctgtat
KU695743_C_P-RF-CB      atttctttccgtccattcgagatctcctcgacaccgcctcagctctgtat
MG826142_C_P-RF-CB      acttctttccatctattcgagatctcctcgacaccgcctcagctctatat
MG826141_C_P-RF-CB      acttctttccatctattcgagatctcctcgacaccgcctcagctctatat
KT003704_C_P-RF-CB      atttctttccatctatccgagacctcctcgacaccgcctcagctctatat
KP148352_C_P-RF-CB      atttctttccatctattcgagatctcctcgacaccgcctcagctctatat
AP011104_C_P-RF-CB      atttctttccatctattcgagatctcctcgacaccgcctcagctctatat
AP011105_C_P-RF-CB      atttctttccatctattcgagatctcctcgacaccgcctcagctctatat
LC416040_C_P-RF-CB      atttctttccatctattcgagatctcctcgacaccgcctcagctctatat
MN683618_C_P-RF-DC      acttctttccttccattcgagatctcctcgacaccgccgctgctctgttt
FJ386643_C_P-RF-CB      acttctttccttctattcgggatctcctcgacaccgcttcagctctatat
KU695742_C_P-RF-CB      atttctttccgtctatacgagatctcctcgacaccgcctcagccctgtat
FJ562317_C_P-RF-CB      acttctttccttcaattcgagatctcctcgacaccgcccaagctttatat
FJ386635_C_P-RF-CB      acttctttccttctatccgagatctcctcgacacagcctctgctctgtat
MT645070_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ803788_C_P-RF-CB      acttctttccttctattcgagatctcctctacaccacctctgttctgtat
HQ700526_C_P-RF-CB      atttctttccgaatattcgagatctcctcgacaccgcctccgctctgtat
MK534582_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
AB241109_C_P-RF-CB      atttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683669_C_P-RF-DC      acttctttcctactgttcgagatctcatcgacaccgcctctgctctgtat
EU717211_C_P-RF-CB      acttctttccttcgattcgagatctcctcgacaccgcctcagctctgtat
AB300369_C_P-RF-CB      acttctttccttctattcgagatctccttgacaccgcctctgctctgtat
MT645048_C_P-RF-CB      acttcttcccttctattcgagatcttctcgacaccgcctctgctttgtat
JX504540_C_P-RF-CB      acttctttccttccattcgagatctcctcgacactgcctctgctctgtat
KJ803778_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
Y18856_C_P-RF-CB        acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KX660686_C_P-RF-DC      acttctttccttctattcgggatcttctcgacaccgcctctgctctgtat
MN683707_C_P-RF-DC      acttctttccttctattcgggatcttctcgacaccgcctctgctctgtat
AY206374_C_P-RF-CB      acttctttccttccattcgtgatcttctcgacaccgcctccgctctgtat
EU939551_C_P-RF-CB      acttctttccatctattcgagatctcctcgacaccgcctctgctctatat
AB670303_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcctcagctctgtat
KC774234_C_P-RF-CB      acttctttccttctattcgagatctcctcgataccgcttcagctctatat
EU916232_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964315_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964308_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964010_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964005_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964007_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964008_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964009_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964303_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964304_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964305_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964306_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964307_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964309_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964310_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964311_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964312_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964313_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964314_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964316_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964317_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU964006_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KX096713_C_P-RF-CA      acttttttccttctattcgagatctccttgacaccgcctctgctctgtat
KY670781_C_P-RF-DC      acttctttccttctgttcgagatctcctcgacaccgccgctgctctgtat
MG826144_C_P-RF-CB      acttctttccttctattcgagacctcctcgacacagcctccgctctgtat
KX660685_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683641_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB367800_C_P-RF-CB      acttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
FJ715345_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ715346_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ715347_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
HQ684849_C_P-RF-BC      acttttttccttctattcgagatctgctcgacaccgccactgctctgtat
AB049609_C_P-RF-CB      acttttttccttctattcgagatctcctcgacaccgcttctgctctgtat
KR013843_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534587_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctctat
KC774485_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgccgctgctctgtat
MN683716_C_P-RF-DC      acttctttccttctattcgggatcttctcgacaccgcctctgctctgtat
MK534577_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctttatat
KC774212_C_P-RF-CB      atttctttccttccattcgagacctcctcgacaccgcctctgctctgtat
EU939606_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY040627_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT645063_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683620_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
HQ700547_C_P-RF-CB      acttcttcccttccattcgcgatcttctcgacaccgcctctgctctgtat
GQ377560_C_P-RF-CB      acttctttccttccattcgtgatcttctcgacaccgcctccgctctgtat
KC774198_C_P-RF-CB      acttctttccttccattcgagatcttctcgacaccgcctctgctctgtat
KC774201_C_P-RF-CB      acttctttccttccattcgagatcttctcgacaccgcctctgctctgtat
EU522070_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU881995_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KT991420_C_P-RF-DC      acttctttcctgctattcgagatctcctcgacaccgcctctgctctgtat
FJ562278_C_P-RF-DC      acttctttcctgctattcgagatctcctcgacaccgcctctgctctgtat
KT991417_C_P-RF-DC      acttctttcctgctattcgagatctcctcgacaccgcctctgctctgtat
KT991423_C_P-RF-DC      acttctttcctgctattcgagatctcctcgacaccgcctctgctctgtat
KT991419_C_P-RF-DC      acttctttcctgctattcgagatctcctcgacaccgcctctgctctgtat
MN683627_C_P-RF-DC      acttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
MN683581_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MH094410_C_P-RF-BC      acttctttccgtctattcgagatctcctcgacaccgcctctgctctatat
JX661487_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
JQ732168_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcttctgctctgtat
GQ377611_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB195939_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
AB195940_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
AB195941_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
AB195955_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
AB195956_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
AB195957_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
AB033557_C_P-RF-CB      acttctttccttccattcgagatcttctcgacaccgcctctgctctgtat
KC774263_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KC774332_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KC774341_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KX660682_C_P-RF-DC      acttctttccttctattcgagatctymtcgacaccgcctctgctctgtat
JF436922_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT645062_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683717_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774490_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctatat
JN400086_C_P-RF-CB      acttctttccttctattcaagatctcctcgacaccgcctctgctttgtat
HM750133_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377522_C_P-RF-CB      acttctttccttctattcgagatctactcgacaccgcctctgctctgtat
FJ386581_C_P-RF-CB      acttctttcctgctattcgagatctcctcgacaccgcctctgctctgtat
DQ478886_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683588_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
AY817509_C_P-RF-DC      acttctttccttctattcgagatctactcgacaccgcctctgctctgtat
KC774447_C_P-RF-DC      acttctttccatctgttcgagatctcctcgacaccgcctctgctctgtat
KC774486_C_P-RF-DC      acttctttccttctggtcgagatctcctcgacaccgcctctgctctgtat
MN650076_C_P-RF-DC      acttttttccttctattcgggatcttctcgacaccgcctctgctctgtat
MN683720_C_P-RF-DC      acttctttccttctattcgggatcttctcgacaccgcctctgctctgtat
MN683718_C_P-RF-DC      acttctttccttctattcgggatcttctcgacaccgcctctgctctgtat
MN683719_C_P-RF-DC      acttctttccttctattcgggatcttctcgacaccgcctctgctctgtat
KX660674_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683664_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683665_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KX660680_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT645060_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683677_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683675_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683655_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683619_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683611_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683603_C_P-RF-DC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ410520_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774489_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774479_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774475_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774470_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774461_C_P-RF-DC      acttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
KC774434_C_P-RF-DC      acttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KC774432_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
JQ707714_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377630_C_P-RF-BC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB195950_C_P-RF-CB      acttctttccttctattcgagatctcctcgataccgcctctgctctgtat
AB195951_C_P-RF-CB      acttctttccttctattcgagatctcctcgataccgcctctgctctgtat
JF828933_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JF828934_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JF828935_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JF828936_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JF828938_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY862864_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY862865_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY862866_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683657_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683617_C_P-RF-DC      acttctttccttctattcgagatctcatcgacaccgcctctgctctgtat
MN683636_C_P-RF-DC      acttctttccttctattcgagatctcatcgacaccgcctctgctctgtat
MN683637_C_P-RF-DC      acttctttccttctattcgagatctcatcgacaccgcctctgctctgtat
MN683638_C_P-RF-DC      acttctttccttctattcgagatctcatcgacaccgcctctgctctgtat
MN683651_C_P-RF-DC      acttctttccttctattcgagatctcatcgacaccgcctctgctctgtat
KC774349_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774488_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774493_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
Y18857_C_P-RF-CB        acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT645067_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683691_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683676_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683673_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683670_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683654_C_P-RF-DC      atttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683582_C_P-RF-DC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KX660677_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683668_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KX660675_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683613_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683614_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683615_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683666_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KT991421_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP276255_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtac
KP276254_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KF917451_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KC774499_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774497_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774494_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774487_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774454_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774430_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774431_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX429898_C_P-RF-DC      acttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
JF491449_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ478892_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ478889_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN657317_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774458_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctctac
AF330110_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683684_C_P-RF-DC      acttctttccgtctattcgagatctactcgacaccgcctctgctctgtat
MN683622_C_P-RF-DC      acttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
MN683625_C_P-RF-DC      acttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
MN683596_C_P-RF-DC      acttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
MN683623_C_P-RF-DC      acttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
MN683683_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683660_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683640_C_P-RF-DC      acttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KC774463_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY817512_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683597_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683621_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683642_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683650_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774425_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ715387_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ715384_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
AY247030_C_P-RF-CB      acttctttccttctattcgagatctcctagacaccgcctctgctctgtat
FJ715385_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ715411_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ715412_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ715413_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ715414_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774474_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683605_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774495_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774492_C_P-RF-DC      acttctttccttctatacgagatctcctcgacaccgcctctgctctgtat
KC774476_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774483_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774222_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683610_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774344_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683639_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774468_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ144601_C_P-RF-BC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683571_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683592_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683594_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774457_C_P-RF-DC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774420_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY800249_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774426_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY817515_C_P-RF-DC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774480_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU835240_C_P-RF-GC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774478_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN657316_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MT645066_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MN683586_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MT645049_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
MN683689_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683690_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683645_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683635_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683658_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683659_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683713_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT645065_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683632_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683628_C_P-RF-DC      acttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
MN683624_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683612_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683616_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683587_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683692_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683693_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683715_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173349_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774471_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ478897_C_P-RF-DC      acttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY817510_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ478887_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JF491448_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JF491456_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774423_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774424_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774433_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774448_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774472_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU519422_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN657315_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683572_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683584_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683590_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683607_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683609_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683626_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683630_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683643_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683644_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683647_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683649_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683652_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683653_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683656_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683661_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683662_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683663_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683671_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683672_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683679_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683685_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MN683714_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY817513_C_P-RF-DC      acttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KF214680_C_P-RF-GC      atttctttccatctgttcgagatctcctcgacaccgcctcagctttgtat
MH368022_C_P-RF-GC      atttctttccgtctattcgagacctcctcgacaccgcakcagctctgtat
MZ439768_C_P-RF-GC      ttttctttccgtctgtacgggaccttctcgacaccgcatcagctctccat
MZ439798_C_P-RF-GC      atttctttccgtctgtacgggaccttctcgacaccgcatcagctctccat
FJ023665_C_P-RF-GC      atttctttccgtctattcgagatctactcgacaccgcctcagctctgtac
FJ882613_C_P-RF-GC      atttctttccgtctgttcgggatctactcgacaccgcctcagctctctac
EU833891_C_P-RF-GC      atttctctccgtctgttcgagatctactcgacaccgcctcagctctctac
FJ882617_C_P-RF-GC      atttctttccgtctgttcgagatctactcgacaccgcctcagctctctac
FJ882612_C_P-RF-GC      atttctttccgtctgttcgagatctactcgacaccgcctcagctctctac
FJ882618_C_P-RF-GC      atttctttccgtctgttcgagatctactcgacaccgcctcagctctctac
FJ023666_C_P-RF-GC      atttctttccgtctattcgagatctactcgacaccgccgcagctctctac
FJ882611_C_P-RF-GC      atttctttccgtctattcgagatctactcgacaccgcctcagctctctac
FJ023670_C_P-RF-GC      atttctttccgtctattcgagatctactcgacaccgcctcagctttgtat
FJ023664_C_P-RF-GC      atttctttccgtctattcgagatctactcgacaccgcctcagctctgtac
FJ023667_C_P-RF-GC      atttctttccgtctattcgagatctactcgacaccgcctcagctctgtac
FJ023673_C_P-RF-GC      atttctttccgtctattcgagatctactcgacaccgcctcagctctgtac
FJ882610_C_P-RF-GC      atttctttccgtctattcgagatctactcgacaccgcctcagctctctac
FJ882614_C_P-RF-GC      atttctttccgtctattcgagatctactcgacaccgcctcagctctctac
MK534669_C_P-RF-CB      acttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK534566_C_P-RF-BC      acttttttccttctattcgcgatctcctcgacaccgcctcagctctgtat
MK534663_C_P-RF-CB      acttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
FJ023659_C_P-RF-BC      atttctttccatctattcgagaccttctcgacaccgcatcagctctgtat
FR714496_C_P-RF-CB      atttctttccgtctactcgggaccttctcgacaccgcatcagctctctat
KP148442_C_P-RF-BC      atttctttccgtctattcgagaccttctcgacaccgcctcagctctgtat
MH746811_C_P-RF-BC      atttctttccgtctattcgggaccttctcgacaccgcatcagctctgtat
FR714490_C_P-RF-GB      atttctttccgtctattcgggaccttctcgacaccgcatcagctctgtat
KC172106_C_P-RF-GB      atttctttccgtctattcgggaccttctcgacaccgcatcagctctgtat
MG826145_C_P-RF-BC      atttctttccgtctattcgggaccttctcgacaccgcatcagctctgtat
MH746813_C_P-RF-BC      atttctttccgtctattcgggaccttctcgacaccgcatcagctctgtat
MH746812_C_P-RF-BC      atttctttccgtctattcgggaccttctcgacaccgcatcagctctgtat
MF488699_C_P-RF-DE      acttctttccttccgtccgagatcttctagataccgcctcagctctgtat
AB933283_C_P-RF-AG      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JF440019_C_P-RF-AG      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB933282_C_P-RF-AG      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JF440021_C_P-RF-AG      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JF440022_C_P-RF-AG      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
EU833890_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
EU833889_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707468_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707426_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707424_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707459_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707473_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707465_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707464_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707463_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707441_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB933281_C_P-RF-AG      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB933279_C_P-RF-AG      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707457_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707458_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707460_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707461_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707462_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707466_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707467_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707469_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707470_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707448_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707474_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
KP274926_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
EF464099_C_P-RF-AG      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707421_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707430_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707432_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707445_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707450_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707456_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707471_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707472_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707475_C_P-RF-GA      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB933280_C_P-RF-AG      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
MZ097814_C_P-RF-DE      acttctwtccttcagtahgagatcttctagatactgcctcagctctgttt
GQ161806_C_P-RF-EA      acttctttccttccgtccgagatctcctagataccgcctcagctctgtac
JN664933_C_P-RF-DA      acttctttccttccgtccgggatcttctagataccgcctcagctctgtat
JN664946_C_P-RF-DA      acttctttccttcagtacgagatcttcttgatacagcctcagctctcttt
JF440017_C_P-RF-DA      acttctttccttccgtccgagatctcctagataccgcctcagctctctat
AY230115_C_P-RF-DA      acttctttccttccgtcagagatctcctagacaccgcctcagctctgttt
X68292_C_P-RF-DA        acttctttccttccgtaagagatctcctagacaccgcctcagctctgtat
JF439776_C_P-RF-AG      acttctttccttccgtcagagatctcctagacaccgcctcagctctgtat
AB453985_C_P-RF-AC      acttctttccttccatcagagatctcctagacaccgcctcagctctgtat
MF925386_C_P-RF-AC      acttctttccttccgtcggagatctcctagacaccgcctcagctttgtat
KF779353_C_P-RF-DA      acttctttccttccgtcagagatctcctagacaccgcctcagctctgtat
AB222708_C_P-RF-AD      acttctttccttccgtcagagatctcctagacaccgcctcagctctgtat
AB330368_C_P-RF-DA      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
EF494376_C_P-RF-CA      acttttttccttccgtcagagatctcctagacaccgcctcagctctgtat
AF297619_C_P-RF-DA      acttttttccttccgtacgagatctcctagacaccgcctcagctctgtat
AF297620_C_P-RF-DA      acttttttccttccgttagagatctcctagacaccgcctcagctctgtat
AB194949_C_P-RF-AE      acttctttccttccgtccgagatctcctagataccgcctcagctctatat
MF488705_C_P-RF-AD      atttctttccttcagtacgggatctactagataccgcctcagctctgtat
MH464850_C_P-RF-DA      acttttttccttcagtccgggatctacttgatacagcctcagctctgtat
HM146131_C_P-RF-AD      acttctttccttccgtccgggatctactagatacagcctcagctttatat
MT426089_C_P-RF-AB      acttctttccttccgtccgggatctactggatacagcctcagctctgtat
GQ331048_C_P-RF-AE      acttctttccttccgtccgggatctccttgataccgcctcagctctgtat
AY161147_C_P-RF-DA      acttctttccttcagaccgggatctactagacacagcttcagctctatat
KJ586810_C_P-RF-AF      atttctttccttccgtccgggatctacttgatacagcctcagctctgtat
AY233277_C_P-RF-AC      acttctttccttccgtccgggatctactagatacagcctcagctctatat
KF214656_C_P-RF-AC      acttctttccttccgtccgggatctactagatacagcctcagctctgtat
MF925404_C_P-RF-AC      acttctttccttccgtccgggatctactagatacagcctcagctctatat
FJ349221_C_P-RF-DE      acttctttccttcgataagcgatcttctagccaccgccacagctctgttt
AB674412_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JN688717_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctctat
KJ647356_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctctat
DQ464167_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
DQ464165_C_P-RF-DE      acttctttccttccgctcgagatcttctagataccgcctcagctctgtat
DQ464166_C_P-RF-DE      acttctttccttccgctcgagatcttctagataccgcctcagctctgtat
DQ464164_C_P-RF-DE      acttctttccttccgctcgagatcttctagataccgcctcagctctgtat
KJ647349_C_P-RF-DE      acttctttccttcagcacgagatcttctagataccgcctcagctctgtat
MZ097766_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MK052976_C_P-RF-BD      acttctttccttcaatacgagatcttctagataccgcctcagctctgtat
KJ647351_C_P-RF-DE      acttctatccttcagtacgagatcttctagataccgcctcagctctatat
MT426112_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JN688689_C_P-RF-DE      acttctatccttcagttcgagatcttctagataccgcctccgctttgtat
JN688715_C_P-RF-DE      acttctttccttcactaagagatcttttagataccgcctcagctctattt
KM359442_C_P-RF-DE      acttctttccttcagtacgtgatcttctagataccgcctcagctctgtat
MW601310_C_P-RF-DE      acttctttcctacagtacgagatcttctagataccgccgcagctctgttt
MZ097777_C_P-RF-DE      acttctttcctacagtacgagatcttctagataccgccgcagctctgttt
KJ586811_C_P-RF-DF      acttttttccttcagtacgagattttttagataccgcctcagctctgtat
AB270538_C_P-RF-DE      acttctttccttcggtacgagatcttctagataccgcctcagctctattt
KF679991_C_P-RF-DE      acttctttccttcagtacgagatctgctagataccgccgcagctctgtat
MG877711_C_P-RF-DE      acttctatccttcagtacgggatcttctagataccgcctcagctctgtat
KM577666_C_P-RF-DE      acttctatccatcagtacgagatcttctagataccgcctcagctctgtat
MH724243_C_P-RF-DE      acttctttccttcaatacgagatcttctagataccgcctctgctctgtat
MN507835_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctttgtac
MW601317_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MZ097806_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgttt
X65259_C_P-RF-DA        acttctttctctacgtacgagatctcctagataccgcctcagctctgtat
MH724240_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcatcagctctctat
MF488702_C_P-RF-DE      acttctttccttctctacgagatcttcttgataccgcctcagctctgtat
KX827302_C_P-RF-DE      acttctatccttcagtacgagatcttctagataccgcctcagctctgtat
MW601296_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MZ097767_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MH724239_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JN257204_C_P-RF-DE      acttctttccttcagtacgagatcttctagatactgcctcagctctgtat
MW601264_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgttt
MZ097745_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgttt
AY341335_C_P-RF-DE      acttctttccttcggtacgagatcttctagataccgcctcagctctgttt
JQ687532_C_P-RF-DE      acttctttccttcggtacgagatcttctagataccgcctcagctctatat
MZ097850_C_P-RF-DE      acttctttccttcggtacgagatcttctagataccgcctcagctctgtat
X80925_C_P-RF-DE        acttctttccttcggtacgagatcttctagataccgcctcagctctgtat
EF103284_C_P-RF-AD      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MH464835_C_P-RF-DE      acttctttccttcagtacgtgaccttctagataccgcctcagctctgttt
KC774450_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgccgcagctctgtat
AJ627221_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MW601227_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MZ097716_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
FJ349212_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgttt
MW601284_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MZ097758_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
AB188243_C_P-RF-DE      acttctttccttcagtacgagctcttctagataccgcctcagctctgtat
AB188245_C_P-RF-DE      acttctttccttcagtacgagctcttctagataccgcctcagctctgtat
MW601260_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MZ097740_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KM577667_C_P-RF-DE      acttctttccttcagtaaaagatcttctagataccgcctcagctctgtat
EU594406_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctctat
AB210819_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MW601235_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MZ097721_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KM386676_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KM577665_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
AJ627217_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
AY373430_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KM524359_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KT366492_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MK598656_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MW601241_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MZ097724_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MK598654_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
DQ111987_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
EU594435_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
EU594436_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MK618439_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
GQ183486_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MK598652_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctttgtat
MK598653_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctttgtat
JF440012_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440007_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440004_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440005_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440013_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440011_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440001_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF439995_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF439996_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF439998_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440000_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440002_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440003_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440006_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440008_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440009_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440010_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440014_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF440015_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF439999_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MH724222_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagccctgtat
AY236161_C_P-RF-DA      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MZ097667_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtac
MT426110_C_P-RF-DE      acttctttccttcagtacgacatcttctagataccgcctcagctctgtat
EU185780_C_P-RF-AD      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KC012653_C_P-RF-AD      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MF967563_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MK618438_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MK618440_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MK618444_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MT426111_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
U95551_C_P-RF-DE        acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MT426113_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
AJ344117_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JX898686_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JX898690_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JX898693_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JX898695_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JX898696_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JX898698_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JX898699_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MK618442_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MK618445_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JX898687_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JX898688_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
DQ315777_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KM524337_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KM524336_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctgtgtat
LK995391_C_P-RF-ED      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
AB583679_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KM577663_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KM577664_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MN507850_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
EF103285_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KT366504_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
AY233293_C_P-RF-DE      acttctttccttcagtacgtgaccttctagataccgcctcagctctgtat
AY233295_C_P-RF-DE      acttctttccttcagtacgtgaccttctagataccgcctcagctctgtat
MT210033_C_P-RF-DE      acttctttccttcagtacgtgaccttctagataccgcctcagctctgtat
GU563560_C_P-RF-DE      acttctttccttcagtacgtgaccttctagataccgccgcagctctgtat
MH464846_C_P-RF-DE      acttctttccttcagtacgtgaccttctagataccgcctcagctctgtat
MH464852_C_P-RF-DE      acttctttccttcagtacgtgaccttctagataccgcctcagctctgtat
MH464851_C_P-RF-DE      acttctttccttcagtacgtgaccttctagataccgcctcagctctgtat
JN664943_C_P-RF-DE      atttctttccgtctgtacgagatcttctagataccgccgcagctctatat
KU668440_C_P-RF-DE      acttctttccgtctgtacgagatcttctagataccgcctcagctctatat
JN664929_C_P-RF-DE      atttctttccgtctgtacgagatcttctagataccgccgcagctttatac
JN664934_C_P-RF-DE      atttctttccgtctgtacgagatcttctagataccgccrcagctctatat
JN664915_C_P-RF-DE      acttctttccttctgtccgagatcttctagataccgcctcagctctatat
JN664925_C_P-RF-DE      acttctttccttctgtccgagatcttctagataccgcctcagctctatat
GQ205377_C_P-RF-DE      atttctttccgtctgtccgagattttctagataccgccgcagcgctatat
KC875338_C_P-RF-DE      atttctttccgtctgtccgagatcttctagataccgcctcagcgctatat
KC875339_C_P-RF-DE      atttctttccgtctgtccgagatcttctagataccgcctcagcgctatat
GQ205378_C_P-RF-DE      atttctttccgtctgtccgagatcttctagataccgccgcagcgctatat
GQ205387_C_P-RF-DE      atttctttccgtctgtccgagatcttctagataccgccgcagcgctatat
GQ205379_C_P-RF-DE      atttctttccgtctgtacgagatctgctagacaccgccgcagctctatat
AB033558_C_P-RF-DE      atttctttccgtctgtacgagatcttctagataccgccgcagctctatat
MK516279_C_P-RF-DE      atttctttccgtctgtacgagatcttctagacaccgccgcagctctatat
MK516280_C_P-RF-DE      atttctttccgtctgtacgagatcttctagacaccgccgcagctctatat
MK541689_C_P-RF-DE      atttctttccgtctgtacgagatcttctagacaccgccgcagctctatat
DQ315780_C_P-RF-DE      atttctttccgtctgtacgagatcttctagacaccgccgcagctctatat
KT366505_C_P-RF-DE      atttctttccgtctgtacgagatcttctagataccgccgcagctctatat
DQ315779_C_P-RF-DE      atttctttccgtctgtacgagatcttctagataccgccgcagctctatat
JN664940_C_P-RF-DE      atttctttccgtctgtacgagatcttctagataccgccgcagctctatat
MK052957_C_P-RF-DE      acttctttccttcaatacgagatcttctagataccgcctcagctctgtat
MK052969_C_P-RF-DE      atttctttccttcaatacgagatcttctagataccgcctcagctctgtat
KJ470898_C_P-RF-DE      acttctttccttccgtccgagatctactagataccgctgcagcgctgtat
KJ470897_C_P-RF-DE      acttctttccttccgttcgagatctactagataccgctacagcgctgtat
KF192835_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KJ470891_C_P-RF-DE      acttctttccttccgtccgagatctactagataccgctgcagcgctgtat
KF192833_C_P-RF-DE      acttctttccttccgtccgagatcttctagataccgctgcagcgctgtat
MF618346_C_P-RF-DE      acttctttccttccgtccgagatcttctagataccgctgcagcgctgtat
KF192840_C_P-RF-DE      acttctttccttccgtccgagatcttctagataccgctgcagcgctgtat
KF192836_C_P-RF-DE      acttctttccttccgtccgagatcttctagataccgctgcagcgctgtat
KF192838_C_P-RF-DE      acttctttccttccgtccgagatcttctagataccgctgcagcgctgtat
KF192837_C_P-RF-DE      acttctttccttccgtccgagatcttctagataccgctgcagcgctgtat
KF192839_C_P-RF-DE      acttctttccttccgtccgagatcttctagataccgctgcagcgctgtat
KF192841_C_P-RF-DE      acttctttccttccgtccgagatcttctagataccgctgcagcgctgtat
MF618347_C_P-RF-DE      acttctttccttccgtccgagatcttctagataccgctgcagcgctgtat
KJ470892_C_P-RF-DE      acttctttccttccgtccgagatctactagataccgctgcagcgctgtat
KJ470888_C_P-RF-DE      acttctttccttccgtccgagatctactagatactgctgcagcgctgtat
KJ470890_C_P-RF-DE      acttctttccttccgtccgagatctactagatactgctgcagcgctgtat
KJ470884_C_P-RF-DE      acttctttccttccgtccgagatctactagataccgctgcagcgctgtat
KJ470886_C_P-RF-DE      acttctttccttccgtccgagatctactagataccgctgcagcgctgtat
KJ470887_C_P-RF-DE      acttctttccttccgtccgagatctactagataccgctgcagcgctgtat
HQ700494_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
FJ692536_C_P-RF-DE      acttctttccttccgtaagagatcttctagataccgcctcagctctgtat
HQ700492_C_P-RF-DE      acttctatccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700579_C_P-RF-DE      acttctttccttccatacgagatcttctagataccgccgcggctctgtat
HQ700585_C_P-RF-DE      acttctttccttccatacgagatcttctagataccgccgcggctctgtat
AB048702_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcagctctgtat
AB048703_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcagctctgtat
HQ700493_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700534_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700533_C_P-RF-DE      acttctttccttccgttcgagatcttctagataccgccgcggctctgtat
MH481860_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcagctctgtat
J02202_C_P-RF-DE        acttctttccttccgtacgagatcttctagataccgccgcagctctgtat
MH481862_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcagctctgtat
MH481859_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcagctctgtat
MH481858_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcagctctgtat
MH481861_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcagctctgtat
HQ700536_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700541_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700581_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgcagcggctctgtat
HQ700503_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
AB033559_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700497_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700501_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700524_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700525_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700582_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700583_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700584_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700535_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700537_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700538_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700500_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700539_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
HQ700540_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgccgcggctctgtat
JN040803_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JF754613_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JN257154_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctatat
FJ562223_C_P-RF-CD      acttttttccttcagtacgagatcttctagataccgcctcagctctgtac
MZ097826_C_P-RF-DE      acttctwtccgtcagtacgagatcttctagataccgcctcagctctgtat
MF925401_C_P-RF-DB      acttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF925360_C_P-RF-DB      acttctttccttcagtacgagctcttcttgataccgcctcagctctgtat
MF925396_C_P-RF-DC      acttctttccttcagtacgagatcttcttgataccgcctcagctctgtat
EF103283_C_P-RF-AD      acttctttccttcagtacgagatcttcttgataccgcctcagctctgtat
EF103282_C_P-RF-AD      acttctttccttccgtacgagatcttcttgataccgcctcagctctgtat
KM524357_C_P-RF-DE      acttctttccttcagtacgagatctccttgataccgcctcagctctgtat
KT366503_C_P-RF-DE      acttctttccttcagtacgagatctccttgataccgcctcagctctgtat
KR905422_C_P-RF-DE      acttctttccttcagtacgagatctccttgataccgcctcagctctgtat
MF925371_C_P-RF-DC      acttctttccttcagtacgggatcttctagataccgcctcagctctgtat
MF925388_C_P-RF-DC      acttctttccttcagtacgggatcttcttgataccgcctcagctctgtat
MF925392_C_P-RF-DB      acttctttccttcagtacgcgatcttcttgataccgcctcagctctgtat
MF925402_C_P-RF-BD      acttctttccttcagtacgagatcttcttgataccgcctcagctctgtat
AB674436_C_P-RF-DE      acttctatccttcagtacgagatcttctagataccgccacagctctgtat
MZ097838_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgcctcagctctgttt
MZ097680_C_P-RF-DE      acttttttccttcagtacgagatcttctagataccgcctcagctctgtat
MZ097703_C_P-RF-DE      acttttttccttcagtacgagatcttctagataccgcctcagctctgtat
MF925397_C_P-RF-DC      acttctttccttcagtacgggatcttctagataccgcctcagctctatat
MF925384_C_P-RF-DB      acttctttccttcagtgcgagatcttctagataccgcctcagctctatat
AY161145_C_P-RF-AD      acttctttccttcagtacgagatctcctagataccgcctcagctctatat
AY161146_C_P-RF-AD      acttctttccttcagtacgagatctcctagataccgcctcagctctatat
GQ377627_C_P-RF-CD      acttctttccttcagtacgagatcttctagataccgcctcagctctatat
AY161140_C_P-RF-AD      acttctttccttcagcacgagatctcctagataccgcctcagctctatat
AY161141_C_P-RF-AD      acttctttccttcagcacgagatctcctagataccgcctcagcactatat
JN642141_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgttt
JN642152_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgttt
AB674434_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JN642137_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JN642160_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MZ097652_C_P-RF-DE      acttctttccttcaatacgagatcttctagataccgcctcagctctgttt
KF471643_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MW887645_C_P-RF-CD      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MZ097822_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgccgcagctctgtat
JN040798_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgttt
JN642127_C_P-RF-DE      acttctttccgtcagtacgagatcttctagataccgcctcagctctgtat
JF754616_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctctgctctgtat
MW601230_C_P-RF-DE      acttctttccgtcagtacgagatcttctagataccgcctcagctctgtat
MZ097719_C_P-RF-DE      acttctttccgtcagtacgagatcttctagataccgcctcagctctgtat
JN257210_C_P-RF-DE      acttttttccttcagtacgagatcttctagataccgcctcagctctgtat
JN257174_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MZ097687_C_P-RF-DE      acttctttccttcmgtacgagatcttctagataccgcctcagctctgtat
JN257206_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JN257207_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JN257191_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JN257216_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JN642139_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
AB674432_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgccgcagctctgtat
AB674433_C_P-RF-DE      acttctttccttcagttcgagatcttctagataccgcctcagctctgtat
JN257164_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
JN257189_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
FJ904405_C_P-RF-DE      acttctatccttcagtacgagatcttctagataccgcctcagctctgtat
FN594767_C_P-RF-DE      acttctttccttcrgtaaaagatcttctagataccgcctcagctctgtat
FJ904436_C_P-RF-DE      acttctatcctccagtacgagatcttctagacaccgcctmagctctgttt
FJ904409_C_P-RF-DE      acttctttccttcagtacgagatctactagataccgccactgctctgttt
KP168421_C_P-RF-DE      atttctttccttccgtacgggatctcctagataccgcctcagctctgtat
FJ904408_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgccagagctctgttt
FJ349207_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
FJ904416_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
FJ904417_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
FJ904414_C_P-RF-DE      acttctatccttcagtacgagatcttctagataccgcctcagctctgtat
FJ904407_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
FJ904430_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgttt
FJ904425_C_P-RF-DE      acttctatccttcagtacgagatcttctagataccgcctcagctctgtat
FJ904400_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
DQ991753_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
FJ904398_C_P-RF-DE      acttctttcctaacgtacgagatcttctagataccgcctcagctctgttt
GQ161788_C_P-RF-AE      acttctttccttcagtaagagatcttctagataccgcctcagctttgtat
FJ904394_C_P-RF-DE      acttctttccatcagtacgagatcttctagataccgcctcagctctgttt
FN594769_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgttt
FJ904440_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KX357628_C_P-RF-DE      acttctttccttcggttcgagatcttctagataccgcctcagccctgtat
GQ161767_C_P-RF-AE      acttctttccttcagtaagagatcttctagataccgcctcagctctgtat
HF571060_C_P-RF-AE      acttctttccttcagtaagagatcttctagataccgcctcagccctgtat
GQ161837_C_P-RF-AE      gmttttttccttcagtaagagatyttctagataccgcctcarccctgtat
GQ161838_C_P-RF-AE      acttttttccttcagtaagagatyttttagataccgcctcanccctgtat
FJ904444_C_P-RF-DE      acttctttccttcggtacgagatcttctagataccgcctcagctctgtat
FJ904396_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgttt
GQ161753_C_P-RF-AE      acttctttccttccgtccgagatctcctagataccgcctcagctctgtat
FJ904428_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
FJ904404_C_P-RF-DE      acttttttccttcagtacgagatcttctagataccgcctcagctctgtat
KX357631_C_P-RF-DE      acttctttccttcagttcgtgatcttctagataccgcctcagccctgtat
FJ904442_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgttt
KX357627_C_P-RF-DE      acttctttccttcggttcgagatcttctagataccgcctcagccctgttt
KX357626_C_P-RF-DE      acttctttcctgcggttcgagatcttctagataccgcctcagccctgtat
MT591274_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MT591275_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
FJ904401_C_P-RF-DE      acttctttccatcagtacgagatcttctagataccgcttcagctctgtat
KU736921_C_P-RF-DE      acttctttccttcagtacgagatctgctagataccgcctcagctctgtat
KU736922_C_P-RF-DE      acttctttccttcagtacgagatctgctagataccgcctcagctctgtat
KP288875_C_P-RF-DE      acttctttccatcagtacgagatcttctagataccgcctcagctctgtat
KX357632_C_P-RF-DE      acttctttccttcggttcgagatcttctagataccgccgcagccctgttt
KP168417_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KP168418_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KP168420_C_P-RF-DE      acttttttccttccgtacgggatctcctagataccgcctcagctctgtat
FJ904437_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KP168416_C_P-RF-DE      acttctttccgtcggtacgggatcttctagataccgcctcagctctgtac
FJ904447_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgccgcagctctgtat
MT591280_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
FJ904441_C_P-RF-DE      acttctttccttcggtccgagatcttctagataccgcctcagctctgtat
FJ904397_C_P-RF-DE      acttctttccttcagtacgacatcttctagataccgcctcagctctattt
KF170740_C_P-RF-DE      acttctttccttcggttcgggatcttctagataccgcctcagctctgtat
KM606741_C_P-RF-DE      acttctatccttcagtacgagatcttctagataccgcctctgccctgtat
FJ904406_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KM606750_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctctgccctgtat
KP995112_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctctgccctgtat
KM606751_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctctgccctgtat
KX357636_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KX827299_C_P-RF-DE      acttctttccttcagtacgacatcttctagataccgcctcagctctgtat
KX357630_C_P-RF-DE      acttctttccttcggttcgagatcttctagataccgcctcagccctgtat
KX357625_C_P-RF-DE      acttctttccttcggttcgagatcttctagataccgcctcagccctgttt
KX357629_C_P-RF-DE      acttctttccttcggttcgagatcttctagataccgcctcagccctgttt
KX357634_C_P-RF-DE      acttctttccttcggttcgagctcttctagataccgcctcagccctgtat
KX357624_C_P-RF-DE      acttctttccttcggttcgacatcttctagataccgcctcagccctgtat
KX357623_C_P-RF-DE      acttctttccttcggttcgagatcttctagataccgcctcagccttgtat
KX357633_C_P-RF-DE      acttctttccttcggttcgagatcttctagataccgcctcagccctgtat
KX357635_C_P-RF-DE      acttctttccttcggttcgagatcttctagataccgcctcagccctgtat
FJ904403_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
KX357641_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgcctcagctctgtat
KU736917_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgcctcagctctgtat
KU736914_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgcctcagctctgtat
KU736915_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgcctcagctctgtat
KU736916_C_P-RF-DE      acttctttccttccgtacgggatcttctagataccgcctcagctctttat
KU736923_C_P-RF-DE      acttctttccttccgtacgagatcttctagataccgcctcagctttgtat
MH685719_C_P-RF-DE      acttctttccttccgtacgggatctcctagataccgcctcagctctgtat
MT426114_C_P-RF-DE      acttctttccttccgtacgggatctcctagataccgcctcagctctgtat
KU711666_C_P-RF-DE      acttttttccttcagtaagagatcttctagataccgcctcagctctgtat
FN594771_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
AM494716_C_P-RF-DE      acttctttccttcagtacgagatctactagataccgcctcagctctgtat
GU177079_C_P-RF-DE      acttctttccttcagtacgagatctactagataccgcctcagctctgtat
FN594770_C_P-RF-DE      acttctttccttcagtgmgrgatcttctagataccgcctcagctctgttt
GQ161754_C_P-RF-DE      acttctttccttcagtacgagatcttctagataccgcctcagctctgtat
                             *  *                       **                

KF219922_C_P-RF-GH      cgggawkccttagagtccycygawcattgywcsccymaccatacwgcwct
JQ272886_C_P-RF-GF      cgggaakcyttagartcmycwgawcattgywcrcctmaccatacmgcwct
HE981179_C_P-RF-FG      agggatgctttagagtcaccggaacattgcacccccaatcataccgctct
HE981180_C_P-RF-GF      agggatgctttagagtcaccggaacattgcacccccagtcataccgctct
JQ272887_C_P-RF-GF      cgggatgctttagaatcaccagaacattgcacacctaaccataccgctct
KJ586803_C_P-RF-AF      cgggatgctttagaatcaccagaacattgcacacctaaccataccgcttt
MK534665_C_P-RF-CB      cgggaggccttagagtctccggaacattgtacacctcaccatacagcact
KC774323_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HQ700580_C_P-RF-CB      cgggaggccttagagtctccggaacatgtttcacctcaccatacwgcact
KF873530_C_P-RF-CB      cgggaggccctagagtctgcggaacattgttcacctcaccatacagcact
KJ803771_C_P-RF-DB      cgggaggccttagattctccggaacattgttcacctcaccatacggcaat
EF494378_C_P-RF-CA      cgggaggccttagagtctccggagcattgtacacctcaccatacagcact
MG826150_C_P-RF-BC      cgggaggccttagagtctccggaacattgtacacctcaccatacggcact
FJ032343_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
FJ386674_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
KJ803785_C_P-RF-CB      cgggacgccttagagtctccggaacatgtttcagctcaccatacagcact
EU939623_C_P-RF-CB      mgggaggccttagagtctcccgaacattgttcacctcatcatacggctat
MK534590_C_P-RF-BC      cgggaggccttagagtctccggtacatggttcacctcaccatacggcact
GQ377592_C_P-RF-CB      cgggaggctctagagtctccggagcattgttcacctcaccatacggccat
KR013948_C_P-RF-CB      cgggaggccttagagtctcctgaccattgttcacctcatcatacggcact
EU939620_C_P-RF-CB      cgggaggccttagagtctccggaacattgtacacctcatcatacggcact
KJ803822_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcgct
FJ562328_C_P-RF-CB      cgggaggccttagagtctcccgaacattgtacacctcaccatacggcact
MK534668_C_P-RF-BC      agggaggccttagagtctccggaacatatttcatctcaccatacggcact
MK534555_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcaat
MK534728_C_P-RF-BC      cgggaggccttagagtctcccgaacattgttcagctcaccatacggcact
MK534700_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
KJ803782_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
KJ803798_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
EU882006_C_P-RF-CB      cgggaggcattagagtctccggaacattgttcacctcaccatacggcact
MG826151_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU660227_C_P-RF-BC      cgagaagccttagagtctccggaacattgttcacctcaccatacggcact
KJ803791_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcaat
MK534715_C_P-RF-BC      cgggaggccttagagtctccggaacatggtacacctcaccatacggcact
MK534686_C_P-RF-BC      agggaagccttagagtctccggaacatgtttcagctcaccatacggcact
EU939621_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcagctcatcatacggcact
MK534701_C_P-RF-BC      cgggaggccctagagtctccggaacattgttcacctcaccatacggcact
MK534583_C_P-RF-BC      cgggagcccttagagtctccggaacattgttcacctcaccatacggcact
MK534615_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU939630_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534635_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcgct
MK534653_C_P-RF-BC      agggaagccttagagtctccggaacattgttcacctcaccatacggcact
GQ377604_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcaat
EU939631_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcagctcaccatacggcact
MK534641_C_P-RF-BC      cgggaggcattagagtctccggaacattgttcacctcaccatacggcact
KM213033_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcagctcaccatacggcact
MK534725_C_P-RF-CB      cgggaggccttagagtctccggagcattgttcacctcaccatacggcgct
KX774505_C_P-RF-BC      cgggaggccttagagtctccggagcattgttcacctcaccatacggcact
MK534724_C_P-RF-CB      cgggaggccttagagtctccggagcattgttcacctcaccatacggcact
MK534714_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcatcatacggcact
MK534721_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534559_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534620_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534637_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
GQ377556_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK052970_C_P-RF-BD      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MT645045_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534632_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
JF436919_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MT645056_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcgcctcaccatacggcaat
FJ562229_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
KJ410497_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaacatacggcact
GQ377595_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
EU939627_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccacacggcact
MK534734_C_P-RF-BC      cgggaggccttagagtctccggaacattgtacacctcaccatacggcact
EU939632_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggccct
MK534569_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
KJ803803_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcaat
MK534651_C_P-RF-BC      cgggaggccctagagtctccagaacattgttcacctcaccatacggcact
GQ377626_C_P-RF-CB      cgggaggccttagagtctccagaacattgttcacctcaccatacggcact
MK534561_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534630_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534584_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534706_C_P-RF-CB      cgggaggccttagagtctccggaacattgtacacctcaccatacggcact
MK534594_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
KC774414_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
FJ032337_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MK534713_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
GQ377590_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcatcatacggcact
KJ173279_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
KJ173280_C_P-RF-CB      cgggaggccttaaagtctccggaacattgttcacctcaccatacggcact
MK534712_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534585_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534574_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
JX661498_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
HQ684848_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
GQ377594_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534660_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
FJ562247_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534731_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534648_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534563_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534726_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534655_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534681_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534670_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534695_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534718_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534729_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534730_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534716_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534568_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534617_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK052968_C_P-RF-BD      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
KJ803802_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
KJ173358_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
GQ377614_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
GQ377602_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
GQ377573_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
GQ377565_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
GQ377564_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
GQ377539_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
KC315400_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534646_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534609_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534616_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534607_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534567_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534579_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534580_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534625_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534639_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534560_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MG826146_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MG826147_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534564_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534685_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534675_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
GQ377596_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
GQ377549_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534562_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534598_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534722_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534717_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534690_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534689_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534688_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534684_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534672_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534664_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534633_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534736_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534618_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534558_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534556_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK052967_C_P-RF-BD      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
GQ377613_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
GQ377634_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534623_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534654_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534723_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
KP148337_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534662_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MK534687_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MF925382_C_P-RF-CB      cgggaggccttggagtctcaggaacattgttcacctcaccatacagcact
KU679952_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcayatcaccatacagcact
KY470865_C_P-RF-GC      cgggaggccttagagtctccgggacattgctcacctcaccatacagcact
KY470858_C_P-RF-GC      cgggaggccttagagtctccggaacattgttcacctcatcatacagcact
KY470871_C_P-RF-GC      cgggaggccttagagtctccggaacattgttcacctcatcatacagcact
JQ027310_C_P-RF-CB      cgggaggccttagagtctccggaacattgtwcacctcaccatacrgcact
EU787444_C_P-RF-CB      cgggaggccttaaagtctccggaacattgttaacctcaccataccgcact
HQ700554_C_P-RF-CB      agggaggccttagagtctccggaacattgttcacctcaccatacagcaat
KJ803827_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcaat
MK534679_C_P-RF-CB      cgggaggccttagagtctgtggaacatgttacacctcaccatacagcact
GQ475335_C_P-RF-CB      cgggaggccttagagtctccggaacattgtacacctcaccatacagcact
KU576102_C_P-RF-CB      cgggatgccttagagtctccggaacattgttcacctcaccgtacagcact
KU576103_C_P-RF-CB      cgggatgccttagagtctccggaacattgttcacctcaccatacagcact
KJ598675_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU576384_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KY363262_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KY363263_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774305_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MK534589_C_P-RF-BC      cgggaggccttagagtctccggaacattgttctcctcaccatacagcact
MN683730_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
DQ089798_C_P-RF-CB      cgggaggccttagagtctccggaacattgtacacctcaccatacagcact
KY363272_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KY363273_C_P-RF-CB      cgggaggccttagagtctccggaacatcgttcacctcaccatacagcact
MN683712_C_P-RF-DC      cgggaggccttagagtctccagaacattgttcacctcaccatacagcact
EU589339_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccataccgcact
MZ439673_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcaat
FJ361772_C_P-RF-GC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU939577_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MK534719_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ386646_C_P-RF-CB      cgggaggccctagagtctccggaacattgttcacctcaccatacagcact
FJ386586_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcagctcaccatacagcact
KY470845_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KY470848_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KY470851_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KY470852_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KY470853_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcaccccaccatacagcact
KY470844_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KY470843_C_P-RF-DC      cgagaggccttagagtctccggaacattgttcacctcaccatacagcact
KY470846_C_P-RF-DC      cgagaggccttagagtctccggaacattgttcacctcaccatacagcact
KY470847_C_P-RF-DC      cgagaggccttagagtctccggaacattgttcacctcaccatacagcact
KY470849_C_P-RF-DC      cgagaggccttagagtctccggaacattgttcacctcaccatacagcact
KY470850_C_P-RF-DC      cgagaggccttagagtctccggaacattgttcacctcaccatacagcact
KY470855_C_P-RF-DC      cgagaggccttagagtctccggaacattgttcacctcaccatacagcact
KY470854_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KY470856_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KJ803772_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU939547_C_P-RF-CB      agggaggccttagagtctccggaacattgttcacctcaccatacagcact
JQ040142_C_P-RF-CB      cgggaggccttagagtctccggaacactgttcacctcaccatacagcact
JX661486_C_P-RF-CB      cgggaggccttagagtctccggaacactgttcacctcaccatacagcact
JQ040148_C_P-RF-CB      cgggaggccttagagtctccggaacactgttcacctcaccatacagcact
GQ377635_C_P-RF-BC      cgggaggccttagagtctccggaacactgttcacctcaccatacagcact
JX661485_C_P-RF-CB      cgggaggccttagagtctccggaacactgttcacctcaccatacagcact
MG893554_C_P-RF-CB      cgggaggccttagagtctccggaacactgttcacctcaccatacagcact
MG893555_C_P-RF-CB      cgggaggccttagagtctccggaacactgttcgcctcaccatacagcact
MK534613_C_P-RF-CB      cgagaggccttagagtctccggaacattgttcacctcaccatactgcact
KX765835_C_P-RF-GC      cgggaggccctagagtctccggaacattgttcacctcaccatacagcact
JQ801477_C_P-RF-BC      cgagaggccttagagtctccggaacattgttcacctcaccatacagcact
KJ803753_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
JQ801476_C_P-RF-CG      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MF925370_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
JN664935_C_P-RF-DC      cgggaggctttagagtctccggaacattgttcacctcaccatacagcact
MF925381_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT645015_C_P-RF-CB      cgggaggccttagagtctccggaacattgttctcctcaccatacagcact
KJ803804_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacatcaccatacagcact
MK534610_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
GQ924618_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB674504_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MK534606_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatactgcact
MK534735_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MG826148_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
JF436923_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
JN104438_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
JN104442_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MF925389_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KJ410506_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB031265_C_P-RF-CB      agggaggccttagagtctccggaacattgttcacctcaccatacagcact
MK534682_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB367419_C_P-RF-CB      cgggaggccttagagtctcctgaacattgtacacctcaccatacagcact
KU964366_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964367_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964370_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964372_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964374_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964379_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964380_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ562263_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KT991424_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KT991427_C_P-RF-DC      cgggaggccttggagtctccggaacattgttcacctcaccatacagcact
MN650068_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcatcatacagcact
MT645039_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB205152_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcagctcaccatacagcact
KC774193_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774291_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774307_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774449_C_P-RF-DC      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
MN650079_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AY057948_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683680_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683580_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683678_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683721_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KP276253_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HM750148_C_P-RF-DC      cgggaggctttagagtctccggaacattgttcacctcaccatacagcact
MN683725_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683703_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650083_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KX354997_C_P-RF-DC      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KC774482_C_P-RF-DC      agggaggccttagagtctccggaacattgttcacctcaccatacagcact
HM750142_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
DQ478890_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AY817511_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KX660689_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683711_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KX660684_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683706_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650087_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650080_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650081_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650082_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650084_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650077_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KP276256_C_P-RF-DC      cgggaggccttagagtctcctgaacattgttcacctcaccatacagcact
HM750150_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HM750147_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HM750145_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HM750144_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ349241_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683700_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683699_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683697_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683696_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683687_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683688_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683686_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683724_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650072_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650073_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650074_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650075_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650078_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650085_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650086_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683723_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650069_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774456_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HM750143_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HM750149_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683694_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683695_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HM750146_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU787435_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774453_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774481_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KY629632_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ562226_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683722_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683634_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU519423_C_P-RF-DC      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
MN683674_C_P-RF-DC      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
JF491451_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
JF491455_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683574_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683579_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
JQ040174_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagccct
GQ377607_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU919166_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU919167_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774178_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774364_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774428_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB270535_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
DQ478898_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774442_C_P-RF-DC      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KC774422_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963856_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963857_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963858_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963859_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963860_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963861_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963863_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963864_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963865_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963866_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963867_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963868_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963869_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963870_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963862_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU916239_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU916241_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU916240_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774455_C_P-RF-DC      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KC774452_C_P-RF-DC      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KC774435_C_P-RF-DC      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KC774443_C_P-RF-DC      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KC774484_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774498_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU787434_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774466_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774439_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HQ700520_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacatcaccatacagccct
EU916228_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ562267_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcaat
AB014375_C_P-RF-CB      cgggaggccttagagtctccggaacattgtacgcctcaccatacggcact
EU939668_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
KU576837_C_P-RF-BC      cgggatgccttagagtctccggaacattgctcacctcaccacacagcact
KU577083_C_P-RF-BC      cgggatgccttagagtctccggaacattgctcacctcaccacacagcact
FJ562227_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
GU385774_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU589337_C_P-RF-CB      cgggaggctttagagtctccggaacattgttcacctcaccatacagcact
AF461361_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
KU964351_C_P-RF-CB      cgggaggccttagagtctccggaacactgttcacctcaccatacagcact
KU963930_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU963931_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU963932_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU963933_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU963934_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU963935_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU963936_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU963938_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU963939_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU963940_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU963941_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU963942_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU963943_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU963944_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
JQ040130_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ386593_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MG826149_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ562287_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ562277_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU939602_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ562305_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
EU939629_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
GQ377633_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871994_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871995_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871992_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871993_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871996_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU872014_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU872015_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871985_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871981_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871983_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871986_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871999_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871984_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871987_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871988_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871989_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871990_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
EU871991_C_P-RF-CB      cgggaggccttagagtctcctgaacattgttcacctcaccatacggcact
MT645071_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB642096_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcasctcaccatacagcact
AB198084_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
GU357843_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ562336_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ562271_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU939589_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU939565_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KR013806_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcgccatacagcact
AF411409_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccataccgcact
EU939581_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963883_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KM875422_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacggcact
AB367393_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT645069_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
M38454_C_P-RF-CB        cgggaggccttagagtctccggaacattgctcacctcaccataccgcact
AY123424_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccataccgcact
KY881840_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccataccgcact
EU871997_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccataccgcact
JQ040146_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
JX429896_C_P-RF-CB      cgggaggccttagagtctccggaacactgttcacctcaccatacagcact
JX661494_C_P-RF-CB      cgggaggccttagagtctccggaacactgttcacctcaccatacagcact
MT645029_C_P-RF-CB      cgggaggccttagagtctccggaacaatgttcacctcaccatacagcact
KJ173299_C_P-RF-CB      cgggaggccttagagtctccggaacactgttcacctcaccatacagcact
KJ173300_C_P-RF-CB      cgggaggccttagagtctccggaacactgttcacctcaccatacagcact
JX026887_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ386633_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KY470893_C_P-RF-CB      cgagaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774188_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774294_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MG893561_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KJ173325_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagctct
KJ173326_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagctct
FJ787446_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ787480_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426501_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426531_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426561_C_P-RF-CB      cgggaggccttagagtcaacggaacattgttcacctcaccatacagcact
MT426506_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426553_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426457_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426491_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426547_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426563_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426545_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426482_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426490_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426514_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426515_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426523_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426527_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426551_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426463_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426539_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426510_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426504_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426503_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426535_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426461_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426455_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426483_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426459_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426460_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426462_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426464_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426469_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426470_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426473_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426475_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426476_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426477_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426478_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426479_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426481_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426486_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426487_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426489_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426492_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426507_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426544_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426574_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426568_C_P-RF-CB      cgggaggccttagagtctccggaccattgttcacctcaccatacagcact
MT426555_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426550_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426546_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426542_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426564_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426540_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcgct
MT426537_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426562_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426573_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426533_C_P-RF-CB      cgggaggccttagagtctccggaacaatgttcacctcaccatacagcact
MT426532_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426528_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426499_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426494_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426472_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426468_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426465_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MK321265_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MK720627_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MK720628_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426456_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426466_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426467_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426471_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426480_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426484_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426485_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426488_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426493_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426495_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426496_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426497_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426498_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426500_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426502_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426505_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426508_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426509_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426511_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426512_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426513_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426517_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426518_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426519_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426520_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426521_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426522_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426524_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426525_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426526_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426529_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426530_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426534_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426536_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426538_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426541_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426543_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426549_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426554_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426556_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426557_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426558_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426559_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426560_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426565_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426566_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426567_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426569_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426570_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426571_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426572_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426575_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT426576_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ562314_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MG893559_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT645035_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KR013816_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774183_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774186_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774246_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
AY167095_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB367400_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
JQ040175_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
LC458432_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ562302_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ562294_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
LC279263_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
LC279264_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
LC279265_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
LC279266_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
LC279267_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
GQ377516_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
GQ377544_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
GQ377581_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
GQ377520_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
GQ377534_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774258_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KJ173320_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KJ173322_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MW887644_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KJ173329_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KJ173330_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KC774324_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774230_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963990_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963991_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963993_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963994_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963995_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963998_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU963999_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964001_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964003_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KJ173350_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774328_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatactgcact
KC774317_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774322_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
GQ377548_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ386578_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ386585_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FJ386649_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB105172_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagccct
AP011102_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagccct
AB493842_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagccct
AP011103_C_P-RF-CB      cgggaagccttagagtctccggaacattgttcacctcaccatacagccct
AB493840_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagccct
GQ358155_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcatcatacagccct
AB493837_C_P-RF-CB      cgggaggccttagagtctccggagcattgctcacctcaccatacagccct
GQ358156_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagccct
AB493838_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagccct
AB493847_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagccct
KU679945_C_P-RF-CB      cgggatgccttagagtctccggaacrttgttcagctcaccatacagccct
KF873537_C_P-RF-CB      cgggatgccttagagtctccggaacattgtacacctcaccatacagccct
KF873540_C_P-RF-CB      cgggatgccttagagtctccggaacattgttcacctcaccatacagccct
KF873538_C_P-RF-CB      cgggatgccttagagtctccggaacattgttcacctcaccatacagccct
KF873543_C_P-RF-CB      cgggatgccttagagtctccggaacattgttcacctcaccatacagccct
KF873542_C_P-RF-CB      cgggatgccttagagtctccggaacattgttcacctcaccatacagccct
AP011108_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HQ700557_C_P-RF-CB      cgggaggctttagagtctccggaacattgttcacctcaccatacagcact
HQ700542_C_P-RF-CB      cgggaggccctagagtctccggaacattgttcacctcaccatacagcact
KU695745_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcaat
X75656_C_P-RF-CB        cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HQ700462_C_P-RF-CB      agggaggccttagagtctccggaacattgttcacctcaccatacagcact
HQ700485_C_P-RF-CB      agggaggccttagagtctccggaacattgttcacctcaccatacagcact
HQ700498_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HQ700499_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HQ700560_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KF873533_C_P-RF-CB      cgggaggccttagagtytccggaacattgttcacctcaccatacagcact
KF873534_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KF873531_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KF873532_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KF873535_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU679939_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU679940_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU679956_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KF873527_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KU679954_C_P-RF-CB      cgggaggccttagaatctccggaacattgctcacctcaccatacagcact
KU679942_C_P-RF-CB      cgggaggccttagaatctccggaacattgctcacctcaccatacagcact
KU679943_C_P-RF-BC      cgggaggccttagaatctccggaacattgctcacctcaccatacagcact
HQ700518_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HQ700527_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HQ700528_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HQ700523_C_P-RF-CB      agggacgccttagagtctccggaacattgttcacctcaccatacagcact
HQ700530_C_P-RF-CB      agggacgccttagagtctccggaacattgttcacctcaccatacagcact
HQ700531_C_P-RF-CB      agggacgccttagagtctccggaacattgttcacctcaccatacagcact
HQ700532_C_P-RF-CB      agggacgccttagagtctccggaacattgttcacctcaccatacagcact
HQ700519_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
HQ700521_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KF873521_C_P-RF-BC      cgagaggccttagagtctccggaacattgctcacctcaccatacagcact
KU679955_C_P-RF-CB      cgagaggccttagagtctccggaacattgctcagctcaccatacagcact
KU679950_C_P-RF-CB      cgagaggccttagagtcttcggaacattgctcacctcaccatacagcact
KU679944_C_P-RF-BC      cgagaggccttagagtctccggaacattgctcacctcaccatacagcact
KU679948_C_P-RF-CB      cgagaggccttagagtctccggaacattgctcacctcaccatacagcact
KU679953_C_P-RF-BC      cgagaggccttagagtctccggaacattgctcacctcaccatacagcact
KU679946_C_P-RF-BC      cgagaggccttagagtctccggaacattgctcacctcaccatacagcact
KF873519_C_P-RF-CB      cgagaggccttagagtctccggaacattgctcacctcaccatacagcact
KF873517_C_P-RF-BC      cgagaggccttagagtctccggaacattgctcacctcaccatacagcact
KF873518_C_P-RF-CB      cgagaggccttagagtctccggaacattgctcacctcaccatacagcact
KF873515_C_P-RF-CB      cgagaggccttagagtctccggaacattgctcacctcaccatacagcact
KF873511_C_P-RF-CB      cgagaggccttagagtctccggaacattgctcacctcaccatacagcact
KF873513_C_P-RF-CB      cgagaggccttagagtctccggaacattgctcacctcaccatacagcact
KU679958_C_P-RF-CB      cgggaggccttagagtctccggagcattgcacacmtcaccatacagcact
KU679941_C_P-RF-CB      cgggaggctttagagtctccggaacattgctcacctcaccatacagcact
KF873522_C_P-RF-CB      cgggaggccttagagtctccggagcattgctcacctcaccatacagcact
KF873523_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
KF873524_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
HQ700509_C_P-RF-CB      cgggaggccttagagtccccggagcattgttcacctcaccatacagcact
HQ700515_C_P-RF-CB      cgggaggccttagagtccccggagcattgttcacctcaccatacagcact
HQ700507_C_P-RF-CB      cgggaggccttagagtctccggagcattgttcacctcaccatacagcact
HQ700508_C_P-RF-CB      cgggaggccttagagtctccggagcattgttcacctcaccatacagcact
KU695744_C_P-RF-CB      cgggaggccttagagtctccggagcattgttcacctcaccatacagcact
KU695746_C_P-RF-CB      cgggaggccttagagtctccggagcattgttcacctcaccatacagcact
HQ700505_C_P-RF-CB      cgggaggccttagagtctccggagcattgttcacctcaccacacagcact
KU695741_C_P-RF-CB      cgggaggccttagagtctccggagcattgttcacctcaccatacagcact
KU695743_C_P-RF-CB      cgggaggccttagagtctccggagcattgttcacctcaccatacagcact
MG826142_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagccct
MG826141_C_P-RF-CB      cgggaggccttagagtcttcggaacattgttcacctcaccatacggcact
KT003704_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KP148352_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AP011104_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AP011105_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
LC416040_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683618_C_P-RF-DC      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
FJ386643_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU695742_C_P-RF-CB      agggaagccttagagtctccggaacattgttcacctcaccatacagcact
FJ562317_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcagctcaccatacagcact
FJ386635_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
MT645070_C_P-RF-DC      cgggaggccttagagtctccggagcattgttcacctcaccatacagcact
KJ803788_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HQ700526_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccacacagcact
MK534582_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcgcctcaccatacagcaat
AB241109_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683669_C_P-RF-DC      cgggaggccttagagtctccggaacattgtacacctcaccatacagcact
EU717211_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB300369_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT645048_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
JX504540_C_P-RF-CB      cgggaggccttagagtctccggaacactgctcacctcaccatacagcact
KJ803778_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
Y18856_C_P-RF-CB        cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KX660686_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683707_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AY206374_C_P-RF-CB      cgggaggctcttgagtctccggaacattgttcacctcaccatacagcact
EU939551_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacggcact
AB670303_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774234_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU916232_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964315_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964308_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964010_C_P-RF-CB      cgggaggccttagagtctccggaacatggttcacctcaccatacagcact
KU964005_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964007_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964008_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964009_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964303_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964304_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964305_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964306_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964307_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964309_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964310_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964311_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964312_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964313_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964314_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964316_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964317_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KU964006_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KX096713_C_P-RF-CA      cgggaggccttaragtctccggaacattgttcagctcaccatacagcact
KY670781_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MG826144_C_P-RF-CB      cgggaggccttagagtcaccggaacattgttcacctcaccatacagcact
KX660685_C_P-RF-DC      cgggaggccttagagtctccggaacattgttctcctcaccatacagcact
MN683641_C_P-RF-DC      cgggaggccttagagtctccggaacattgttctcctcaccatacagcact
AB367800_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcagctcaccatacagcact
FJ715345_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcagt
FJ715346_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcagt
FJ715347_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcagt
HQ684849_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB049609_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KR013843_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccacacggcact
MK534587_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774485_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683716_C_P-RF-DC      cgggaggccttagagtctccgcaacattgttcacctcaccatacagcact
MK534577_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774212_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatactgcact
EU939606_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AY040627_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatactgcact
MT645063_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683620_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HQ700547_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
GQ377560_C_P-RF-CB      cgggaggctctagagtctccggaacattgttcacctcaccatacagcact
KC774198_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774201_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
EU522070_C_P-RF-CB      cgagaagccttagagtctccggaacattgttcacctcaccatacagcact
EU881995_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KT991420_C_P-RF-DC      cgggaggccttagagtctccggaacactgttcacctcaccatacagcact
FJ562278_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KT991417_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KT991423_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KT991419_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683627_C_P-RF-DC      cgggaggccttagagtctccggaacattgtacacctcaccatacagcact
MN683581_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MH094410_C_P-RF-BC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
JX661487_C_P-RF-CB      cgggaggccttagagtctccagaacattgttcacctcaccatacagcact
JQ732168_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
GQ377611_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB195939_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB195940_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB195941_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB195955_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB195956_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB195957_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AB033557_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatactgcact
KC774263_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774332_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774341_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KX660682_C_P-RF-DC      cgggaggccttagagwctccggaacattgttcacctcaccatacagcact
JF436922_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT645062_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683717_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774490_C_P-RF-DC      cgtgaggccttagagtctccggaacattgttcacctcaccatacagcact
JN400086_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
HM750133_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatactgcact
GQ377522_C_P-RF-CB      cgggaggccttagagtctccggaacattgctcacctcaccatacagcact
FJ386581_C_P-RF-CB      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
DQ478886_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683588_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
AY817509_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774447_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KC774486_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN650076_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683720_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683718_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683719_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KX660674_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683664_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683665_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
KX660680_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MT645060_C_P-RF-DC      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
MN683677_C_P-RF-DC      cgagaggccttagagtctccggaacattgttcacctcaccatac