HBVdb

Dataset for nucleotide sequence X of genotype H

[Download (right click)] [Edit] [Sequences] [Repertoires]

34 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


AB064315_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY090454_X_C-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY090457_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HM117851_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB059659_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB205010_X_P-H      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM066946_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB059660_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB059661_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM998718_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB375161_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB375163_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM998719_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM998723_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB818694_X_P-H      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB266536_X_P-H      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU498228_X_P-H      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB353764_X_P-H      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM998720_X_P-H      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM117850_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ356715_X_P-H      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY090460_X_P-H      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB275308_X_P-H      atggctgataggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ356716_X_C-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB375162_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB179747_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF157291_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX264501_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB375159_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB375160_X_P-H      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY458059_X_P-H      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY458060_X_P-H      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB375164_X_P-H      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM998721_X_P-H      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
                    ******* * ** ************************************** ********

AB064315_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
AY090454_X_C-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcctggggctctgccgccccct
AY090457_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcctggggctctgccgccccct
HM117851_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
AB059659_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctaccgccctct
AB205010_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
HM066946_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctaccgccctct
AB059660_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctaccgccctct
AB059661_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
KM998718_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccccct
AB375161_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccccct
AB375163_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccccct
KM998719_X_P-H      gtcgacgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
KM998723_X_P-H      gtcgacgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
AB818694_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
AB266536_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
EU498228_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
AB353764_X_P-H      gtcggcgctgaatcctgcggacgacccctctcggggtcgcttggggctctgccgccctct
KM998720_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
HM117850_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgtttggggctctgccgccctct
FJ356715_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
AY090460_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
AB275308_X_P-H      gtcggcgcagaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
FJ356716_X_C-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
AB375162_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
AB179747_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
EF157291_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
KX264501_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
AB375159_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
AB375160_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
KY458059_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
KY458060_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
AB375164_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
KM998721_X_P-H      gtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctct
                    **** *** ************************ *****  ********* ****** **

AB064315_X_P-H      tctccgcctgccgttccggccaacgacgggtcgcacctctctttacgcggactccccgcc
AY090454_X_C-H      tctccgccttccgttccggccgacgacagggcgcacctctctttacgcggactccccgcc
AY090457_X_P-H      tctccgccttccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
HM117851_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB059659_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB205010_X_P-H      tctccgcctgccgttccggccgtcgacgggtcgcacctctctttacgcggactccccgcc
HM066946_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB059660_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB059661_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
KM998718_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB375161_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB375163_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
KM998719_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
KM998723_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB818694_X_P-H      tctccgcctgtcgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB266536_X_P-H      tctccgcctgtcgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
EU498228_X_P-H      tctccgcctgtcgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB353764_X_P-H      tctccgcctgtcgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
KM998720_X_P-H      tctccgcctgccgttccgaccgacgacgggtcgcacctctctttacgcggactccccgcc
HM117850_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
FJ356715_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AY090460_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB275308_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
FJ356716_X_C-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB375162_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB179747_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
EF157291_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
KX264501_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB375159_X_P-H      tctccgcctaccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB375160_X_P-H      tctccgcctaccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
KY458059_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
KY458060_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
AB375164_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
KM998721_X_P-H      tctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccgcc
                    *********  ******* **  **** ** *****************************

AB064315_X_P-H      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
AY090454_X_C-H      tgtgccttttcatcagccggcccgtgtgcacttcggttcacctctgcacgtcgcatggag
AY090457_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM117851_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB059659_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcacatggag
AB205010_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM066946_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB059660_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB059661_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KM998718_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB375161_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB375163_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KM998719_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KM998723_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB818694_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB266536_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU498228_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB353764_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KM998720_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM117850_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ356715_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY090460_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB275308_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ356716_X_C-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB375162_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB179747_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF157291_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KX264501_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB375159_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB375160_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY458059_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY458060_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB375164_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KM998721_X_P-H      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
                    ******** ***** ***** ************** **************** *******

AB064315_X_P-H      accaccgtgaacgcccctcggaacttgccaacaaccttatataagaggactcttggactt
AY090454_X_C-H      accaccgtgaacgcccctcaaagcttgccaacacccttacataaaaggactcttggactt
AY090457_X_P-H      accaccgtgaacgcccctcaaagcttgccaacaaccttacataagaggactcttggactt
HM117851_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
AB059659_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttatataagaggactcttggactt
AB205010_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
HM066946_X_P-H      accaccgtgaacgcccctcggagcttgccaacaaccttacataagaggactcttggactt
AB059660_X_P-H      accaccgtgaacgcccctcggagcttgccaacaaccttacataagaggactcttggactt
AB059661_X_P-H      accaccgtgaacgcccctcggagcttgccaacaaccttacataagaggactcttggactt
KM998718_X_P-H      accaccgtgaacgcccctcagagcttgccaacaaccttacataagagaactcttggactt
AB375161_X_P-H      accaccgtgaacgcccctyrgaacttgccaacaaccttacataagagaactcttggactt
AB375163_X_P-H      accaccgtgaacgcccctcagagcttgccaacaaccttacataagagaactcttggactt
KM998719_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
KM998723_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
AB818694_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
AB266536_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
EU498228_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
AB353764_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
KM998720_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
HM117850_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
FJ356715_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttatataagaggactcttggactt
AY090460_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttgcataagaggactcttggtctt
AB275308_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
FJ356716_X_C-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
AB375162_X_P-H      accaccgtgaacgcccattggaacttgccaacaaccttacataagaggactcttggactt
AB179747_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
EF157291_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
KX264501_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
AB375159_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
AB375160_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
KY458059_X_P-H      accaccgtgaacgccccttggaacctgccaacaaccttacataagaggactcttggactt
KY458060_X_P-H      accaccgtgaacgccccttggaacctgccaacaaccttacataagaggactcttggactt
AB375164_X_P-H      accmccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
KM998721_X_P-H      accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactt
                    *** ************ *   * * ******** ****  **** ** ******** ***

AB064315_X_P-H      tcgccccggtcaatgacctggattgaggaatacatcaaagactgtgtatttaagggctgg
AY090454_X_C-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtgtttaaggactgg
AY090457_X_P-H      tcaccccggtcaacgacctggattgaggaatacatcaaagactgtgtgtttaaggactgg
HM117851_X_P-H      tcgccccagtcaacgacctggattgaggaatacatcaaagactgtgtgtttaaggactgg
AB059659_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaggactgtgtatttaaggactgg
AB205010_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
HM066946_X_P-H      tcgccccggtcaacgacctggattgaggactacatcaaagactgtgtatttaaggactgg
AB059660_X_P-H      tcgccccggtcaacgacctggattgaggactacatcaaagactgtgtatttaaggactgg
AB059661_X_P-H      tcgccccggtcaacgacctggattgaggactacatcaaagactgtgtatttaaggactgg
KM998718_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
AB375161_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
AB375163_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
KM998719_X_P-H      tcgccccagtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
KM998723_X_P-H      tcgccccagtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
AB818694_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
AB266536_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
EU498228_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
AB353764_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
KM998720_X_P-H      tcgcctcggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
HM117850_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
FJ356715_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
AY090460_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
AB275308_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
FJ356716_X_C-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
AB375162_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
AB179747_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
EF157291_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
KX264501_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
AB375159_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
AB375160_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
KY458059_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
KY458060_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
AB375164_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
KM998721_X_P-H      tcgccccggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgg
                    ** ** * ***** *************** ******** ******** ******* ****

AB064315_X_P-H      gaggagtcgggggaggagttgaggttaatgatttatgtattaggaggctgtaggcataaa
AY090454_X_C-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AY090457_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
HM117851_X_P-H      gaggagtcgggggaggagtcgaggttaatggtttatgtattaggaggctgtaggcataaa
AB059659_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtactaggaggctgtaggcataaa
AB205010_X_P-H      gaggagtcgggggaggagttgaggttaatgatctttgtattaggaggctgtaggcataaa
HM066946_X_P-H      gaggagtcaggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AB059660_X_P-H      gaggagtcgggggaggagctgaggttaaaggtctttgtattaggaggctgtaggcataaa
AB059661_X_P-H      gaggagtcgggggaggagctgaggttaaaggtctttgtattaggaggctgtaggcataaa
KM998718_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AB375161_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AB375163_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
KM998719_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataga
KM998723_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AB818694_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AB266536_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
EU498228_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AB353764_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
KM998720_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
HM117850_X_P-H      gaggagtcgggggaggagctgaggttaaaggtctttgtattaggaggctgtaggcataaa
FJ356715_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AY090460_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AB275308_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
FJ356716_X_C-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AB375162_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AB179747_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
EF157291_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
KX264501_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AB375159_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AB375160_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
KY458059_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
KY458060_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
AB375164_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
KM998721_X_P-H      gaggagtcgggggaggagttgaggttaaaggtctttgtattaggaggctgtaggcataaa
                    ******** *********  ******** * * * **** ****************** *

AB064315_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AY090454_X_C-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AY090457_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
HM117851_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AB059659_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AB205010_X_P-H      ttggtctgttcaccagcaccatgcaacttttccacctctgcctaa
HM066946_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AB059660_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AB059661_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
KM998718_X_P-H      ttggtctgttcaccaccaccatgcaactttttcacctctgcctaa
AB375161_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AB375163_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
KM998719_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctggctaa
KM998723_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AB818694_X_P-H      ttggtctgtgcaccagcaccatgcaactttttcacctctgcctaa
AB266536_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
EU498228_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AB353764_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
KM998720_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
HM117850_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
FJ356715_X_P-H      ttggtctgttcaccagcaccattcaactttttcacctctgcctaa
AY090460_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AB275308_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
FJ356716_X_C-H      ttggtctgttcaccagcaccattcaactttttcacctctgcctaa
AB375162_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AB179747_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
EF157291_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
KX264501_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AB375159_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AB375160_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
KY458059_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
KY458060_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
AB375164_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
KM998721_X_P-H      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
                    ********* ***** ****** ******** ******** ****

© 1998-2020Legal notice