HBVdb

Dataset for nucleotide sequence SP of genotype H

[Download (right click)] [Edit] [Sequences] [Repertoires]

28 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


AB059660_SP_P-H      atgcccctatcctgtcaacaattccggagacttgtgttattagacaacga
AB064315_SP_P-H      atgcccctatcctatcaacgcttcctgagtgtactgttattagacaacga
HM117850_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
HM066946_SP_P-H      atgcccctatcctatcaacacttccggagactactgttattagacaacga
HQ285946_SP_P-H      atgcccctatcctatcaacacttccggagactactgttattagacaacga
AY090457_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB375163_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB353764_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB059659_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
FJ356716_SP_C-H      atgcccctatcctatccacacttccggagactactgttgttagacaacga
HM117851_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
FJ356715_SP_P-H      atgcccctatcctatcaacgcttccggagactactgttgttagacaacga
EF157291_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AY090460_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB375159_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB375160_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB375161_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB375162_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB375164_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AY090454_SP_C-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
KX264501_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB275308_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB179747_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB059661_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB205010_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB266536_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
EU498228_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
AB818694_SP_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
                     ************* ** **  **** ***  *  **** ***********

AB059660_SP_P-H      ggcagggcccctagaggaagaactccctcgcctcgcagacgaagatctaa
AB064315_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM117850_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM066946_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
HQ285946_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY090457_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB375163_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB353764_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB059659_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
FJ356716_SP_C-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM117851_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
FJ356715_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
EF157291_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY090460_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB375159_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB375160_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB375161_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB375162_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB375164_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY090454_SP_C-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
KX264501_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB275308_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB179747_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB059661_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB205010_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB266536_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU498228_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB818694_SP_P-H      ggcagggcccctagaagaagaactccctcgcctcgcagacgaagatctca
                     *************** ******************************** *

AB059660_SP_P-H      atcaccgcgtcgcagaagatctccatctccagcttcccaatgatctacaa
AB064315_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatcttcaa
HM117850_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
HM066946_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
HQ285946_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AY090457_SP_P-H      atcaccgcgtcgccgaagatctcaatctccagcttcccaatgatctacaa
AB375163_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatcaacaa
AB353764_SP_P-H      atctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AB059659_SP_P-H      atcgccgcgtcgcagaagatctcaatctccatcttccaaatgatctacaa
FJ356716_SP_C-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatcaacaa
HM117851_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
FJ356715_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
EF157291_SP_P-H      atctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AY090460_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AB375159_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AB375160_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AB375161_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AB375162_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AB375164_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AY090454_SP_C-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
KX264501_SP_P-H      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AB275308_SP_P-H      atctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AB179747_SP_P-H      atctccgcgtcgcagaagatctcaatctccagcttcccaatgatcwacaa
AB059661_SP_P-H      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AB205010_SP_P-H      atctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AB266536_SP_P-H      atctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
EU498228_SP_P-H      atctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
AB818694_SP_P-H      atctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
                     *** ********* ********* ******* ***** *******  ***

AB059660_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AB064315_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
HM117850_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
HM066946_SP_P-H      ccaccagcacgggaccctgcaagacctgcaccactcttgctcaaggaacc
HQ285946_SP_P-H      ccaccagcacgggaccctgcaagacctgcaccactcttgctcaaggaacc
AY090457_SP_P-H      ccaccagcacgggtccctgcaaaacctgcaccactcttgctcaaggaacc
AB375163_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcytgctcaaggaacc
AB353764_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AB059659_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
FJ356716_SP_C-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
HM117851_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
FJ356715_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
EF157291_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AY090460_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AB375159_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AB375160_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AB375161_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AB375162_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AB375164_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AY090454_SP_C-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
KX264501_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AB275308_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaccc
AB179747_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AB059661_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AB205010_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AB266536_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
EU498228_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
AB818694_SP_P-H      ccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacc
                     ************* ******** ************* ********** **

AB059660_SP_P-H      tctatgtttccctcctgttgctgtaccaaaccttcggacggaaattgcac
AB064315_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
HM117850_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
HM066946_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
HQ285946_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AY090457_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AB375163_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AB353764_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AB059659_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
FJ356716_SP_C-H      tctatgtttccctcttgctgctgtaccaaaccttcggacggaaattgcac
HM117851_SP_P-H      tctatgtttccctcctgctgctgtataaaaccttcggacggaaattgcac
FJ356715_SP_P-H      tctatgtttccctcttgctgctgtaccaaaccttcggacggaaattgcac
EF157291_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AY090460_SP_P-H      tctatgtttccctcttgctgctgtaccaaaccttcggacggaaattgcac
AB375159_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AB375160_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AB375161_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AB375162_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AB375164_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AY090454_SP_C-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
KX264501_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AB275308_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AB179747_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AB059661_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AB205010_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AB266536_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
EU498228_SP_P-H      tctatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcac
AB818694_SP_P-H      tctatgtttccctcctgctgttgtaccaaaccttcggacggaaattgcac
                     ************** ** ** ****  ***********************

AB059660_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB064315_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
HM117850_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggact
HM066946_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
HQ285946_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AY090457_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB375163_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB353764_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggatt
AB059659_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
FJ356716_SP_C-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
HM117851_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
FJ356715_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
EF157291_SP_P-H      ctgtattcccatcccatcgtcttgggctttcggaaaatacctatgggagt
AY090460_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB375159_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB375160_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB375161_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB375162_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB375164_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AY090454_SP_C-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
KX264501_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB275308_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB179747_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB059661_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB205010_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB266536_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
EU498228_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
AB818694_SP_P-H      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
                     ****************** ***************************** *

AB059660_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB064315_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
HM117850_SP_P-H      gggcctcagcccgtttctcatggctcagtttactag
HM066946_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
HQ285946_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AY090457_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB375163_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB353764_SP_P-H      gggcctcagcccgtttctcatggctcagtttactag
AB059659_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
FJ356716_SP_C-H      gggcctcagcccgtttctcttggctcagtttactag
HM117851_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
FJ356715_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
EF157291_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AY090460_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB375159_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB375160_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB375161_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB375162_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB375164_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AY090454_SP_C-H      gggcctcagcccgtttctcttggctcagtttactag
KX264501_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB275308_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB179747_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB059661_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB205010_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB266536_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
EU498228_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
AB818694_SP_P-H      gggcctcagcccgtttctcttggctcagtttactag
                     ******************* ****************

© 1998-2020Legal notice