HBVdb

Dataset for nucleotide sequence S of genotype H

[Download (right click)] [Edit] [Sequences] [Repertoires]

98 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


JN604202_S_P-H      atgaagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtttttc
MK568527_S_P-H      atggagaacatcacatcaggactcccaggactccgtctcgtgttacaggcggtgtgtttc
DQ236109_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
MF150691_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
MF150692_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236129_S_P-H      atggagaacatcacatcaggactcctaggaccccttcccgtgttacaggcggtgtgttcc
DQ236126_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
GQ486375_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
GQ486268_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtctttc
MK568533_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KM606705_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KM606937_S_P-H      atggagaacatcacatcaggactcctaggcccccttctcgtgttacaggcggtgtgtttc
KM998717_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236127_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacagggggtgtttttc
AB059659_S_P-H      atggagaacatcacatcaggactcctaggaccccttcccgtgttacagggggtgtttttc
AB375163_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236118_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
HM117850_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB353764_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB353766_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KX372218_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KM998722_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KC836829_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB064315_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
JN604203_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
FJ356715_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtttttc
AF369535_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236102_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AF369545_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236113_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttt
DQ236111_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236112_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236132_S_P-H      atggagaacatcacgtcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236124_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgttcc
DQ236114_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB375160_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236115_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
MF150695_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
FJ356716_S_C-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AF369536_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AF369540_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236106_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
EF157291_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB275308_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB179747_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB205010_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB266536_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB353765_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
EU498228_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB818694_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
HM066946_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
HQ285946_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KP997512_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
MK568526_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
MK568532_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236122_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236123_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
GQ486592_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
JN604310_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KM998718_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KM998720_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
EU159675_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AY090460_S_P-H      atggagaacatcacatcaggactcctaagaccccttctcgtgttacaggcggtgtgtttc
KM998721_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
MK568522_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
MK568524_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
HM117851_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
MK568534_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
MK568523_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KM998723_S_P-H      atggagagcatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236131_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236130_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AY090457_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
U91819_S_P-H        atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AF369543_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB375159_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB375162_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AF369541_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AF369542_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236120_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
MF150696_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB059661_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB059660_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB375164_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AF369531_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AF369537_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AF369538_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AF369539_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236101_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236121_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
DQ236125_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KM998719_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KX264501_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KY458059_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KY458060_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AB375161_S_P-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
AY090454_S_C-H      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
U91827_S_P-H        atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
                    *** *** ****** ********** * * * ** ** *********** ***** **  

JN604202_S_P-H      tcgttgacaaaaatcctcacaataccccagagtctagactcgtggtggacttctctcaat
MK568527_S_P-H      tggttgacaaaaatccgcacaatgccaaagaggctagactcgtggtggacttctctcaat
DQ236109_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MF150691_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagt
MF150692_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagt
DQ236129_S_P-H      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagt
DQ236126_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagacttgtggtggacttctctcaat
GQ486375_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcagt
GQ486268_S_P-H      ttgttgacaaaaatcctcacaataccacggagtctagactcgtggtggacttctctcagt
MK568533_S_P-H      ttgttgacaaaaatccgcaaaataccacagagtctagactcgtggtggacttctctcaat
KM606705_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagt
KM606937_S_P-H      ttgttgacaaaaatcctcacaataccccagagtctagactcgtggtggacttctctcagt
KM998717_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236127_S_P-H      tcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB059659_S_P-H      tcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB375163_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236118_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM117850_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB353764_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
AB353766_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
KX372218_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KM998722_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC836829_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
AB064315_S_P-H      ttgttgacaaaaatcctcacaataccacggagtctagactcgtggtggacttctctcaat
JN604203_S_P-H      ttgttgacaaaaatcckcacaataccaaagagtctagactcgtggtggacttctctcaat
FJ356715_S_P-H      ttgttgacaaaagtcctcacaataccaaagagtctagactcgtggtggacttctctcaat
AF369535_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236102_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF369545_S_P-H      ttgttgacaaaaatcctcacaataccacggagtctagactcgtggtggacttctctcaat
DQ236113_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236111_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236112_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236132_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagt
DQ236124_S_P-H      ttgttgacaaaaatccgcacaataccaaagagtctagactcgtggtggacttctctcaat
DQ236114_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB375160_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236115_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MF150695_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ356716_S_C-H      ttgttgacaaaaatccgcacaataccacagagtctagactcgtggtggacttctctcaat
AF369536_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctcgcaat
AF369540_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236106_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF157291_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
AB275308_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
AB179747_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
AB205010_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
AB266536_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
AB353765_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
EU498228_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
AB818694_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
HM066946_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
HQ285946_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
KP997512_S_P-H      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
MK568526_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK568532_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236122_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236123_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486592_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN604310_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KM998718_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KM998720_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EU159675_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY090460_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KM998721_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK568522_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK568524_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM117851_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK568534_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK568523_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KM998723_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236131_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236130_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY090457_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91819_S_P-H        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF369543_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB375159_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB375162_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF369541_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF369542_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236120_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MF150696_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB059661_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB059660_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB375164_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF369531_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF369537_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF369538_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF369539_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236101_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236121_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ236125_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KM998719_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KX264501_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY458059_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY458060_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB375161_S_P-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY090454_S_C-H      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91827_S_P-H        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
                    * ***** **** *** ** *** **   *** ******* ************** ** *

JN604202_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattygcagtccccaatctccaatcac
MK568527_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236109_S_P-H      tttctaggggtacctcccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
MF150691_S_P-H      tttctaggggtaccacccgagtgtcctggccaaaattcgcagtccccaatctccaatcac
MF150692_S_P-H      tttctaggggtaccacccgagtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236129_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236126_S_P-H      tttctaggggtaccaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ486375_S_P-H      tttctaggggtaccacccgrgtgtcctggccaaaattcgcagtccccaatctccaatcac
GQ486268_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
MK568533_S_P-H      tctctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KM606705_S_P-H      tttctaggggaaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KM606937_S_P-H      tttctaggggaaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KM998717_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236127_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB059659_S_P-H      tttctagaggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB375163_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236118_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
HM117850_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB353764_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB353766_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KX372218_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KM998722_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KC836829_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB064315_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
JN604203_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
FJ356715_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AF369535_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236102_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AF369545_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236113_S_P-H      tttctaggggtaccacctgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236111_S_P-H      tttctaggggtaccacccgggtgtcctggccaaagttcgcagtccccaatctccaatcac
DQ236112_S_P-H      tttctaggggtaccacccgggtgtcctggccaaagttcgcagtccccaatctccaatcac
DQ236132_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236124_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236114_S_P-H      tttctaggggtacctcccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB375160_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236115_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
MF150695_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
FJ356716_S_C-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AF369536_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AF369540_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236106_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
EF157291_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB275308_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB179747_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB205010_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB266536_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB353765_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
EU498228_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB818694_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
HM066946_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
HQ285946_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KP997512_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
MK568526_S_P-H      tttctaggggtaccacccgggtgtcctggccaaagttcgcagtccccaatctccaatcac
MK568532_S_P-H      tttctaggggtaccacccgggtgtcctggccaaagttcgcagtccccaatctccaatcac
DQ236122_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236123_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
GQ486592_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
JN604310_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KM998718_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KM998720_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
EU159675_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AY090460_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KM998721_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
MK568522_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
MK568524_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
HM117851_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
MK568534_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
MK568523_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KM998723_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236131_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236130_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AY090457_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
U91819_S_P-H        tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AF369543_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB375159_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB375162_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AF369541_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AF369542_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236120_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
MF150696_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB059661_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB059660_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB375164_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AF369531_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AF369537_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AF369538_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AF369539_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236101_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236121_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ236125_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KM998719_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KX264501_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KY458059_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
KY458060_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AB375161_S_P-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
AY090454_S_C-H      tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
U91827_S_P-H        tttctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
                    * ***** ** *** ** * ************** ** *********** **********

JN604202_S_P-H      ttaccaatctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
MK568527_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236109_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
MF150691_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
MF150692_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236129_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236126_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
GQ486375_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
GQ486268_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
MK568533_S_P-H      ttacaaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KM606705_S_P-H      ttaccaatctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KM606937_S_P-H      ttaccaatctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KM998717_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236127_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB059659_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB375163_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236118_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
HM117850_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB353764_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB353766_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KX372218_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KM998722_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KC836829_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB064315_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
JN604203_S_P-H      ttacaaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
FJ356715_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AF369535_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236102_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AF369545_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236113_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236111_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236112_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236132_S_P-H      ttaccaatctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236124_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236114_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB375160_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgtcggatgtgtctgcggcgtttt
DQ236115_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgtcggatgtgtctgcggcgtttt
MF150695_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
FJ356716_S_C-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AF369536_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AF369540_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236106_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF157291_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB275308_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB179747_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB205010_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB266536_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB353765_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EU498228_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB818694_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
HM066946_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
HQ285946_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KP997512_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
MK568526_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
MK568532_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236122_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236123_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
GQ486592_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
JN604310_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KM998718_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KM998720_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EU159675_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AY090460_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KM998721_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
MK568522_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
MK568524_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
HM117851_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
MK568534_S_P-H      ttaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
MK568523_S_P-H      ttaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KM998723_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236131_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236130_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AY090457_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
U91819_S_P-H        ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AF369543_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB375159_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB375162_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AF369541_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AF369542_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236120_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
MF150696_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB059661_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB059660_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB375164_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AF369531_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AF369537_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AF369538_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AF369539_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236101_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236121_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ236125_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KM998719_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KX264501_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KY458059_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KY458060_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AB375161_S_P-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AY090454_S_C-H      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
U91827_S_P-H        ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
                    **** ** *** *************************** ********************

JN604202_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
MK568527_S_P-H      accatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236109_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
MF150691_S_P-H      atcatctccctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
MF150692_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236129_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236126_S_P-H      atcatcttcctcttcaccctgctgctatgcctcatcttcttgttggttcttctggactat
GQ486375_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
GQ486268_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
MK568533_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KM606705_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KM606937_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KM998717_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236127_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactat
AB059659_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB375163_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236118_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
HM117850_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB353764_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB353766_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KX372218_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KM998722_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactat
KC836829_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB064315_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JN604203_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
FJ356715_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF369535_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236102_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF369545_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236113_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236111_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236112_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236132_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236124_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236114_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB375160_S_P-H      atcatcttcctcttcatcctgctgctaggcctcatcttcttgttggttcttctggactat
DQ236115_S_P-H      atcatcttcctcttcatcctgctgctaggcctcatcttcttgttggttcttctggactat
MF150695_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
FJ356716_S_C-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF369536_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF369540_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236106_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
EF157291_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB275308_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB179747_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB205010_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB266536_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB353765_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
EU498228_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB818694_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
HM066946_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
HQ285946_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KP997512_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
MK568526_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
MK568532_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236122_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236123_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
GQ486592_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JN604310_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KM998718_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KM998720_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
EU159675_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AY090460_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KM998721_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
MK568522_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
MK568524_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
HM117851_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
MK568534_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatctccttgttggttcttctggactat
MK568523_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KM998723_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236131_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236130_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AY090457_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
U91819_S_P-H        atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF369543_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB375159_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB375162_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF369541_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF369542_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236120_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
MF150696_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB059661_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB059660_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB375164_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF369531_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF369537_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF369538_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF369539_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236101_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236121_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236125_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KM998719_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KX264501_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KY458059_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KY458060_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB375161_S_P-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AY090454_S_C-H      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
U91827_S_P-H        atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
                    * ***** ******** ********** ********* ******** **** ********

JN604202_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
MK568527_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
DQ236109_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
MF150691_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
MF150692_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
DQ236129_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcttcaaccaccagcacgggaccc
DQ236126_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
GQ486375_S_P-H      caaggtatgttgcccgtatgtcctctacttccaggatctacgaccaccagcacgggaccc
GQ486268_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatccacgaccaccagcacgggaccc
MK568533_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
KM606705_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatccacaaccaccagcacgggaccc
KM606937_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatccacaaccaccagcacgggaccc
KM998717_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaaccaccagcacgggaccc
DQ236127_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacgaccaccagcacgggaccc
AB059659_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB375163_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaaccaccagcacgggaccc
DQ236118_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaaccaccagcacgggaccc
HM117850_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB353764_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB353766_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
KX372218_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaactaccagcacgggaccc
KM998722_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
KC836829_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB064315_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcttcaaccaccagcacgggaccc
JN604203_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
FJ356715_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AF369535_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcatcaaccaccagcacgggaccc
DQ236102_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcatcaaccaccagcacgggaccc
AF369545_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
DQ236113_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaaccaccagcacgggaccc
DQ236111_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaaccaccagcacgggaccc
DQ236112_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaaccaccagcacgggaccc
DQ236132_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
DQ236124_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
DQ236114_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB375160_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
DQ236115_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
MF150695_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
FJ356716_S_C-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaaccaccagcacgggaccc
AF369536_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AF369540_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
DQ236106_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
EF157291_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB275308_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB179747_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcwacaaccaccagcacgggaccc
AB205010_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB266536_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB353765_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
EU498228_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB818694_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
HM066946_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
HQ285946_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
KP997512_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
MK568526_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaaccaccagcacgggaccc
MK568532_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaaccaccagcacgggaccc
DQ236122_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaactaccagcacgggaccc
DQ236123_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaaccaccagcacgggaccc
GQ486592_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaaccaccagcacgggaccc
JN604310_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaaccaccagcacgggaccc
KM998718_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatcaacaaccaccagcacgggaccc
KM998720_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
EU159675_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AY090460_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
KM998721_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
MK568522_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
MK568524_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
HM117851_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
MK568534_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
MK568523_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
KM998723_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
DQ236131_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
DQ236130_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AY090457_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggtccc
U91819_S_P-H        caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggtccc
AF369543_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB375159_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB375162_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AF369541_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AF369542_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
DQ236120_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
MF150696_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB059661_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB059660_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB375164_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AF369531_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AF369537_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AF369538_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AF369539_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
DQ236101_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
DQ236121_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
DQ236125_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
KM998719_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
KX264501_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
KY458059_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
KY458060_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AB375161_S_P-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
AY090454_S_C-H      caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
U91827_S_P-H        caaggtatgttgcccgtgtgtcctctacttccaggatctacaaccaccagcacgggaccc
                    ***************** ********************  * ** *********** ***

JN604202_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
MK568527_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaca
DQ236109_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctggtgctgtacc
MF150691_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaca
MF150692_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaca
DQ236129_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatggttccctcctgctgctgtacc
DQ236126_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
GQ486375_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
GQ486268_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
MK568533_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
KM606705_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
KM606937_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
KM998717_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236127_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB059659_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB375163_S_P-H      tgcaaaacctgcaccactcytgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236118_S_P-H      tgcaaaacctgcaccactcytgctcaaggaacctctatgtttccctcctgctgctgtacc
HM117850_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB353764_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB353766_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
KX372218_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaca
KM998722_S_P-H      tgcagaacctgcaccactcttgctcaaggaacctctatgtttccctcatgctgctgtacc
KC836829_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB064315_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
JN604203_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
FJ356715_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcttgctgctgtacc
AF369535_S_P-H      tgcaaaacctgcacgactcttgctcaaggaacctctatgtatccctcatgctgctgtacc
DQ236102_S_P-H      tgcaaaacctgcacgactcttgctcaaggaacctctatgtatccctcatgctgctgtacc
AF369545_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236113_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236111_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaca
DQ236112_S_P-H      tgcaaaacctgcaccactcttgctcaaggaaactctatgtttccctcctgctgctgtacc
DQ236132_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236124_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236114_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgttaccctcctgctgctgtacc
AB375160_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236115_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
MF150695_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
FJ356716_S_C-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcttgctgctgtacc
AF369536_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AF369540_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236106_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
EF157291_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB275308_S_P-H      tgcaaaacctgcaccactcttgctcaaggaccctctatgtttccctcctgctgctgtacc
AB179747_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB205010_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB266536_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB353765_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
EU498228_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB818694_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgttgtacc
HM066946_S_P-H      tgcaagacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
HQ285946_S_P-H      tgcaagacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
KP997512_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
MK568526_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
MK568532_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236122_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236123_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
GQ486592_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
JN604310_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
KM998718_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
KM998720_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcttgctgctgtacc
EU159675_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcttgctgctgtacc
AY090460_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcttgctgctgtacc
KM998721_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcttgctgctgtacc
MK568522_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcttgctgctgtacc
MK568524_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcttgctgctgtacc
HM117851_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtata
MK568534_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
MK568523_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
KM998723_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236131_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236130_S_P-H      tgcaaaacctgcacctctcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AY090457_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
U91819_S_P-H        tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AF369543_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB375159_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB375162_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AF369541_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AF369542_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236120_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
MF150696_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB059661_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB059660_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgttgctgtacc
AB375164_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AF369531_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AF369537_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AF369538_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AF369539_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236101_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236121_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
DQ236125_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
KM998719_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
KX264501_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
KY458059_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
KY458060_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AB375161_S_P-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
AY090454_S_C-H      tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
U91827_S_P-H        tgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtacc
                    ****  ********  *** **********  *******   ***** ** ** ****  

JN604202_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttaggaaat
MK568527_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcgtcttgggctttcggaaaa
DQ236109_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
MF150691_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
MF150692_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236129_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236126_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
GQ486375_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
GQ486268_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
MK568533_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KM606705_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KM606937_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KM998717_S_P-H      aaaccttcggacggaaattgcacctgtaytcccatcccatcatcttgggctttcggaaaa
DQ236127_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB059659_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB375163_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236118_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
HM117850_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB353764_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB353766_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KX372218_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcgtcttgggctttcggaaaa
KM998722_S_P-H      aaaccttcggaaggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KC836829_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB064315_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
JN604203_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
FJ356715_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AF369535_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236102_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AF369545_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236113_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttttcggaaa
DQ236111_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttttgtaaaa
DQ236112_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttttgtaaaa
DQ236132_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236124_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236114_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB375160_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236115_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
MF150695_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
FJ356716_S_C-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AF369536_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AF369540_S_P-H      aaaccttcggatggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236106_S_P-H      aaaccttcggatggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
EF157291_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcgtcttgggctttcggaaaa
AB275308_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB179747_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB205010_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB266536_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB353765_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
EU498228_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB818694_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
HM066946_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
HQ285946_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KP997512_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
MK568526_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
MK568532_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236122_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236123_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
GQ486592_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
JN604310_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KM998718_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KM998720_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
EU159675_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccgtcatcttgggctttcggaaaa
AY090460_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KM998721_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
MK568522_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
MK568524_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
HM117851_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
MK568534_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
MK568523_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KM998723_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236131_S_P-H      aaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236130_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AY090457_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
U91819_S_P-H        aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AF369543_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB375159_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB375162_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AF369541_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AF369542_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236120_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
MF150696_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB059661_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB059660_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB375164_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AF369531_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AF369537_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AF369538_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AF369539_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236101_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236121_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
DQ236125_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KM998719_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KX264501_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KY458059_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
KY458060_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AB375161_S_P-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
AY090454_S_C-H      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
U91827_S_P-H        aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
                    ***** ***** **************** ********* ** ***********    ** 

JN604202_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
MK568527_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236109_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgct
MF150691_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
MF150692_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236129_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236126_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
GQ486375_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
GQ486268_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
MK568533_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KM606705_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KM606937_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KM998717_S_P-H      tacctatgggggtgggcctcagcccgtttcttttggctcagtttactagtgccatttgtt
DQ236127_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AB059659_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AB375163_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
DQ236118_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
HM117850_S_P-H      tacctatgggactgggcctcagcccgtttctcatggctcagtttactagtgcaatttgtt
AB353764_S_P-H      tacctatgggattgggcctcagcccgtttctcatggctcagtttactagtgcaatttgtt
AB353766_S_P-H      tacctatgggattgggcctcagcccgtttctcatggctcagtttactagtgcaatttgtt
KX372218_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KM998722_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KC836829_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AB064315_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
JN604203_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
FJ356715_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AF369535_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236102_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AF369545_S_P-H      tccctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236113_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236111_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236112_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236132_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236124_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236114_S_P-H      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcaatttgtt
AB375160_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagcgcaatttgct
DQ236115_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagcgcaatttgct
MF150695_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
FJ356716_S_C-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AF369536_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AF369540_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236106_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
EF157291_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AB275308_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AB179747_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AB205010_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AB266536_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AB353765_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
EU498228_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AB818694_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
HM066946_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
HQ285946_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KP997512_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
MK568526_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
MK568532_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236122_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236123_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
GQ486592_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
JN604310_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KM998718_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KM998720_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcactttgtt
EU159675_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AY090460_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KM998721_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
MK568522_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
MK568524_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
HM117851_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
MK568534_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
MK568523_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KM998723_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236131_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236130_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AY090457_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
U91819_S_P-H        tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AF369543_S_P-H      ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgct
AB375159_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgct
AB375162_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgct
AF369541_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgct
AF369542_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgct
DQ236120_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgct
MF150696_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgct
AB059661_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AB059660_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AB375164_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AF369531_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AF369537_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AF369538_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AF369539_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236101_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236121_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
DQ236125_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KM998719_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KX264501_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KY458059_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
KY458060_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AB375161_S_P-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
AY090454_S_C-H      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
U91827_S_P-H        tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgtt
                    * ********  ********** ********  **************** **  **** *

JN604202_S_P-H      cagtggtgcgtagggctttcccccattgtctggcctttagttatatggatgatttggtat
MK568527_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236109_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagctatatggatgatgtggtat
MF150691_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
MF150692_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236129_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236126_S_P-H      cagtggtgcgtagggctttcccccactgcctggctttcagttatatggatgatttggtat
GQ486375_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
GQ486268_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
MK568533_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KM606705_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KM606937_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KM998717_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236127_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AB059659_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AB375163_S_P-H      cagtggtgcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
DQ236118_S_P-H      cagtggtgcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
HM117850_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatgtggatgatttggtat
AB353764_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttggttatgtggatgatctggtat
AB353766_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatgtggatgatctggtat
KX372218_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KM998722_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KC836829_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatctggtat
AB064315_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
JN604203_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
FJ356715_S_P-H      cagtggtgcgtagggctttcccccactgtttggcttttagttatatggatgatttggtat
AF369535_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236102_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AF369545_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236113_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236111_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236112_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236132_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236124_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236114_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AB375160_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236115_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
MF150695_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
FJ356716_S_C-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AF369536_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AF369540_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236106_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
EF157291_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatctggtat
AB275308_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatctggtat
AB179747_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatctggtat
AB205010_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatctggtat
AB266536_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatctggtat
AB353765_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatctggtat
EU498228_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatctggtat
AB818694_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatctggtat
HM066946_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
HQ285946_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KP997512_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
MK568526_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
MK568532_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236122_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236123_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
GQ486592_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
JN604310_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KM998718_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KM998720_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
EU159675_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AY090460_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KM998721_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
MK568522_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
MK568524_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
HM117851_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
MK568534_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
MK568523_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KM998723_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236131_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236130_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AY090457_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
U91819_S_P-H        cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AF369543_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AB375159_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AB375162_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AF369541_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AF369542_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236120_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
MF150696_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AB059661_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AB059660_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AB375164_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AF369531_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AF369537_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AF369538_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AF369539_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236101_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236121_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
DQ236125_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KM998719_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KX264501_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KY458059_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
KY458060_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AB375161_S_P-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
AY090454_S_C-H      cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
U91827_S_P-H        cagtggtgcgtagggctttcccccactgtctggcttttagttatatggatgatttggtat
                    ************************* **  **** **  * *** ******** ******

JN604202_S_P-H      tgggggccaaatctgtgcaacatcttgagtccctttataccgctgttaccaattttttgt
MK568527_S_P-H      tgggggccaaatctgtacatcatcttgagtccctttataccgctgttaccaattttttgt
DQ236109_S_P-H      tgggggccaagtctgtgcagcatcctgagtccctttataccgctgttaccaattttctgt
MF150691_S_P-H      tgggggccaaatctgtgcagcaccttgaggccatttataccgctgttaccaattttttgt
MF150692_S_P-H      tgggggctaaatctgtggagcaccttgcgtccctttataccgctgttaccaattttttgt
DQ236129_S_P-H      tgggggccaaatctgtgcaacatctggagtccctttataccgctgttaccaattttttgt
DQ236126_S_P-H      tgggggccaaatctgcacaccatcttgagtccctttataccgctgttaccaattttttgt
GQ486375_S_P-H      tgggggccaaatctgtgcarcatcttgagtccatttataccgctgttaccaattttttgt
GQ486268_S_P-H      tgggggccaaatctgtacagcaccttgagtccctttataccgctgttaccaattttttgt
MK568533_S_P-H      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttttgt
KM606705_S_P-H      tgggggccaaatctgtgcagcatcttgaggccctttataccgctgttaccaattttttgt
KM606937_S_P-H      tgggggccaaatctgtgcagcatcttgaggccctttataccgctgttaccaatttgttgt
KM998717_S_P-H      tgggggccaaatctgtgcagcatcttgaggccctttataccgctgttaccaattttttgt
DQ236127_S_P-H      tgggggccaaatctgtgcagcatcttgagtccatttataccgctgttaccaattttttgt
AB059659_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB375163_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236118_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
HM117850_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB353764_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB353766_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
KX372218_S_P-H      tgggggccaaatctgtggcgcatcttgagtccctttataccgctgttaccaattttttgt
KM998722_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
KC836829_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttcttt
AB064315_S_P-H      tgggggccaaatctgtgcaacatcttgagtccatttataccgctgttaccaattttttgt
JN604203_S_P-H      tgggggccaaatctgtacagcatcttgagtccctttataccgctgttaccaattttttgt
FJ356715_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AF369535_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236102_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AF369545_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctctaaccaattttttgt
DQ236113_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttctgt
DQ236111_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236112_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236132_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236124_S_P-H      tgggggccaaatctgttcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236114_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB375160_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236115_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
MF150695_S_P-H      tgggggccaaatctgagcaacaccttgagtccctttataccgctgttaccaattttttgt
FJ356716_S_C-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AF369536_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttatactgctgttaccaattttttgt
AF369540_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaatttgttgt
DQ236106_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaatttgttgt
EF157291_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB275308_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB179747_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB205010_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB266536_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB353765_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
EU498228_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB818694_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
HM066946_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
HQ285946_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
KP997512_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
MK568526_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
MK568532_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236122_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236123_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
GQ486592_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
JN604310_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
KM998718_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
KM998720_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
EU159675_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AY090460_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
KM998721_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
MK568522_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
MK568524_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
HM117851_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
MK568534_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
MK568523_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
KM998723_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236131_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236130_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AY090457_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
U91819_S_P-H        tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AF369543_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB375159_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB375162_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AF369541_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AF369542_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236120_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
MF150696_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB059661_S_P-H      tgggggccaaatctgtgcagcatcttgaggccctttataccgctgttaccaattttttgt
AB059660_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB375164_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AF369531_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AF369537_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AF369538_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AF369539_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236101_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236121_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
DQ236125_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
KM998719_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
KX264501_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
KY458059_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
KY458060_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AB375161_S_P-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
AY090454_S_C-H      tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
U91827_S_P-H        tgggggccaaatctgtgcagcatcttgagtccctttataccgctgttaccaattttttgt
                    ******* ** ****     ** *  * * ** ******* *** * ********  * *

JN604202_S_P-H      tatctgtgggcatccatttaa
MK568527_S_P-H      tatctgtgggcatccatttga
DQ236109_S_P-H      tgtctgtgggcatacatttaa
MF150691_S_P-H      tatctgtgggcatccatttaa
MF150692_S_P-H      tatctgtgggcatccatttga
DQ236129_S_P-H      tatctgtgggcatccatttga
DQ236126_S_P-H      tatctgtgggcatccatttga
GQ486375_S_P-H      tatctgtgggcatccatttga
GQ486268_S_P-H      tatctgtgggcatccatttga
MK568533_S_P-H      tatctgtgggcatccatttga
KM606705_S_P-H      tatctgtgggcatccatttga
KM606937_S_P-H      tatctgtgggcatccatttga
KM998717_S_P-H      tatctgtgggcatccatttaa
DQ236127_S_P-H      tatctgtgggcatccatttga
AB059659_S_P-H      tatctgtgggcatccatttga
AB375163_S_P-H      tatctgtgggcatccatttaa
DQ236118_S_P-H      tatctgtgggcatccatttaa
HM117850_S_P-H      tatctgtgggcatccatttga
AB353764_S_P-H      tatctgtgggcatccatttga
AB353766_S_P-H      tatctgtgggcatccatttga
KX372218_S_P-H      tatctgtgggcatccatttga
KM998722_S_P-H      tatctgtgggcatccatttga
KC836829_S_P-H      tgtctttgggtatacatttaa
AB064315_S_P-H      tatctgtgggcatccatttga
JN604203_S_P-H      tatctgtgggcatccatttga
FJ356715_S_P-H      tatctgtgggcatccatttga
AF369535_S_P-H      tatctgtgggcatccatttaa
DQ236102_S_P-H      tatctgtgggcatccatttaa
AF369545_S_P-H      tatctgtgggcatccatttga
DQ236113_S_P-H      tatctgtgggcatccatttaa
DQ236111_S_P-H      tatctgtgggcatccatttaa
DQ236112_S_P-H      tatctgtgggcatccatttaa
DQ236132_S_P-H      tatctgtgggcatccatttga
DQ236124_S_P-H      tatctgtgggcatccatttga
DQ236114_S_P-H      tatctgtgggcatccatttaa
AB375160_S_P-H      tatctgtgggcatccatttga
DQ236115_S_P-H      tatctgtgggcatccatttga
MF150695_S_P-H      tatctgtgggcatccatttga
FJ356716_S_C-H      tatctgtgggcatccatttga
AF369536_S_P-H      tatctgtgggcatccatttga
AF369540_S_P-H      tatctgtgggcatccatttga
DQ236106_S_P-H      tatctgtgggcatccatttga
EF157291_S_P-H      tatctgtgggcatccatttga
AB275308_S_P-H      tatctgtgggcatccatttga
AB179747_S_P-H      tatctgtgggcatccatttga
AB205010_S_P-H      tatctgtgggcatccatttga
AB266536_S_P-H      tatctgtgggcatccatttga
AB353765_S_P-H      tatctgtgggcatccatttga
EU498228_S_P-H      tatctgtgggcatccatttga
AB818694_S_P-H      tatctgtgggcatccatttga
HM066946_S_P-H      tatctgtgggcatccatttga
HQ285946_S_P-H      tatctgtgggcatccatttga
KP997512_S_P-H      tatctgtgggcatccatttga
MK568526_S_P-H      tatctgtgggcatccatttaa
MK568532_S_P-H      tatctgtgggcatccatttaa
DQ236122_S_P-H      tatctgtgggcatccatttaa
DQ236123_S_P-H      tatctgtgggcatccatttaa
GQ486592_S_P-H      tatctgtgggcatccatttaa
JN604310_S_P-H      tatctgtgggcatccatttaa
KM998718_S_P-H      tatctgtgggcatccatttaa
KM998720_S_P-H      tatctgtgggcatccatttga
EU159675_S_P-H      tatctgtgggcatccatttga
AY090460_S_P-H      tatctgtgggcatccatttga
KM998721_S_P-H      tatctgtgggcatccatttga
MK568522_S_P-H      tatctgtgggcatccatttga
MK568524_S_P-H      tatctgtgggcatccatttga
HM117851_S_P-H      tatctgtgggcatccatttga
MK568534_S_P-H      tatctgtgggcatccatttga
MK568523_S_P-H      tatctgtgggcatccatttga
KM998723_S_P-H      tatctgtgggcatccatttga
DQ236131_S_P-H      tatctgtgggcatccatttga
DQ236130_S_P-H      tatctgtgggcatccatttga
AY090457_S_P-H      tatctgtgggcatccatttaa
U91819_S_P-H        tatctgtgggcatccatttaa
AF369543_S_P-H      tatctgtgggcatccatttga
AB375159_S_P-H      tatctgtgggcatccatttga
AB375162_S_P-H      tatctgtgggcatccatttga
AF369541_S_P-H      tatctgtgggcatccatttga
AF369542_S_P-H      tatctgtgggcatccatttga
DQ236120_S_P-H      tatctgtgggcatccatttga
MF150696_S_P-H      tatctgtgggcatccatttga
AB059661_S_P-H      tatctgtgggcatccatttga
AB059660_S_P-H      tatctgtgggcatccatttga
AB375164_S_P-H      tatctgtgggcatccatttga
AF369531_S_P-H      tatctgtgggcatccatttga
AF369537_S_P-H      tatctgtgggcatccatttga
AF369538_S_P-H      tatctgtgggcatccatttga
AF369539_S_P-H      tatctgtgggcatccatttga
DQ236101_S_P-H      tatctgtgggcatccatttga
DQ236121_S_P-H      tatctgtgggcatccatttga
DQ236125_S_P-H      tatctgtgggcatccatttga
KM998719_S_P-H      tatctgtgggcatccatttga
KX264501_S_P-H      tatctgtgggcatccatttga
KY458059_S_P-H      tatctgtgggcatccatttga
KY458060_S_P-H      tatctgtgggcatccatttga
AB375161_S_P-H      tatctgtgggcatccatttra
AY090454_S_C-H      tatctgtgggcatccatttaa
U91827_S_P-H        tatctgtgggcatccatttaa
                    * *** **** ** ***** *

© 1998-2020Legal notice