HBVdb

Dataset for nucleotide sequence PreS2 of genotype H

[Download (right click)] [Edit] [Sequences] [Repertoires]

40 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


MK568527_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcacttttggatacgagagt
JN604202_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgaaagt
MK568533_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AB064315_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgctggatccgagagt
AB059659_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttagatccgagagt
AB353764_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AB179747_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AB205010_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AB275308_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
EF157291_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AB266536_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
EU498228_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AB818694_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
JN604203_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
FJ356715_PreS2_P-H      atgcagtggaactcaatacagttccaccaagcactgttggatccgagagt
AB375163_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggacccgagagt
HM117850_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
HM066946_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
HQ285946_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AY090457_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AB375160_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
JN604310_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggacccgagagt
MK568526_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggacccgagagt
MK568532_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggacccgagagt
AY090454_PreS2_C-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
MK568523_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
MK568534_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
FJ356716_PreS2_C-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AB059660_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AB375161_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
HM117851_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AB375159_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AB375162_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AB059661_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AB375164_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
KX264501_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
EU159675_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
AY090460_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
MK568522_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
MK568524_PreS2_P-H      atgcagtggaactcaacacagttccaccaagcactgttggatccgagagt
                        **************** ******************  * **  *** ***

MK568527_PreS2_P-H      aaagggtctgtatcttcctgctggtggctccagttcagaaacacagaacc
JN604202_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
MK568533_PreS2_P-H      gaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
AB064315_PreS2_P-H      aagggg---------tcctgctggtggctccagttcagaaacacagaacc
AB059659_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
AB353764_PreS2_P-H      aagggggctgtattttcctgctggtggctccagttcagaaacacagaacc
AB179747_PreS2_P-H      aagggggctgtattttcctgctggtggctccagttcagaaacacagaacc
AB205010_PreS2_P-H      aagggggctgtatcttcctgctggtggctccagttcagaaacacagaacc
AB275308_PreS2_P-H      aagggggctgtattttcctgctggtggctccagttcagaaacacagaacc
EF157291_PreS2_P-H      aagggggctgtattttcctgctggtggctccagttcagaaacacagaacc
AB266536_PreS2_P-H      aagggggctgtattttcctgctggtggctccagttcagaaacacagaacc
EU498228_PreS2_P-H      aagggggctgtattttcctgctggtggctccagttcagaaacacagaacc
AB818694_PreS2_P-H      aagggggctgtattttcctgctggtggctccagttcagaaacacagaacc
JN604203_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
FJ356715_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
AB375163_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
HM117850_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacaaaacc
HM066946_PreS2_P-H      gaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
HQ285946_PreS2_P-H      gaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
AY090457_PreS2_P-H      aaggggtctgtatcttcctgctggtggctccagttcagaaacacagaacc
AB375160_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
JN604310_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
MK568526_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
MK568532_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
AY090454_PreS2_C-H      caggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
MK568523_PreS2_P-H      aagggctctgtattttcctgctggtggctccagttcagaaacacagaacc
MK568534_PreS2_P-H      aagggctctgtattttcctgctggtggctccagttcagaaacacagaacc
FJ356716_PreS2_C-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
AB059660_PreS2_P-H      aaggggtctgtatcttcctgctggtggctccagttcagaaacacagaacc
AB375161_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
HM117851_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
AB375159_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
AB375162_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
AB059661_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
AB375164_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
KX264501_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
EU159675_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
AY090460_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
MK568522_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
MK568524_PreS2_P-H      aaggggtctgtattttcctgctggtggctccagttcagaaacacagaacc
                         * **          ****************************** ****

MK568527_PreS2_P-H      ctgctccgactattgcctctcacacatcatcaatcttatcgacgactggg
JN604202_PreS2_P-H      ctgctccgactattgtctctctcacatcgtcaatcttctcgaagactggg
MK568533_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB064315_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB059659_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB353764_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB179747_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB205010_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB275308_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
EF157291_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB266536_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
EU498228_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB818694_PreS2_P-H      ctgcgccgactattgcctctctcacatcatcaatcttctcgaagactggg
JN604203_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
FJ356715_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB375163_PreS2_P-H      ctgctccgactattgtctctctcacatcatcaatcttctcgaagactggg
HM117850_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
HM066946_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
HQ285946_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AY090457_PreS2_P-H      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB375160_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
JN604310_PreS2_P-H      ctgctccgactattgtctctctcacatcatcaatcttctcgaagactggg
MK568526_PreS2_P-H      ctgctccgactattgtctctctcacatcatcaatcttctcgaagactggg
MK568532_PreS2_P-H      ctgctccgactattgtctctctcacatcatcaatcttctcgaagactggg
AY090454_PreS2_C-H      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
MK568523_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MK568534_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
FJ356716_PreS2_C-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB059660_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB375161_PreS2_P-H      ctgctccgactattgtctctctcacatcatcaatcttctcgaagactggg
HM117851_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB375159_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB375162_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB059661_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB375164_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KX264501_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
EU159675_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AY090460_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MK568522_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MK568524_PreS2_P-H      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
                        ***  ********** ***** ****** ******** **** *******

MK568527_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcccaggactccg
JN604202_PreS2_P-H      gatcctgctatgaacatgaagaacatcacatcaggactcctaggacccct
MK568533_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB064315_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB059659_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB353764_PreS2_P-H      gaccctgttatgaacatggagaacatcacatcaggactcctaggacccct
AB179747_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB205010_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB275308_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
EF157291_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB266536_PreS2_P-H      gaccctgttatgaacatggagaacatcacatcaggactcctaggacccct
EU498228_PreS2_P-H      gaccctgttatgaacatggagaacatcacatcaggactcctaggacccct
AB818694_PreS2_P-H      gaccctgttatgaacatggagaacatcacatcaggactcctaggacccct
JN604203_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
FJ356715_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB375163_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
HM117850_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
HM066946_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
HQ285946_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AY090457_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB375160_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
JN604310_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
MK568526_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
MK568532_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AY090454_PreS2_C-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
MK568523_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
MK568534_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
FJ356716_PreS2_C-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB059660_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB375161_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
HM117851_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB375159_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB375162_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB059661_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB375164_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
KX264501_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
EU159675_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AY090460_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaagacccct
MK568522_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
MK568524_PreS2_P-H      gaccctgctatgaacatggagaacatcacatcaggactcctaggacccct
                        ** **** ********** ********************* * *** ** 

MK568527_PreS2_P-H      tctcgtgttacaggcggtgtgtttctggttgacaaaaatccgcacaatgc
JN604202_PreS2_P-H      tctcgtgttacaggcggtgtttttctcgttgacaaaaatcctcacaatac
MK568533_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgcaaaatac
AB064315_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB059659_PreS2_P-H      tcccgtgttacagggggtgtttttctcgttgacaaaaatcctcacaatac
AB353764_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB179747_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB205010_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB275308_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
EF157291_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB266536_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
EU498228_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB818694_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN604203_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcckcacaatac
FJ356715_PreS2_P-H      tctcgtgttacaggcggtgtttttcttgttgacaaaagtcctcacaatac
AB375163_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM117850_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM066946_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HQ285946_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AY090457_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB375160_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN604310_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MK568526_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MK568532_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AY090454_PreS2_C-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MK568523_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MK568534_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ356716_PreS2_C-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgcacaatac
AB059660_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB375161_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM117851_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB375159_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB375162_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB059661_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB375164_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KX264501_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
EU159675_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AY090460_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MK568522_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MK568524_PreS2_P-H      tctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
                        ** *********** ***** ***** ********** *** ** *** *

MK568527_PreS2_P-H      caaagaggctagactcgtggtggacttctctcaattttctaggggtacca
JN604202_PreS2_P-H      cccagagtctagactcgtggtggacttctctcaattttctaggggtacca
MK568533_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattctctaggggtacca
AB064315_PreS2_P-H      cacggagtctagactcgtggtggacttctctcaattttctaggggtacca
AB059659_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctagaggtacca
AB353764_PreS2_P-H      caaagagtctagactcgtggtggacttctctcaattttctaggggtacca
AB179747_PreS2_P-H      caaagagtctagactcgtggtggacttctctcaattttctaggggtacca
AB205010_PreS2_P-H      caaagagtctagactcgtggtggacttctctcaattttctaggggtacca
AB275308_PreS2_P-H      caaagagtctagactcgtggtggacttctctcaattttctaggggtacca
EF157291_PreS2_P-H      caaagagtctagactcgtggtggacttctctcaattttctaggggtacca
AB266536_PreS2_P-H      caaagagtctagactcgtggtggacttctctcaattttctaggggtacca
EU498228_PreS2_P-H      caaagagtctagactcgtggtggacttctctcaattttctaggggtacca
AB818694_PreS2_P-H      caaagagtctagactcgtggtggacttctctcaattttctaggggtacca
JN604203_PreS2_P-H      caaagagtctagactcgtggtggacttctctcaattttctaggggtacca
FJ356715_PreS2_P-H      caaagagtctagactcgtggtggacttctctcaattttctaggggtacca
AB375163_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
HM117850_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
HM066946_PreS2_P-H      caaagagtctagactcgtggtggacttctctcaattttctaggggtacca
HQ285946_PreS2_P-H      caaagagtctagactcgtggtggacttctctcaattttctaggggtacca
AY090457_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
AB375160_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
JN604310_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
MK568526_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
MK568532_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
AY090454_PreS2_C-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
MK568523_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
MK568534_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
FJ356716_PreS2_C-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
AB059660_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
AB375161_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
HM117851_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
AB375159_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
AB375162_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
AB059661_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
AB375164_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
KX264501_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
EU159675_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
AY090460_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
MK568522_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
MK568524_PreS2_P-H      cacagagtctagactcgtggtggacttctctcaattttctaggggtacca
                        *   *** **************************** ***** *******

MK568527_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
JN604202_PreS2_P-H      cccgggtgtcctggccaaaattygcagtccccaatctccaatcacttacc
MK568533_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttaca
AB064315_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB059659_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB353764_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB179747_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB205010_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB275308_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
EF157291_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB266536_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
EU498228_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB818694_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
JN604203_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaca
FJ356715_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB375163_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
HM117850_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
HM066946_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
HQ285946_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AY090457_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB375160_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
JN604310_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
MK568526_PreS2_P-H      cccgggtgtcctggccaaagttcgcagtccccaatctccaatcacttacc
MK568532_PreS2_P-H      cccgggtgtcctggccaaagttcgcagtccccaatctccaatcacttacc
AY090454_PreS2_C-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
MK568523_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
MK568534_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
FJ356716_PreS2_C-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB059660_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB375161_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
HM117851_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB375159_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB375162_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB059661_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AB375164_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
KX264501_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
EU159675_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
AY090460_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
MK568522_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
MK568524_PreS2_P-H      cccgggtgtcctggccaaaattcgcagtccccaatctccaatcacttacc
                        ******************* ** *********** ************** 

MK568527_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JN604202_PreS2_P-H      aatctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MK568533_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB064315_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB059659_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB353764_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB179747_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB205010_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB275308_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
EF157291_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB266536_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
EU498228_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB818694_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JN604203_PreS2_P-H      aacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
FJ356715_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB375163_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
HM117850_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
HM066946_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
HQ285946_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AY090457_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB375160_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgtcggatgtgtctgcggc
JN604310_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MK568526_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MK568532_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AY090454_PreS2_C-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MK568523_PreS2_P-H      aacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MK568534_PreS2_P-H      aacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
FJ356716_PreS2_C-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB059660_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB375161_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
HM117851_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB375159_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB375162_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB059661_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB375164_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KX264501_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
EU159675_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AY090460_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MK568522_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MK568524_PreS2_P-H      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
                        ** *** *************************** ***************

MK568527_PreS2_P-H      gttttaccatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN604202_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MK568533_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB064315_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB059659_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB353764_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB179747_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB205010_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB275308_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
EF157291_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB266536_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
EU498228_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB818694_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN604203_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ356715_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB375163_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM117850_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM066946_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HQ285946_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AY090457_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB375160_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctaggcctcatcttcttgttg
JN604310_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MK568526_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MK568532_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AY090454_PreS2_C-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MK568523_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MK568534_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatctccttgttg
FJ356716_PreS2_C-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB059660_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB375161_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM117851_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB375159_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB375162_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB059661_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB375164_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KX264501_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
EU159675_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AY090460_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MK568522_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MK568524_PreS2_P-H      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
                        ****** ************************* ********* *******

MK568527_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
JN604202_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
MK568533_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB064315_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB059659_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB353764_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB179747_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB205010_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB275308_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
EF157291_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB266536_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
EU498228_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB818694_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
JN604203_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
FJ356715_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB375163_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
HM117850_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
HM066946_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
HQ285946_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AY090457_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB375160_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
JN604310_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
MK568526_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
MK568532_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AY090454_PreS2_C-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
MK568523_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
MK568534_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
FJ356716_PreS2_C-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB059660_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB375161_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
HM117851_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB375159_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB375162_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB059661_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AB375164_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
KX264501_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
EU159675_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
AY090460_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
MK568522_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
MK568524_PreS2_P-H      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
                        **************************************************

MK568527_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
JN604202_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
MK568533_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB064315_PreS2_P-H      atcttcaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB059659_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB353764_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB179747_PreS2_P-H      atcwacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB205010_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB275308_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
EF157291_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB266536_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
EU498228_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB818694_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
JN604203_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
FJ356715_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB375163_PreS2_P-H      atcaacaaccaccagcacgggaccctgcaaaacctgcaccactcytgctc
HM117850_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
HM066946_PreS2_P-H      atctacaaccaccagcacgggaccctgcaagacctgcaccactcttgctc
HQ285946_PreS2_P-H      atctacaaccaccagcacgggaccctgcaagacctgcaccactcttgctc
AY090457_PreS2_P-H      atctacaaccaccagcacgggtccctgcaaaacctgcaccactcttgctc
AB375160_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
JN604310_PreS2_P-H      atcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
MK568526_PreS2_P-H      atcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
MK568532_PreS2_P-H      atcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AY090454_PreS2_C-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
MK568523_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
MK568534_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
FJ356716_PreS2_C-H      atcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB059660_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB375161_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
HM117851_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB375159_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB375162_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB059661_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AB375164_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
KX264501_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
EU159675_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
AY090460_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
MK568522_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
MK568524_PreS2_P-H      atctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctc
                        ***  **************** ******** ************* *****

MK568527_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtacaaaaccttcggacgga
JN604202_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
MK568533_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AB064315_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AB059659_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AB353764_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AB179747_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AB205010_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AB275308_PreS2_P-H      aaggaccctctatgtttccctcctgctgctgtaccaaaccttcggacgga
EF157291_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AB266536_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
EU498228_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AB818694_PreS2_P-H      aaggaacctctatgtttccctcctgctgttgtaccaaaccttcggacgga
JN604203_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
FJ356715_PreS2_P-H      aaggaacctctatgtttccctcttgctgctgtaccaaaccttcggacgga
AB375163_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
HM117850_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
HM066946_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
HQ285946_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AY090457_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AB375160_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
JN604310_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
MK568526_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
MK568532_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AY090454_PreS2_C-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
MK568523_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
MK568534_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
FJ356716_PreS2_C-H      aaggaacctctatgtttccctcttgctgctgtaccaaaccttcggacgga
AB059660_PreS2_P-H      aaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacgga
AB375161_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
HM117851_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtataaaaccttcggacgga
AB375159_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AB375162_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AB059661_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
AB375164_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
KX264501_PreS2_P-H      aaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacgga
EU159675_PreS2_P-H      aaggaacctctatgtttccctcttgctgctgtaccaaaccttcggacgga
AY090460_PreS2_P-H      aaggaacctctatgtttccctcttgctgctgtaccaaaccttcggacgga
MK568522_PreS2_P-H      aaggaacctctatgtttccctcttgctgctgtaccaaaccttcggacgga
MK568524_PreS2_P-H      aaggaacctctatgtttccctcttgctgctgtaccaaaccttcggacgga
                        ***** **************** ** ** ****  ***************

MK568527_PreS2_P-H      aattgcacctgtattcccatcccatcgtcttgggctttcggaaaatacct
JN604202_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttaggaaattacct
MK568533_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB064315_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB059659_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB353764_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB179747_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB205010_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB275308_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
EF157291_PreS2_P-H      aattgcacctgtattcccatcccatcgtcttgggctttcggaaaatacct
AB266536_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
EU498228_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB818694_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
JN604203_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
FJ356715_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB375163_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
HM117850_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
HM066946_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
HQ285946_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AY090457_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB375160_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
JN604310_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
MK568526_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
MK568532_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AY090454_PreS2_C-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
MK568523_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
MK568534_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
FJ356716_PreS2_C-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB059660_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB375161_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
HM117851_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB375159_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB375162_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB059661_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
AB375164_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
KX264501_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
EU159675_PreS2_P-H      aattgcacctgtattcccatcccgtcatcttgggctttcggaaaatacct
AY090460_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
MK568522_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
MK568524_PreS2_P-H      aattgcacctgtattcccatcccatcatcttgggctttcggaaaatacct
                        *********************** ** *********** ***** *****

MK568527_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
JN604202_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
MK568533_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB064315_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB059659_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB353764_PreS2_P-H      atgggattgggcctcagcccgtttctcatggctcagtttactagtgcaat
AB179747_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB205010_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB275308_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
EF157291_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB266536_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
EU498228_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB818694_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
JN604203_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
FJ356715_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB375163_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgccat
HM117850_PreS2_P-H      atgggactgggcctcagcccgtttctcatggctcagtttactagtgcaat
HM066946_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
HQ285946_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AY090457_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB375160_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagcgcaat
JN604310_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
MK568526_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
MK568532_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AY090454_PreS2_C-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
MK568523_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
MK568534_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
FJ356716_PreS2_C-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB059660_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB375161_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
HM117851_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB375159_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB375162_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB059661_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AB375164_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
KX264501_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
EU159675_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
AY090460_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
MK568522_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
MK568524_PreS2_P-H      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaat
                        ****** ******************** **************** ** **

MK568527_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
JN604202_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccattgtctggcctttagttata
MK568533_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB064315_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB059659_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB353764_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttggttatg
AB179747_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB205010_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB275308_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
EF157291_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB266536_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
EU498228_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB818694_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
JN604203_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
FJ356715_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtttggcttttagttata
AB375163_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggctttcagctata
HM117850_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttatg
HM066946_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
HQ285946_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AY090457_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB375160_PreS2_P-H      ttgctcagtggtgcgtagggctttcccccactgtctggcttttagttata
JN604310_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
MK568526_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
MK568532_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AY090454_PreS2_C-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
MK568523_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
MK568534_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
FJ356716_PreS2_C-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB059660_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB375161_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
HM117851_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB375159_PreS2_P-H      ttgctcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB375162_PreS2_P-H      ttgctcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB059661_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AB375164_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
KX264501_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
EU159675_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
AY090460_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
MK568522_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
MK568524_PreS2_P-H      ttgttcagtggtgcgtagggctttcccccactgtctggcttttagttata
                        *** ************************** *** **** **  * *** 

MK568527_PreS2_P-H      tggatgatttggtattgggggccaaatctgtacatcatcttgagtccctt
JN604202_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcaacatcttgagtccctt
MK568533_PreS2_P-H      tggatgatttggtattgggggccaaatctgtacaacatcttgagtccctt
AB064315_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcaacatcttgagtccatt
AB059659_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
AB353764_PreS2_P-H      tggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
AB179747_PreS2_P-H      tggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
AB205010_PreS2_P-H      tggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
AB275308_PreS2_P-H      tggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
EF157291_PreS2_P-H      tggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
AB266536_PreS2_P-H      tggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
EU498228_PreS2_P-H      tggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
AB818694_PreS2_P-H      tggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
JN604203_PreS2_P-H      tggatgatttggtattgggggccaaatctgtacagcatcttgagtccctt
FJ356715_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
AB375163_PreS2_P-H      tggatgatgtggtattgggggccaaatctgtgcagcatcttgagtccctt
HM117850_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
HM066946_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
HQ285946_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
AY090457_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
AB375160_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
JN604310_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
MK568526_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
MK568532_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
AY090454_PreS2_C-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
MK568523_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
MK568534_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
FJ356716_PreS2_C-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
AB059660_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
AB375161_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
HM117851_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
AB375159_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
AB375162_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
AB059661_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgaggccctt
AB375164_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
KX264501_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
EU159675_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
AY090460_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
MK568522_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
MK568524_PreS2_P-H      tggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
                        ******** ********************** ** ********* ** **

MK568527_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
JN604202_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttaa
MK568533_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB064315_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB059659_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB353764_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB179747_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB205010_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB275308_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
EF157291_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB266536_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
EU498228_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB818694_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
JN604203_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
FJ356715_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB375163_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttaa
HM117850_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
HM066946_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
HQ285946_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AY090457_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttaa
AB375160_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
JN604310_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttaa
MK568526_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttaa
MK568532_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttaa
AY090454_PreS2_C-H      tataccgctgttaccaattttttgttatctgtgggcatccatttaa
MK568523_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
MK568534_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
FJ356716_PreS2_C-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB059660_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB375161_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttra
HM117851_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB375159_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB375162_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB059661_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AB375164_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
KX264501_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
EU159675_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
AY090460_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
MK568522_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
MK568524_PreS2_P-H      tataccgctgttaccaattttttgttatctgtgggcatccatttga
                        ******************************************** *

© 1998-2020Legal notice