HBVdb

Dataset for nucleotide sequence PreS2 of genotype H

[Download (right click)] [Edit] [Sequences] [Repertoires]

41 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


MK568527_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactttt
JN604202_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
MT622523_PreS2_P-H      nnnnnnnnnnnnnnnctaaggcacaca------------catccacagtt
MK568533_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB064315_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgct
AB059659_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB353764_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB179747_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB205010_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB275308_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
EF157291_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB266536_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
EU498228_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB818694_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
JN604203_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
FJ356715_PreS2_P-H      ------------atgcagtggaactcaatacagttccaccaagcactgtt
AB375163_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
HM117850_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
HM066946_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
HQ285946_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AY090457_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB375160_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
JN604310_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
MK568526_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
MK568532_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AY090454_PreS2_C-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
MK568523_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
MK568534_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
FJ356716_PreS2_C-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB059660_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB375161_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
HM117851_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB375159_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB375162_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB059661_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AB375164_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
KX264501_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
EU159675_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
AY090460_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
MK568522_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
MK568524_PreS2_P-H      ------------atgcagtggaactcaacacagttccaccaagcactgtt
                                       *   ** ** **            **  ***   *

MK568527_PreS2_P-H      ggatacgagagtaaagggtctgtatcttcctgctggtggctccagttcag
JN604202_PreS2_P-H      ggatccgaaagtaaggggtctgtattttcctgctggtggctccagttcag
MT622523_PreS2_P-H      ggattcgagagtaaggggtctgtgttttcctgctggtggctccagttcag
MK568533_PreS2_P-H      ggatccgagagtgaggggtctgtattttcctgctggtggctccagttcag
AB064315_PreS2_P-H      ggatccgagagtaagggg---------tcctgctggtggctccagttcag
AB059659_PreS2_P-H      agatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
AB353764_PreS2_P-H      ggatccgagagtaagggggctgtattttcctgctggtggctccagttcag
AB179747_PreS2_P-H      ggatccgagagtaagggggctgtattttcctgctggtggctccagttcag
AB205010_PreS2_P-H      ggatccgagagtaagggggctgtatcttcctgctggtggctccagttcag
AB275308_PreS2_P-H      ggatccgagagtaagggggctgtattttcctgctggtggctccagttcag
EF157291_PreS2_P-H      ggatccgagagtaagggggctgtattttcctgctggtggctccagttcag
AB266536_PreS2_P-H      ggatccgagagtaagggggctgtattttcctgctggtggctccagttcag
EU498228_PreS2_P-H      ggatccgagagtaagggggctgtattttcctgctggtggctccagttcag
AB818694_PreS2_P-H      ggatccgagagtaagggggctgtattttcctgctggtggctccagttcag
JN604203_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
FJ356715_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
AB375163_PreS2_P-H      ggacccgagagtaaggggtctgtattttcctgctggtggctccagttcag
HM117850_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
HM066946_PreS2_P-H      ggatccgagagtgaggggtctgtattttcctgctggtggctccagttcag
HQ285946_PreS2_P-H      ggatccgagagtgaggggtctgtattttcctgctggtggctccagttcag
AY090457_PreS2_P-H      ggatccgagagtaaggggtctgtatcttcctgctggtggctccagttcag
AB375160_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
JN604310_PreS2_P-H      ggacccgagagtaaggggtctgtattttcctgctggtggctccagttcag
MK568526_PreS2_P-H      ggacccgagagtaaggggtctgtattttcctgctggtggctccagttcag
MK568532_PreS2_P-H      ggacccgagagtaaggggtctgtattttcctgctggtggctccagttcag
AY090454_PreS2_C-H      ggatccgagagtcaggggtctgtattttcctgctggtggctccagttcag
MK568523_PreS2_P-H      ggatccgagagtaagggctctgtattttcctgctggtggctccagttcag
MK568534_PreS2_P-H      ggatccgagagtaagggctctgtattttcctgctggtggctccagttcag
FJ356716_PreS2_C-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
AB059660_PreS2_P-H      ggatccgagagtaaggggtctgtatcttcctgctggtggctccagttcag
AB375161_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
HM117851_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
AB375159_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
AB375162_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
AB059661_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
AB375164_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
KX264501_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
EU159675_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
AY090460_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
MK568522_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
MK568524_PreS2_P-H      ggatccgagagtaaggggtctgtattttcctgctggtggctccagttcag
                         **  *** *** * **          ***********************

MK568527_PreS2_P-H      aaacacagaaccctgctccgactattgcctctcacacatcatcaatctta
JN604202_PreS2_P-H      aaacacagaaccctgctccgactattgtctctctcacatcgtcaatcttc
MT622523_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcgtcaaccttc
MK568533_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB064315_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB059659_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB353764_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB179747_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB205010_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB275308_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
EF157291_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB266536_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
EU498228_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB818694_PreS2_P-H      aaacacagaaccctgcgccgactattgcctctctcacatcatcaatcttc
JN604203_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ356715_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB375163_PreS2_P-H      aaacacagaaccctgctccgactattgtctctctcacatcatcaatcttc
HM117850_PreS2_P-H      aaacacaaaaccctgctccgactattgcctctctcacatcatcaatcttc
HM066946_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HQ285946_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AY090457_PreS2_P-H      aaacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB375160_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN604310_PreS2_P-H      aaacacagaaccctgctccgactattgtctctctcacatcatcaatcttc
MK568526_PreS2_P-H      aaacacagaaccctgctccgactattgtctctctcacatcatcaatcttc
MK568532_PreS2_P-H      aaacacagaaccctgctccgactattgtctctctcacatcatcaatcttc
AY090454_PreS2_C-H      aaacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
MK568523_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
MK568534_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ356716_PreS2_C-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB059660_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB375161_PreS2_P-H      aaacacagaaccctgctccgactattgtctctctcacatcatcaatcttc
HM117851_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB375159_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB375162_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB059661_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB375164_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KX264501_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
EU159675_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AY090460_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
MK568522_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
MK568524_PreS2_P-H      aaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
                        ******* *******  ********** ***** ****** **** *** 

MK568527_PreS2_P-H      tcgacgactggggaccctgctatgaacatggagaacatcacatcaggact
JN604202_PreS2_P-H      tcgaagactggggatcctgctatgaacatgaagaacatcacatcaggact
MT622523_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
MK568533_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB064315_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB059659_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB353764_PreS2_P-H      tcgaagactggggaccctgttatgaacatggagaacatcacatcaggact
AB179747_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB205010_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB275308_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
EF157291_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB266536_PreS2_P-H      tcgaagactggggaccctgttatgaacatggagaacatcacatcaggact
EU498228_PreS2_P-H      tcgaagactggggaccctgttatgaacatggagaacatcacatcaggact
AB818694_PreS2_P-H      tcgaagactggggaccctgttatgaacatggagaacatcacatcaggact
JN604203_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
FJ356715_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB375163_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
HM117850_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
HM066946_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
HQ285946_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AY090457_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB375160_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
JN604310_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
MK568526_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
MK568532_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AY090454_PreS2_C-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
MK568523_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
MK568534_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
FJ356716_PreS2_C-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB059660_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB375161_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
HM117851_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB375159_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB375162_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB059661_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AB375164_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
KX264501_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
EU159675_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
AY090460_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
MK568522_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
MK568524_PreS2_P-H      tcgaagactggggaccctgctatgaacatggagaacatcacatcaggact
                        **** ********* **** ********** *******************

MK568527_PreS2_P-H      cccaggactccgtctcgtgttacaggcggtgtgtttctggttgacaaaaa
JN604202_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtttttctcgttgacaaaaa
MT622523_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
MK568533_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB064315_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB059659_PreS2_P-H      cctaggaccccttcccgtgttacagggggtgtttttctcgttgacaaaaa
AB353764_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB179747_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB205010_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB275308_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
EF157291_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB266536_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
EU498228_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB818694_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
JN604203_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
FJ356715_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtttttcttgttgacaaaag
AB375163_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
HM117850_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
HM066946_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
HQ285946_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AY090457_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB375160_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
JN604310_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
MK568526_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
MK568532_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AY090454_PreS2_C-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
MK568523_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
MK568534_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
FJ356716_PreS2_C-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB059660_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB375161_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
HM117851_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB375159_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB375162_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB059661_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AB375164_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
KX264501_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
EU159675_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
AY090460_PreS2_P-H      cctaagaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
MK568522_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
MK568524_PreS2_P-H      cctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaa
                        ** * *** ** ** *********** ***** ***** ********** 

MK568527_PreS2_P-H      tccgcacaatgccaaagaggctagactcgtggtggacttctctcaatttt
JN604202_PreS2_P-H      tcctcacaataccccagagtctagactcgtggtggacttctctcaatttt
MT622523_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
MK568533_PreS2_P-H      tccgcaaaataccacagagtctagactcgtggtggacttctctcaattct
AB064315_PreS2_P-H      tcctcacaataccacggagtctagactcgtggtggacttctctcaatttt
AB059659_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
AB353764_PreS2_P-H      tcctcacaataccaaagagtctagactcgtggtggacttctctcaatttt
AB179747_PreS2_P-H      tcctcacaataccaaagagtctagactcgtggtggacttctctcaatttt
AB205010_PreS2_P-H      tcctcacaataccaaagagtctagactcgtggtggacttctctcaatttt
AB275308_PreS2_P-H      tcctcacaataccaaagagtctagactcgtggtggacttctctcaatttt
EF157291_PreS2_P-H      tcctcacaataccaaagagtctagactcgtggtggacttctctcaatttt
AB266536_PreS2_P-H      tcctcacaataccaaagagtctagactcgtggtggacttctctcaatttt
EU498228_PreS2_P-H      tcctcacaataccaaagagtctagactcgtggtggacttctctcaatttt
AB818694_PreS2_P-H      tcctcacaataccaaagagtctagactcgtggtggacttctctcaatttt
JN604203_PreS2_P-H      tcckcacaataccaaagagtctagactcgtggtggacttctctcaatttt
FJ356715_PreS2_P-H      tcctcacaataccaaagagtctagactcgtggtggacttctctcaatttt
AB375163_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
HM117850_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
HM066946_PreS2_P-H      tcctcacaataccaaagagtctagactcgtggtggacttctctcaatttt
HQ285946_PreS2_P-H      tcctcacaataccaaagagtctagactcgtggtggacttctctcaatttt
AY090457_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
AB375160_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
JN604310_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
MK568526_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
MK568532_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
AY090454_PreS2_C-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
MK568523_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
MK568534_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
FJ356716_PreS2_C-H      tccgcacaataccacagagtctagactcgtggtggacttctctcaatttt
AB059660_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
AB375161_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
HM117851_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
AB375159_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
AB375162_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
AB059661_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
AB375164_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
KX264501_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
EU159675_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
AY090460_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
MK568522_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
MK568524_PreS2_P-H      tcctcacaataccacagagtctagactcgtggtggacttctctcaatttt
                        *** ** *** **   *** **************************** *

MK568527_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
JN604202_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattygcagtccccaatctc
MT622523_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
MK568533_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaacctc
AB064315_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB059659_PreS2_P-H      ctagaggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB353764_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB179747_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB205010_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB275308_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
EF157291_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB266536_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
EU498228_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB818694_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
JN604203_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
FJ356715_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB375163_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
HM117850_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
HM066946_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
HQ285946_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AY090457_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB375160_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
JN604310_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
MK568526_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaagttcgcagtccccaatctc
MK568532_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaagttcgcagtccccaatctc
AY090454_PreS2_C-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
MK568523_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
MK568534_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
FJ356716_PreS2_C-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB059660_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB375161_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
HM117851_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB375159_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB375162_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB059661_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AB375164_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
KX264501_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
EU159675_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
AY090460_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
MK568522_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
MK568524_PreS2_P-H      ctaggggtaccacccgggtgtcctggccaaaattcgcagtccccaatctc
                        **** ************************** ** *********** ***

MK568527_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
JN604202_PreS2_P-H      caatcacttaccaatctcctgtcctccaacttgtcctggctatcgttgga
MT622523_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
MK568533_PreS2_P-H      caatcacttacaaacctcctgtcctccaacttgtcctggctatcgttgga
AB064315_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB059659_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB353764_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB179747_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB205010_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB275308_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
EF157291_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB266536_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
EU498228_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB818694_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
JN604203_PreS2_P-H      caatcacttacaaacctcttgtcctccaacttgtcctggctatcgttgga
FJ356715_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB375163_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
HM117850_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
HM066946_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
HQ285946_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AY090457_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB375160_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgtcgga
JN604310_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
MK568526_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
MK568532_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AY090454_PreS2_C-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
MK568523_PreS2_P-H      caatcacttaccaacctcttgtcctccaacttgtcctggctatcgttgga
MK568534_PreS2_P-H      caatcacttaccaacctcttgtcctccaacttgtcctggctatcgttgga
FJ356716_PreS2_C-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB059660_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB375161_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
HM117851_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB375159_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB375162_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB059661_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AB375164_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
KX264501_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
EU159675_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
AY090460_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
MK568522_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
MK568524_PreS2_P-H      caatcacttaccaacctcctgtcctccaacttgtcctggctatcgttgga
                        *********** ** *** *************************** ***

MK568527_PreS2_P-H      tgtgtctgcggcgttttaccatcttcctcttcatcctgctgctatgcctc
JN604202_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
MT622523_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
MK568533_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB064315_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB059659_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB353764_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB179747_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB205010_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB275308_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
EF157291_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB266536_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
EU498228_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB818694_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
JN604203_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
FJ356715_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB375163_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
HM117850_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
HM066946_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
HQ285946_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AY090457_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB375160_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctaggcctc
JN604310_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
MK568526_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
MK568532_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AY090454_PreS2_C-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
MK568523_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
MK568534_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
FJ356716_PreS2_C-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB059660_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB375161_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
HM117851_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB375159_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB375162_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB059661_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AB375164_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
KX264501_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
EU159675_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
AY090460_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
MK568522_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
MK568524_PreS2_P-H      tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
                        ****************** ************************* *****

MK568527_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
JN604202_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
MT622523_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
MK568533_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB064315_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB059659_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB353764_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB179747_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB205010_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB275308_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
EF157291_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB266536_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
EU498228_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB818694_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
JN604203_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
FJ356715_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB375163_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
HM117850_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
HM066946_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
HQ285946_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AY090457_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB375160_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
JN604310_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
MK568526_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
MK568532_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AY090454_PreS2_C-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
MK568523_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
MK568534_PreS2_P-H      atctccttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
FJ356716_PreS2_C-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB059660_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB375161_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
HM117851_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB375159_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB375162_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB059661_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AB375164_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
KX264501_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
EU159675_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
AY090460_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
MK568522_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
MK568524_PreS2_P-H      atcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcc
                        **** *********************************************

MK568527_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
JN604202_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
MT622523_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
MK568533_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
AB064315_PreS2_P-H      tctacttccaggatcttcaaccaccagcacgggaccctgcaaaacctgca
AB059659_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
AB353764_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
AB179747_PreS2_P-H      tctacttccaggatcwacaaccaccagcacgggaccctgcaaaacctgca
AB205010_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
AB275308_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
EF157291_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
AB266536_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
EU498228_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
AB818694_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
JN604203_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
FJ356715_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
AB375163_PreS2_P-H      tctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgca
HM117850_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
HM066946_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaagacctgca
HQ285946_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaagacctgca
AY090457_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggtccctgcaaaacctgca
AB375160_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
JN604310_PreS2_P-H      tctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgca
MK568526_PreS2_P-H      tctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgca
MK568532_PreS2_P-H      tctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgca
AY090454_PreS2_C-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
MK568523_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
MK568534_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
FJ356716_PreS2_C-H      tctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgca
AB059660_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
AB375161_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
HM117851_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
AB375159_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
AB375162_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
AB059661_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
AB375164_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
KX264501_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
EU159675_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
AY090460_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
MK568522_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
MK568524_PreS2_P-H      tctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgca
                        ***************  **************** ******** *******

MK568527_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtacaaaa
JN604202_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
MT622523_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
MK568533_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AB064315_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AB059659_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AB353764_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AB179747_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AB205010_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AB275308_PreS2_P-H      ccactcttgctcaaggaccctctatgtttccctcctgctgctgtaccaaa
EF157291_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AB266536_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
EU498228_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AB818694_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgttgtaccaaa
JN604203_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
FJ356715_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcttgctgctgtaccaaa
AB375163_PreS2_P-H      ccactcytgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
HM117850_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
HM066946_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
HQ285946_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AY090457_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AB375160_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
JN604310_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
MK568526_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
MK568532_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AY090454_PreS2_C-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
MK568523_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
MK568534_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
FJ356716_PreS2_C-H      ccactcttgctcaaggaacctctatgtttccctcttgctgctgtaccaaa
AB059660_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaa
AB375161_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
HM117851_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtataaaa
AB375159_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AB375162_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AB059661_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
AB375164_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
KX264501_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaa
EU159675_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcttgctgctgtaccaaa
AY090460_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcttgctgctgtaccaaa
MK568522_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcttgctgctgtaccaaa
MK568524_PreS2_P-H      ccactcttgctcaaggaacctctatgtttccctcttgctgctgtaccaaa
                        ****** ********** **************** ** ** ****  ***

MK568527_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcgtcttgggcttt
JN604202_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
MT622523_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
MK568533_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB064315_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB059659_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB353764_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB179747_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB205010_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB275308_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
EF157291_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcgtcttgggcttt
AB266536_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
EU498228_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB818694_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
JN604203_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
FJ356715_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB375163_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
HM117850_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
HM066946_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
HQ285946_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AY090457_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB375160_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
JN604310_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
MK568526_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
MK568532_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AY090454_PreS2_C-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
MK568523_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
MK568534_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
FJ356716_PreS2_C-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB059660_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB375161_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
HM117851_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB375159_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB375162_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB059661_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
AB375164_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
KX264501_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
EU159675_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccgtcatcttgggcttt
AY090460_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
MK568522_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
MK568524_PreS2_P-H      ccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttt
                        *********************************** ** ***********

MK568527_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
JN604202_PreS2_P-H      aggaaattacctatgggagtgggcctcagcccgtttctcttggctcagtt
MT622523_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
MK568533_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB064315_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB059659_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB353764_PreS2_P-H      cggaaaatacctatgggattgggcctcagcccgtttctcatggctcagtt
AB179747_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB205010_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB275308_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
EF157291_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB266536_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
EU498228_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB818694_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
JN604203_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
FJ356715_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB375163_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
HM117850_PreS2_P-H      cggaaaatacctatgggactgggcctcagcccgtttctcatggctcagtt
HM066946_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
HQ285946_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AY090457_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB375160_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
JN604310_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
MK568526_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
MK568532_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AY090454_PreS2_C-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
MK568523_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
MK568534_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
FJ356716_PreS2_C-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB059660_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB375161_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
HM117851_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB375159_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB375162_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB059661_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AB375164_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
KX264501_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
EU159675_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
AY090460_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
MK568522_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
MK568524_PreS2_P-H      cggaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtt
                         ***** *********** ******************** **********

MK568527_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
JN604202_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccattgtctgg
MT622523_PreS2_P-H      tactagtgcaatttgctcagtggtgcgtagggctttcccccactgtctgg
MK568533_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AB064315_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AB059659_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AB353764_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AB179747_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AB205010_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AB275308_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
EF157291_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AB266536_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
EU498228_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AB818694_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
JN604203_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
FJ356715_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtttgg
AB375163_PreS2_P-H      tactagtgccatttgttcagtggtgcgtagggctttcccccactgtctgg
HM117850_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
HM066946_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
HQ285946_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AY090457_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AB375160_PreS2_P-H      tactagcgcaatttgctcagtggtgcgtagggctttcccccactgtctgg
JN604310_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
MK568526_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
MK568532_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AY090454_PreS2_C-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
MK568523_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
MK568534_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
FJ356716_PreS2_C-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AB059660_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AB375161_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
HM117851_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AB375159_PreS2_P-H      tactagtgcaatttgctcagtggtgcgtagggctttcccccactgtctgg
AB375162_PreS2_P-H      tactagtgcaatttgctcagtggtgcgtagggctttcccccactgtctgg
AB059661_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AB375164_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
KX264501_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
EU159675_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
AY090460_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
MK568522_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
MK568524_PreS2_P-H      tactagtgcaatttgttcagtggtgcgtagggctttcccccactgtctgg
                        ****** ** ***** ************************** *** ***

MK568527_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtacatcat
JN604202_PreS2_P-H      cctttagttatatggatgatttggtattgggggccaaatctgtgcaacat
MT622523_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtacagcat
MK568533_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtacaacat
AB064315_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcaacat
AB059659_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
AB353764_PreS2_P-H      cttttggttatgtggatgatctggtattgggggccaaatctgtgcagcat
AB179747_PreS2_P-H      cttttagttatatggatgatctggtattgggggccaaatctgtgcagcat
AB205010_PreS2_P-H      cttttagttatatggatgatctggtattgggggccaaatctgtgcagcat
AB275308_PreS2_P-H      cttttagttatatggatgatctggtattgggggccaaatctgtgcagcat
EF157291_PreS2_P-H      cttttagttatatggatgatctggtattgggggccaaatctgtgcagcat
AB266536_PreS2_P-H      cttttagttatatggatgatctggtattgggggccaaatctgtgcagcat
EU498228_PreS2_P-H      cttttagttatatggatgatctggtattgggggccaaatctgtgcagcat
AB818694_PreS2_P-H      cttttagttatatggatgatctggtattgggggccaaatctgtgcagcat
JN604203_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtacagcat
FJ356715_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
AB375163_PreS2_P-H      ctttcagctatatggatgatgtggtattgggggccaaatctgtgcagcat
HM117850_PreS2_P-H      cttttagttatgtggatgatttggtattgggggccaaatctgtgcagcat
HM066946_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
HQ285946_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
AY090457_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
AB375160_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
JN604310_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
MK568526_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
MK568532_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
AY090454_PreS2_C-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
MK568523_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
MK568534_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
FJ356716_PreS2_C-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
AB059660_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
AB375161_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
HM117851_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
AB375159_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
AB375162_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
AB059661_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
AB375164_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
KX264501_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
EU159675_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
AY090460_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
MK568522_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
MK568524_PreS2_P-H      cttttagttatatggatgatttggtattgggggccaaatctgtgcagcat
                        * **  * *** ******** ********************** ** ***

MK568527_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
JN604202_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
MT622523_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
MK568533_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB064315_PreS2_P-H      cttgagtccatttataccgctgttaccaattttttgttatctgtgggcat
AB059659_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB353764_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB179747_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB205010_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB275308_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
EF157291_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB266536_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
EU498228_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB818694_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
JN604203_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
FJ356715_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB375163_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
HM117850_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
HM066946_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
HQ285946_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AY090457_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB375160_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
JN604310_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
MK568526_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
MK568532_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AY090454_PreS2_C-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
MK568523_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
MK568534_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
FJ356716_PreS2_C-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB059660_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB375161_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
HM117851_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB375159_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB375162_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AB059661_PreS2_P-H      cttgaggccctttataccgctgttaccaattttttgttatctgtgggcat
AB375164_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
KX264501_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
EU159675_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
AY090460_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
MK568522_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
MK568524_PreS2_P-H      cttgagtccctttataccgctgttaccaattttttgttatctgtgggcat
                        ****** ** ****************************************

MK568527_PreS2_P-H      ccatttga
JN604202_PreS2_P-H      ccatttaa
MT622523_PreS2_P-H      ccatttga
MK568533_PreS2_P-H      ccatttga
AB064315_PreS2_P-H      ccatttga
AB059659_PreS2_P-H      ccatttga
AB353764_PreS2_P-H      ccatttga
AB179747_PreS2_P-H      ccatttga
AB205010_PreS2_P-H      ccatttga
AB275308_PreS2_P-H      ccatttga
EF157291_PreS2_P-H      ccatttga
AB266536_PreS2_P-H      ccatttga
EU498228_PreS2_P-H      ccatttga
AB818694_PreS2_P-H      ccatttga
JN604203_PreS2_P-H      ccatttga
FJ356715_PreS2_P-H      ccatttga
AB375163_PreS2_P-H      ccatttaa
HM117850_PreS2_P-H      ccatttga
HM066946_PreS2_P-H      ccatttga
HQ285946_PreS2_P-H      ccatttga
AY090457_PreS2_P-H      ccatttaa
AB375160_PreS2_P-H      ccatttga
JN604310_PreS2_P-H      ccatttaa
MK568526_PreS2_P-H      ccatttaa
MK568532_PreS2_P-H      ccatttaa
AY090454_PreS2_C-H      ccatttaa
MK568523_PreS2_P-H      ccatttga
MK568534_PreS2_P-H      ccatttga
FJ356716_PreS2_C-H      ccatttga
AB059660_PreS2_P-H      ccatttga
AB375161_PreS2_P-H      ccatttra
HM117851_PreS2_P-H      ccatttga
AB375159_PreS2_P-H      ccatttga
AB375162_PreS2_P-H      ccatttga
AB059661_PreS2_P-H      ccatttga
AB375164_PreS2_P-H      ccatttga
KX264501_PreS2_P-H      ccatttga
EU159675_PreS2_P-H      ccatttga
AY090460_PreS2_P-H      ccatttga
MK568522_PreS2_P-H      ccatttga
MK568524_PreS2_P-H      ccatttga
                        ****** *

© 1998-2021Legal notice