Dataset for nucleotide sequence PreC of genotype H

[Download (right click)] [Edit] [Sequences] [Repertoires]

41 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

AB059659_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
MT622523_PreC_P-H      atgtaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
AB059660_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
FJ356715_PreC_P-H      attcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
FJ356716_PreC_C-H      attcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AY090454_PreC_C-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AY090457_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
HM066946_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
JX896129_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB375163_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
JX896125_PreC_P-H      atgcwactttttcacctctgcctaatcatcttttgttcatgtcccactgt
JX896127_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB059661_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
JX896128_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
JX896131_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB064315_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
JX896126_PreC_P-H      atgcaactttttcacctctgcctaatcatctyttgttcatgtcccactgt
JX896133_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB375162_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
JX896130_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB375159_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB375160_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB375161_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB205010_PreC_P-H      atgcaacttttccacctctgcctaatcatcttttgttcatgtcccactgt
AB266536_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB353764_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB818694_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
EU498228_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KC836867_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB179747_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
EF157291_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB275308_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
JX915624_PreC_P-H      tttctcctctttcacctctgcctaatcatcttttgttcatgtcccactgt
HM117851_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
HM117850_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
JX896124_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
JX896134_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
JX896132_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB375164_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KX264501_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AY090460_PreC_P-H      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
                        *    ** ** ******************* ******************

AB059659_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
MT622523_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
AB059660_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ356715_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacc
FJ356716_PreC_C-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacc
AY090454_PreC_C-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY090457_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM066946_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JX896129_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB375163_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacc
JX896125_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JX896127_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB059661_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JX896128_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JX896131_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB064315_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JX896126_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JX896133_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB375162_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JX896130_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB375159_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB375160_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB375161_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB205010_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB266536_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB353764_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB818694_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
EU498228_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KC836867_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB179747_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
EF157291_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB275308_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JX915624_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM117851_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM117850_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JX896124_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JX896134_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JX896132_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB375164_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KX264501_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY090460_PreC_P-H      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
                       *********************************** ********* ****

AB059659_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttctgccttct
MT622523_PreC_P-H      cttttaaagaatttggagcttctgtggagttactgtcatttttgccttct
AB059660_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgcctact
FJ356715_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgcctaat
FJ356716_PreC_C-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AY090454_PreC_C-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AY090457_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
HM066946_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
JX896129_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AB375163_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
JX896125_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
JX896127_PreC_P-H      cttataaagaatttggagcttctgtggagtkactctcatttttgccttct
AB059661_PreC_P-H      tttataaagaatttggagcttctgtggagttactctcatttttgccttct
JX896128_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
JX896131_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AB064315_PreC_P-H      cttataaagaatttggagcttctgcggagttactctcatttttgccttct
JX896126_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
JX896133_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AB375162_PreC_P-H      cttataaagaatttggagcttctgtggagttactcycatttttgccttct
JX896130_PreC_P-H      cttataaagaatttggagcttctgtggagttactcycatttttgccttct
AB375159_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AB375160_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AB375161_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AB205010_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AB266536_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AB353764_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AB818694_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
EU498228_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
KC836867_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AB179747_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
EF157291_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AB275308_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
JX915624_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
HM117851_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
HM117850_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
JX896124_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
JX896134_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
JX896132_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AB375164_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
KX264501_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AY090460_PreC_P-H      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
                        ** ******************** ***** ***  ***** *****  *

AB059659_PreC_P-H      gacttctacccgtctgtccgggacctactcgacaccgcttcagccctcca
MT622523_PreC_P-H      gatttcttcccgcctgtcggggacctactcgacaccgcttcagccctctt
AB059660_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
FJ356715_PreC_P-H      gacttcttcccgtctgtccgggatctactcgacaccgcttcagccctcca
FJ356716_PreC_C-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcca
AY090454_PreC_C-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AY090457_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
HM066946_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
JX896129_PreC_P-H      gacttcttcccgtctatccgggacctactcgacaccgcttcagccctcta
AB375163_PreC_P-H      gatttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
JX896125_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
JX896127_PreC_P-H      gacttcttcccgtctgtccgggacctacycgacaccgcttcagccctcta
AB059661_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
JX896128_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
JX896131_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AB064315_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgctacagccctcta
JX896126_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
JX896133_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AB375162_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
JX896130_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AB375159_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AB375160_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AB375161_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AB205010_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AB266536_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AB353764_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AB818694_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
EU498228_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
KC836867_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AB179747_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
EF157291_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AB275308_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
JX915624_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
HM117851_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
HM117850_PreC_P-H      gatttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
JX896124_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
JX896134_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
JX896132_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AB375164_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
KX264501_PreC_P-H      gacttcttcccgtctgtccgggacctactcgacaccgcttcagccctcta
AY090460_PreC_P-H      gacttcttcccgtctgtccgggacctgctcgacaccgcttcagccctcta
                       ** **** **** ** ** **** ** * ********** ********  

AB059659_PreC_P-H      ccgagatgccttagaatcacccgaacattgctccccccaccacactgctc
MT622523_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccacactgctc
AB059660_PreC_P-H      ccgagatgccttagaatcacccgaacattgcaccccccaccatactgcca
FJ356715_PreC_P-H      ccgagaggccttagaatctcccgatcattgcacccccaaccacactgctc
FJ356716_PreC_C-H      ccgagatgccttagaatcacccgatcattgcacccccaaccacactgctc
AY090454_PreC_C-H      ccgagatgccttagaatcacccgaacattgcacccccaaccatactgctc
AY090457_PreC_P-H      ccgagatgccttagaatctcccgaacattgcacccccaaccatactgctc
HM066946_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccagccatactgctc
JX896129_PreC_P-H      ccgagatgccttagaatcacccgaacattgctcccccaaccacactgcta
AB375163_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccatactgctc
JX896125_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccatactgctc
JX896127_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccatactgctc
AB059661_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccatactgctc
JX896128_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccatactgctc
JX896131_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccatactgctc
AB064315_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccacactgctc
JX896126_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccatactgctc
JX896133_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccacactgctc
AB375162_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccacactgctc
JX896130_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccacactgctc
AB375159_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccacactgctc
AB375160_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccacactgctc
AB375161_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccatactgctc
AB205010_PreC_P-H      ccgagatgccttagaatcaccagaacattgcacccctagccacactgctc
AB266536_PreC_P-H      ccgagatgccttagaatcaccagaacattgcacccccaaccacactgctc
AB353764_PreC_P-H      ccgagatgccttagaatcaccagaacattgcacccccaaccacactgctc
AB818694_PreC_P-H      ccgagatgccttagaatcaccagaacattgcacccccaaccacactgctc
EU498228_PreC_P-H      ccgagatgccttagaatcaccagaacattgcacccccaaccacactgctc
KC836867_PreC_P-H      ccgagatgccttagaatcaccagaacattgcacccccaaccacactgctc
AB179747_PreC_P-H      ccgagatgccttagaatcaccagaacattgcacccccaaccacactgctc
EF157291_PreC_P-H      ccgagatgccttagaatcaccagaacattgcacccccaaccacactgctc
AB275308_PreC_P-H      ccgagatgccttagaatcacctgaacattgcacccccaaccacactgctc
JX915624_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccatactgctc
HM117851_PreC_P-H      cagagatgccttagaatcacccgaacattgcacccccaaccatactgctc
HM117850_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccatactgctc
JX896124_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccatactgctc
JX896134_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccatactgctc
JX896132_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccrcactgctc
AB375164_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccacactgctc
KX264501_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccacactgctc
AY090460_PreC_P-H      ccgagatgccttagaatcacccgaacattgcacccccaaccacactgctc
                       * **** *********** ** ** ****** ****   **  *****  

AB059659_PreC_P-H      tcaggcaagctgtttcgtgctggcgggaggtgacggacttcggtgactgg
MT622523_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgacgattttcgcttcctgg
AB059660_PreC_P-H      tcaggcaagttattttgtgctggggtgagttgatgaccttggcttcctgg
FJ356715_PreC_P-H      tcaggcaagctatttcgtgctggggtgagttgatgaccttggcttcctgg
FJ356716_PreC_C-H      tcaggcaagctatttcgtgctggggtgagttgatgaacttggcttcctgg
AY090454_PreC_C-H      tcaggcaagctattctgtgctggggtgagttaatgactttggcttcctgg
AY090457_PreC_P-H      tcaggcaagctattctgtgctggggtgagttaatgactttggcttcctgg
HM066946_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
JX896129_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
AB375163_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
JX896125_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
JX896127_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
AB059661_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
JX896128_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
JX896131_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
AB064315_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
JX896126_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
JX896133_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
AB375162_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
JX896130_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
AB375159_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
AB375160_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
AB375161_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
AB205010_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
AB266536_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgacattggcttcctgg
AB353764_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgacattggcttcctgg
AB818694_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgacattggcttcctgg
EU498228_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgacattggcttcctgg
KC836867_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgacattggcttcctgg
AB179747_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
EF157291_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
AB275308_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
JX915624_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
HM117851_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgactttggcttcctgg
HM117850_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
JX896124_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
JX896134_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
JX896132_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
AB375164_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
KX264501_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
AY090460_PreC_P-H      tcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgg
                       ********* * **  ******* * *** * * *   ** * *  ****

AB059659_PreC_P-H      gtgggcaataatttacaggatcaggcagcaagagatctagtagttaatta
MT622523_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
AB059660_PreC_P-H      gtgggcaataatttaaatgatcctgcagccagagatctagtagttaatta
FJ356715_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
FJ356716_PreC_C-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
AY090454_PreC_C-H      gtgggcaataatttagaggatcctgcggctagagatctagtagttaatta
AY090457_PreC_P-H      gtgggcaataatttagaggatcctgcggctagagatctagtagttaatta
HM066946_PreC_P-H      gtgggcaataatttagaggatcctgcagccagagatcttgtggttaatta
JX896129_PreC_P-H      gtgggccataatttagaggatcctgcagcaagagatctagtagttaatta
AB375163_PreC_P-H      gtgggcaataatttagaggatcctgcagccagagatctagtagttaatta
JX896125_PreC_P-H      gtgggcaataatttagaggatcctgcagccagagatctagtagttaatta
JX896127_PreC_P-H      gtgggcaataatttagaggatcctgcagccagagatctagtagttaatta
AB059661_PreC_P-H      gtgggcaataatttagaggatcctgcagccagagatctagtagttaatta
JX896128_PreC_P-H      gtgggcaataatttagaggatcctgcagccagagatctagtagttaatta
JX896131_PreC_P-H      gtgggcaataatttagaggatcctgcagccagagatctagtagttaatta
AB064315_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
JX896126_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
JX896133_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
AB375162_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
JX896130_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
AB375159_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
AB375160_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
AB375161_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
AB205010_PreC_P-H      gtgggcaataatttagaggatcctggagcaagagatctagtagttaatta
AB266536_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
AB353764_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
AB818694_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
EU498228_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
KC836867_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
AB179747_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
EF157291_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
AB275308_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
JX915624_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
HM117851_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
HM117850_PreC_P-H      gtgggcaataatttagaggatcctgcagccagagatctagtagttaatta
JX896124_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
JX896134_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
JX896132_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
AB375164_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
KX264501_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
AY090460_PreC_P-H      gtgggcaataatttagaggatcctgcagcaagagatctagtagttaatta
                       ****** ******** * ****  *  ** ******** ** ********

AB059659_PreC_P-H      tgtcaatgctaacataggtctaaaaattagacaattactatggtttcaca
MT622523_PreC_P-H      tgtcaatactaacatgggtctaaaaattagacgattattatggtttcaca
AB059660_PreC_P-H      tgtcaatactcatatgggcctaaaaattagacaattgttgtggtttcata
FJ356715_PreC_P-H      tgtcaatgctaacatgggcctaaaaattagacaattcttatggtttcaca
FJ356716_PreC_C-H      tgtcaatgctaacatgggcctaaaaattagacaattcttatggtttcaca
AY090454_PreC_C-H      tgtcaacactaatatgggcctaaaaattagacaattactatggtttcata
AY090457_PreC_P-H      tgtcaacactaatatgggcctaaaaattagacaattactatggtttcata
HM066946_PreC_P-H      tgtcaatactaatatgggcctaaaaattagacaattattatggtttcata
JX896129_PreC_P-H      tgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
AB375163_PreC_P-H      tgtcaatactaatatgggcctaaaaattagacaattattatggtttcata
JX896125_PreC_P-H      tgtcaatactaatatgggcctaaaaattagacaattattatggtttcata
JX896127_PreC_P-H      tgtcaatactaatatgggcctaaaaattagacaattattatggtttcata
AB059661_PreC_P-H      tgtcaatactaatatgggcctaaaaattagacaattattatggtttcata
JX896128_PreC_P-H      tgtcaataataatatgggcctaaaaattagacaattattatggtttcata
JX896131_PreC_P-H      tgtcaatactaatatgggcctaaaaattagacaattattatggtytcata
AB064315_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
JX896126_PreC_P-H      tgtcagtactaacatgggcctaaaaattagacaattattatggtttcata
JX896133_PreC_P-H      tgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
AB375162_PreC_P-H      tgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
JX896130_PreC_P-H      tgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
AB375159_PreC_P-H      tgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
AB375160_PreC_P-H      tgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
AB375161_PreC_P-H      tgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
AB205010_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
AB266536_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
AB353764_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
AB818694_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
EU498228_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
KC836867_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
AB179747_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
EF157291_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
AB275308_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
JX915624_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattgtggtttcata
HM117851_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcata
HM117850_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcata
JX896124_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattrtggtttcata
JX896134_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcata
JX896132_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
AB375164_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
KX264501_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
AY090460_PreC_P-H      tgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
                       *****    * * ** ** ************* ***  * **** *** *

AB059659_PreC_P-H      tttcctgccttacatttggaagagaaactgtgattgagtatttggtgtct
MT622523_PreC_P-H      tttcctgccttacatttggaagagaagttgtgcttgagtatttggtgtct
AB059660_PreC_P-H      tttcctgccttacgtttggaagagaaattgttcttgagtatttggtgtct
FJ356715_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
FJ356716_PreC_C-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
AY090454_PreC_C-H      tttcctgccttacatttggaagagaaactgttcttgagtatttggtgtct
AY090457_PreC_P-H      tttcctgccttacatttggaagagatactgttcttgagtatttggtgtct
HM066946_PreC_P-H      tttcctgccttacatttggaagagaaactgttcttgagtatttggtgtct
JX896129_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
AB375163_PreC_P-H      tttcctgccttacatttggaagagaaactgttcttgagtatttggtgtct
JX896125_PreC_P-H      tttcctgccttacatttggaagagaaactgttcttgagtatttggtgtct
JX896127_PreC_P-H      tttcctgccttacatttggaagagaaactgttcttgagtatttggtgtct
AB059661_PreC_P-H      tttcctgccttacatttggaagagatactgttcttgagtatctggtgtct
JX896128_PreC_P-H      tttcctgccttacatttggaagagatactgttcttgagtatttggtgtct
JX896131_PreC_P-H      tttcctgccttacatttggaagagaaactgttcttgagtatttggtgtct
AB064315_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
JX896126_PreC_P-H      tttcctsccttacatttggaagagaaactgtgcttgagtatttggtgyct
JX896133_PreC_P-H      tttcctgcctaacatttggaagagaaactgtgcttgagtatttggtgtct
AB375162_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
JX896130_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
AB375159_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
AB375160_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
AB375161_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
AB205010_PreC_P-H      tttcttgccttacatttggaagagaaactgtgcttgagtatttggtgtct
AB266536_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
AB353764_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
AB818694_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
EU498228_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
KC836867_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
AB179747_PreC_P-H      tttcttgccttacatttggaagagaaactgtgcttgagtatttggtgtct
EF157291_PreC_P-H      tttcttgccttacatttggaagagaaactgtgcttgagtatttggtgtct
AB275308_PreC_P-H      tttcttgccttacatttggaagagaaactgtgcttgagtatttggtgtct
JX915624_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
HM117851_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
HM117850_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
JX896124_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
JX896134_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
JX896132_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
AB375164_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
KX264501_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
AY090460_PreC_P-H      tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtct
                       **** * *** ** ***********   ***  ******** ***** **

AB059659_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
MT622523_PreC_P-H      tttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccc
AB059660_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
FJ356715_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
FJ356716_PreC_C-H      tttggagtgtggattcgcactccacytgcttatagaccaccaaatgcccc
AY090454_PreC_C-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
AY090457_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
HM066946_PreC_P-H      tttggagtgtggattcgcactccgcctggttatagaccaccaaatgcccc
JX896129_PreC_P-H      tttggagtgtggatccgtactccacctccttacagaccaccaaatgcccc
AB375163_PreC_P-H      tttggagtgtggattcgtactccacctgcttatagaccaccaaatgcccc
JX896125_PreC_P-H      tttggagtgtggattcgtactccacctgcttatagaccaccaaatgcccc
JX896127_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
AB059661_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
JX896128_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
JX896131_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
AB064315_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
JX896126_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
JX896133_PreC_P-H      tttggagggtggatccgcactccacctgcttacagaccaccaaatgcccc
AB375162_PreC_P-H      tttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccc
JX896130_PreC_P-H      tttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccc
AB375159_PreC_P-H      tttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccc
AB375160_PreC_P-H      tttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccc
AB375161_PreC_P-H      tttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccc
AB205010_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
AB266536_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
AB353764_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
AB818694_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
EU498228_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
KC836867_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
AB179747_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
EF157291_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
AB275308_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
JX915624_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
HM117851_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
HM117850_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
JX896124_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
JX896134_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
JX896132_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
AB375164_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
KX264501_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
AY090460_PreC_P-H      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
                       ******* ****** ** ***** * *  *** *****************

AB059659_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
MT622523_PreC_P-H      tatcctatcaacacttccggagactactgttattagaccacgaggcaggg
AB059660_PreC_P-H      tatcctgtcaacaattccggagacttgtgttattagacaacgaggcaggg
FJ356715_PreC_P-H      tatcctatcaacgcttccggagactactgttgttagacaacgaggcaggg
FJ356716_PreC_C-H      tatcctatccacacttccggagactactgttgttagacaacgaggcaggg
AY090454_PreC_C-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AY090457_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
HM066946_PreC_P-H      tatcctatcaacacttccggagactactgttattagacaacgaggcaggg
JX896129_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB375163_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
JX896125_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
JX896127_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB059661_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
JX896128_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
JX896131_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB064315_PreC_P-H      tatcctatcaacgcttcctgagtgtactgttattagacaacgaggcaggg
JX896126_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
JX896133_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB375162_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
JX896130_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB375159_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB375160_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB375161_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB205010_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB266536_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB353764_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB818694_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
EU498228_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
KC836867_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB179747_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
EF157291_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB275308_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
JX915624_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
HM117851_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
HM117850_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
JX896124_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
JX896134_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
JX896132_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AB375164_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
KX264501_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
AY090460_PreC_P-H      tatcctatcaacacttccggagactactgttgttagacaacgaggcaggg
                       ****** ** **  **** ***  *  **** ****** ***********

AB059659_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccg
MT622523_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
AB059660_PreC_P-H      cccctagaggaagaactccctcgcctcgcagacgaagatctaaatcaccg
FJ356715_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
FJ356716_PreC_C-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
AY090454_PreC_C-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
AY090457_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
HM066946_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
JX896129_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
AB375163_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
JX896125_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
JX896127_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
AB059661_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccg
JX896128_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
JX896131_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccg
AB064315_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
JX896126_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
JX896133_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
AB375162_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
JX896130_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
AB375159_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
AB375160_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
AB375161_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
AB205010_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatctccg
AB266536_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatctccg
AB353764_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatctccg
AB818694_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatctccg
EU498228_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatctccg
KC836867_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatctccg
AB179747_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatctccg
EF157291_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatctccg
AB275308_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatctccg
JX915624_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
HM117851_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
HM117850_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
JX896124_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
JX896134_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
JX896132_PreC_P-H      cccctagaagaagaactccctcgcctcgyagacgaagatctcaatcaccg
AB375164_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
KX264501_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
AY090460_PreC_P-H      cccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccg
                       ******** ******************* ************ **** ***

AB059659_PreC_P-H      cgtcgcagaagatctcaatctccatcttccaaatgttag
MT622523_PreC_P-H      cgtcgcagaagatctcaatctccatcttcccagtgttag
AB059660_PreC_P-H      cgtcgcagaagatctccatctccagcttcccaatgttag
FJ356715_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
FJ356716_PreC_C-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AY090454_PreC_C-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AY090457_PreC_P-H      cgtcgccgaagatctcaatctccagcttcccaatgttag
HM066946_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
JX896129_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AB375163_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
JX896125_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccartgttag
JX896127_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AB059661_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
JX896128_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
JX896131_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AB064315_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
JX896126_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
JX896133_PreC_P-H      cgtcgcagaagatctcaatctcgagcttcccaatgttag
AB375162_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
JX896130_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AB375159_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AB375160_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AB375161_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AB205010_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AB266536_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AB353764_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AB818694_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
EU498228_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
KC836867_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AB179747_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
EF157291_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AB275308_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
JX915624_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
HM117851_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
HM117850_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
JX896124_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
JX896134_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
JX896132_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AB375164_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
KX264501_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
AY090460_PreC_P-H      cgtcgcagaagatctcaatctccagcttcccaatgttag
                       ****** ********* ***** * ***** * ******

© 1998-2021Legal notice