Dataset for nucleotide sequence Genomes of genotype H

[Download (right click)] [Edit] [Sequences] [Repertoires]

28 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

AY090457_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgt
AY090454_FT00000_C-H      ctcaacacagttccaccaagcactgttggatccgagagtcaggggtctgt
AB059659_FT00000_P-H      ctcaacacagttccaccaagcactgttagatccgagagtaaggggtctgt
AB059660_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgt
HM066946_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtgaggggtctgt
AB059661_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgt
MT622523_FT00000_P-H      nnnnctaaggcacacacatccacagttggattcgagagtaaggggtctgt
AB064315_FT00000_P-H      ctcaacacagttccaccaagcactgctggatccgagagtaagggg-----
AB375163_FT00000_P-H      ctcaacacagttccaccaagcactgttggacccgagagtaaggggtctgt
FJ356715_FT00000_P-H      ctcaatacagttccaccaagcactgttggatccgagagtaaggggtctgt
HM117850_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgt
HM117851_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgt
FJ356716_FT00000_C-H      ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgt
AB375161_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgt
AB205010_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgt
AY090460_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgt
AB353764_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgt
AB818694_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgt
AB266536_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgt
EU498228_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgt
AB179747_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgt
EF157291_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgt
AB275308_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgt
AB375162_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgt
AB375160_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgt
AB375159_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgt
AB375164_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgt
KX264501_FT00000_P-H      ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgt
                                *  *  *   **  *** * * **  ******* *****     

AY090457_FT00000_P-H      atcttcctgctggtggctccagttcagaaacacagaaccctgttccgact
AY090454_FT00000_C-H      attttcctgctggtggctccagttcagaaacacagaaccctgttccgact
AB059659_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB059660_FT00000_P-H      atcttcctgctggtggctccagttcagaaacacagaaccctgctccgact
HM066946_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB059661_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
MT622523_FT00000_P-H      gttttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB064315_FT00000_P-H      ----tcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB375163_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
FJ356715_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
HM117850_FT00000_P-H      attttcctgctggtggctccagttcagaaacacaaaaccctgctccgact
HM117851_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
FJ356716_FT00000_C-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB375161_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB205010_FT00000_P-H      atcttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AY090460_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB353764_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB818694_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgcgccgact
AB266536_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
EU498228_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB179747_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
EF157291_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB275308_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB375162_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB375160_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB375159_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
AB375164_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
KX264501_FT00000_P-H      attttcctgctggtggctccagttcagaaacacagaaccctgctccgact
                              ****************************** *******  ******

AY090457_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
AY090454_FT00000_C-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
AB059659_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
AB059660_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
HM066946_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
AB059661_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
MT622523_FT00000_P-H      attgcctctctcacatcgtcaaccttctcgaagactggggaccctgctat
AB064315_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
AB375163_FT00000_P-H      attgtctctctcacatcatcaatcttctcgaagactggggaccctgctat
FJ356715_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
HM117850_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
HM117851_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
FJ356716_FT00000_C-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
AB375161_FT00000_P-H      attgtctctctcacatcatcaatcttctcgaagactggggaccctgctat
AB205010_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
AY090460_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
AB353764_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgttat
AB818694_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgttat
AB266536_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgttat
EU498228_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgttat
AB179747_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
EF157291_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
AB275308_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
AB375162_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
AB375160_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
AB375159_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
AB375164_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
KX264501_FT00000_P-H      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
                          **** ************ **** *********************** ***

AY090457_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AY090454_FT00000_C-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB059659_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttcccgtgttac
AB059660_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
HM066946_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB059661_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
MT622523_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB064315_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB375163_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
FJ356715_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
HM117850_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
HM117851_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
FJ356716_FT00000_C-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB375161_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB205010_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AY090460_FT00000_P-H      gaacatggagaacatcacatcaggactcctaagaccccttctcgtgttac
AB353764_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB818694_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB266536_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
EU498228_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB179747_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
EF157291_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB275308_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB375162_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB375160_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB375159_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
AB375164_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
KX264501_FT00000_P-H      gaacatggagaacatcacatcaggactcctaggaccccttctcgtgttac
                          ******************************* ********* ********

AY090457_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AY090454_FT00000_C-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB059659_FT00000_P-H      agggggtgtttttctcgttgacaaaaatcctcacaataccacagagtcta
AB059660_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM066946_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccaaagagtcta
AB059661_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MT622523_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB064315_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacggagtcta
AB375163_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ356715_FT00000_P-H      aggcggtgtttttcttgttgacaaaagtcctcacaataccaaagagtcta
HM117850_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM117851_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ356716_FT00000_C-H      aggcggtgtgtttcttgttgacaaaaatccgcacaataccacagagtcta
AB375161_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB205010_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccaaagagtcta
AY090460_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB353764_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccaaagagtcta
AB818694_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccaaagagtcta
AB266536_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccaaagagtcta
EU498228_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccaaagagtcta
AB179747_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccaaagagtcta
EF157291_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccaaagagtcta
AB275308_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccaaagagtcta
AB375162_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB375160_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB375159_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB375164_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KX264501_FT00000_P-H      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
                          *** ***** ***** ********** *** **********  *******

AY090457_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AY090454_FT00000_C-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB059659_FT00000_P-H      gactcgtggtggacttctctcaattttctagaggtaccacccgggtgtcc
AB059660_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
HM066946_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB059661_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
MT622523_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB064315_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB375163_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
FJ356715_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
HM117850_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
HM117851_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
FJ356716_FT00000_C-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB375161_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB205010_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AY090460_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB353764_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB818694_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB266536_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
EU498228_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB179747_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
EF157291_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB275308_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB375162_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB375160_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB375159_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
AB375164_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
KX264501_FT00000_P-H      gactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcc
                          ******************************* ******************

AY090457_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AY090454_FT00000_C-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB059659_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB059660_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
HM066946_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB059661_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
MT622523_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB064315_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB375163_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
FJ356715_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
HM117850_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
HM117851_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
FJ356716_FT00000_C-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB375161_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB205010_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AY090460_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB353764_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB818694_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB266536_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
EU498228_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB179747_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
EF157291_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB275308_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB375162_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB375160_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB375159_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
AB375164_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc
KX264501_FT00000_P-H      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtc

AY090457_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AY090454_FT00000_C-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB059659_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB059660_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
HM066946_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB059661_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MT622523_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB064315_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB375163_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
FJ356715_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
HM117850_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
HM117851_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
FJ356716_FT00000_C-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB375161_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB205010_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AY090460_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB353764_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB818694_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB266536_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
EU498228_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB179747_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
EF157291_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB275308_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB375162_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB375160_FT00000_P-H      ctccaacttgtcctggctatcgtcggatgtgtctgcggcgttttatcatc
AB375159_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB375164_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KX264501_FT00000_P-H      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
                          *********************** **************************

AY090457_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AY090454_FT00000_C-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB059659_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB059660_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM066946_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB059661_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MT622523_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB064315_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB375163_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ356715_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM117850_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM117851_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ356716_FT00000_C-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB375161_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB205010_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AY090460_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB353764_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB818694_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB266536_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
EU498228_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB179747_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
EF157291_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB275308_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB375162_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB375160_FT00000_P-H      ttcctcttcatcctgctgctaggcctcatcttcttgttggttcttctgga
AB375159_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB375164_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KX264501_FT00000_P-H      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
                          ********************* ****************************

AY090457_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AY090454_FT00000_C-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB059659_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB059660_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
HM066946_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB059661_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
MT622523_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB064315_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatcttcaacca
AB375163_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatcaacaacca
FJ356715_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
HM117850_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
HM117851_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
FJ356716_FT00000_C-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatcaacaacca
AB375161_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB205010_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AY090460_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB353764_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB818694_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB266536_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
EU498228_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB179747_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatcwacaacca
EF157291_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB275308_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB375162_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB375160_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB375159_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
AB375164_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
KX264501_FT00000_P-H      ctatcaaggtatgttgcccgtgtgtcctctacttccaggatctacaacca
                          ******************************************  ******

AY090457_FT00000_P-H      ccagcacgggtccctgcaaaacctgcaccactcttgctcaaggaacctct
AY090454_FT00000_C-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB059659_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB059660_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
HM066946_FT00000_P-H      ccagcacgggaccctgcaagacctgcaccactcttgctcaaggaacctct
AB059661_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
MT622523_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB064315_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB375163_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcytgctcaaggaacctct
FJ356715_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
HM117850_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
HM117851_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
FJ356716_FT00000_C-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB375161_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB205010_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AY090460_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB353764_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB818694_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB266536_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
EU498228_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB179747_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
EF157291_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB275308_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaccctct
AB375162_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB375160_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB375159_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
AB375164_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
KX264501_FT00000_P-H      ccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctct
                          ********** ******** ************* ********** *****

AY090457_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AY090454_FT00000_C-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AB059659_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AB059660_FT00000_P-H      atgtttccctcctgttgctgtaccaaaccttcggacggaaattgcacctg
HM066946_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AB059661_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
MT622523_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AB064315_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AB375163_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
FJ356715_FT00000_P-H      atgtttccctcttgctgctgtaccaaaccttcggacggaaattgcacctg
HM117850_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
HM117851_FT00000_P-H      atgtttccctcctgctgctgtataaaaccttcggacggaaattgcacctg
FJ356716_FT00000_C-H      atgtttccctcttgctgctgtaccaaaccttcggacggaaattgcacctg
AB375161_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AB205010_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AY090460_FT00000_P-H      atgtttccctcttgctgctgtaccaaaccttcggacggaaattgcacctg
AB353764_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AB818694_FT00000_P-H      atgtttccctcctgctgttgtaccaaaccttcggacggaaattgcacctg
AB266536_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
EU498228_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AB179747_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
EF157291_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AB275308_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AB375162_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AB375160_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AB375159_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
AB375164_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
KX264501_FT00000_P-H      atgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctg
                          *********** ** ** ****  **************************

AY090457_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AY090454_FT00000_C-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB059659_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB059660_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
HM066946_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB059661_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
MT622523_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB064315_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB375163_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
FJ356715_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
HM117850_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggactggg
HM117851_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
FJ356716_FT00000_C-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB375161_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB205010_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AY090460_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB353764_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggattggg
AB818694_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB266536_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
EU498228_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB179747_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
EF157291_FT00000_P-H      tattcccatcccatcgtcttgggctttcggaaaatacctatgggagtggg
AB275308_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB375162_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB375160_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB375159_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
AB375164_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
KX264501_FT00000_P-H      tattcccatcccatcatcttgggctttcggaaaatacctatgggagtggg
                          *************** ***************************** ****

AY090457_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
AY090454_FT00000_C-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
AB059659_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
AB059660_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
HM066946_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
AB059661_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
MT622523_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtgg
AB064315_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
AB375163_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgccatttgttcagtgg
FJ356715_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
HM117850_FT00000_P-H      cctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtgg
HM117851_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
FJ356716_FT00000_C-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
AB375161_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
AB205010_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
AY090460_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
AB353764_FT00000_P-H      cctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtgg
AB818694_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
AB266536_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
EU498228_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
AB179747_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
EF157291_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
AB275308_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
AB375162_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtgg
AB375160_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagcgcaatttgctcagtgg
AB375159_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtgg
AB375164_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
KX264501_FT00000_P-H      cctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtgg
                          **************** **************** ** ***** *******

AY090457_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
AY090454_FT00000_C-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
AB059659_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
AB059660_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
HM066946_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
AB059661_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
MT622523_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
AB064315_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
AB375163_FT00000_P-H      tgcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
FJ356715_FT00000_P-H      tgcgtagggctttcccccactgtttggcttttagttatatggatgatttg
HM117850_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatgtggatgatttg
HM117851_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
FJ356716_FT00000_C-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
AB375161_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
AB205010_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatctg
AY090460_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
AB353764_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttggttatgtggatgatctg
AB818694_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatctg
AB266536_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatctg
EU498228_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatctg
AB179747_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatctg
EF157291_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatctg
AB275308_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatctg
AB375162_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
AB375160_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
AB375159_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
AB375164_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
KX264501_FT00000_P-H      tgcgtagggctttcccccactgtctggcttttagttatatggatgatttg
                          *********************** *******  * *** ******** **

AY090457_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AY090454_FT00000_C-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB059659_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB059660_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
HM066946_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB059661_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgaggccctttataccgctgt
MT622523_FT00000_P-H      gtattgggggccaaatctgtacagcatcttgagtccctttataccgctgt
AB064315_FT00000_P-H      gtattgggggccaaatctgtgcaacatcttgagtccatttataccgctgt
AB375163_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
FJ356715_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
HM117850_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
HM117851_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
FJ356716_FT00000_C-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB375161_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB205010_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AY090460_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB353764_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB818694_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB266536_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
EU498228_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB179747_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
EF157291_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB275308_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB375162_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB375160_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB375159_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
AB375164_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
KX264501_FT00000_P-H      gtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
                          ******************** ** ********* ** *************

AY090457_FT00000_P-H      taccaattttttgttatctgtgggcatccatttaaacacagctaaaacaa
AY090454_FT00000_C-H      taccaattttttgttatctgtgggcatccatttaaacacagctaaaacaa
AB059659_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB059660_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
HM066946_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB059661_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
MT622523_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB064315_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB375163_FT00000_P-H      taccaattttttgttatctgtgggcatccatttaaacacagctaaaacaa
FJ356715_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
HM117850_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
HM117851_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
FJ356716_FT00000_C-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB375161_FT00000_P-H      taccaattttttgttatctgtgggcatccatttraacacagctaaaacaa
AB205010_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AY090460_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB353764_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB818694_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB266536_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
EU498228_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB179747_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
EF157291_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB275308_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB375162_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB375160_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB375159_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
AB375164_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
KX264501_FT00000_P-H      taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaa
                          ********************************* ****************

AY090457_FT00000_P-H      aatggtggggttattccttacactttatgggttatatcattgggagttgg
AY090454_FT00000_C-H      aatggtggggttattccttacactttatgggttatatcattgggagttgg
AB059659_FT00000_P-H      aaaggtggggttattccttacactttatgggttatataattgggagttgg
AB059660_FT00000_P-H      aatggtggggttattccttacactttatgggttatatcattgggagttgg
HM066946_FT00000_P-H      aatggtggggttattccttacactttatgggttatatcattgggagttgg
AB059661_FT00000_P-H      aatggtggggttattccttacactttatgggttatatcattgggagttgg
MT622523_FT00000_P-H      aatggtggggttattccttacactttatgggttatataattgggagttgg
AB064315_FT00000_P-H      aatggtggggttataccttacactttatgggttatagaattgggagttgg
AB375163_FT00000_P-H      aatggtggggttattccttacactttatgggttatatcattgggagttgg
FJ356715_FT00000_P-H      aawggtggggttataccttacactttatgggttatagaattgggagttgg
HM117850_FT00000_P-H      aatggtggggttattccttacactttatgggttatataattgggagctgg
HM117851_FT00000_P-H      aatggtggggttattccttacactttatgggttatgtaattgggagttgg
FJ356716_FT00000_C-H      aaaggtggggttattccttacactttatgggttatataattgggagttgg
AB375161_FT00000_P-H      aatggtggggttattccttacactttatgggttatatcattgggagttgg
AB205010_FT00000_P-H      aatggtggggttatacccttcactttatgggttatagaattgggagttgg
AY090460_FT00000_P-H      aatggtggggttattccttacactttatgggttatataattgggagttgg
AB353764_FT00000_P-H      aatggtggggttattcccttcactttatgggttatataattgggagttgg
AB818694_FT00000_P-H      aatggtggggttattcccttcactttatgggttatataattgggagttgg
AB266536_FT00000_P-H      aatggtggggctattcccttcactttatgggttatataattgggagttgg
EU498228_FT00000_P-H      aatggtggggttattcccttcactttatgggttatataattgggagttgg
AB179747_FT00000_P-H      aatggtggggttattcccttcactttatgggttatataattgggagttgg
EF157291_FT00000_P-H      aatggtggggttattcccttcactttatgggttatataattgggagttgg
AB275308_FT00000_P-H      aatggtggggttattcccttcactttatgggttatataattgggagttgg
AB375162_FT00000_P-H      aatggtggggttattccttacactttatgggttatataattgggagttgg
AB375160_FT00000_P-H      aatggtggggttattccttacactttatgggttatataattgggagttgg
AB375159_FT00000_P-H      aatggtggggttattccttacactttatgggttatataattgggagttgg
AB375164_FT00000_P-H      aatggtggggttattccttacactttatgggttatataattgggagttgg
KX264501_FT00000_P-H      aatggtggggttattccttacactttatgggttatataattgggagttgg
                          ** ******* *** ** * ***************   ******** ***

AY090457_FT00000_P-H      gggacattgcctcaggaacatattgtgcaaaaaatcaaagattgctttcg
AY090454_FT00000_C-H      gggacattgcctcaggaacatattgtgcaaaaaatcaaaaattgctttcg
AB059659_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB059660_FT00000_P-H      gggacattgcctcaggaacatattgtgcataaaatcaaagattgctttcg
HM066946_FT00000_P-H      gggacattgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB059661_FT00000_P-H      gggacattgcctcaggaacatattgtgcataaaatcaaagattgctttcg
MT622523_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB064315_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB375163_FT00000_P-H      gggacgttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
FJ356715_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttyg
HM117850_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
HM117851_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
FJ356716_FT00000_C-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB375161_FT00000_P-H      gggacsttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB205010_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AY090460_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB353764_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB818694_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagagtgctttcg
AB266536_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
EU498228_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB179747_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
EF157291_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB275308_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB375162_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB375160_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB375159_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
AB375164_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
KX264501_FT00000_P-H      gggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcg
                          ***** *********************** ********* * ****** *

AY090457_FT00000_P-H      caaacttcctgttaatcgacccattgattggaaagtctgtcaacgaattg
AY090454_FT00000_C-H      caaacttcccgttaatcgacccattgattggaaagtctgtcaacgaattg
AB059659_FT00000_P-H      caaacttcctgtgaatagacccattgattggaaggtttgtcaacgcattg
AB059660_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgaattg
HM066946_FT00000_P-H      caaacttcccgtgaatagacctattgattggaaggtttgtcaacgaattg
AB059661_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgaattg
MT622523_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
AB064315_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
AB375163_FT00000_P-H      caaacttcccgtaaatagacccattgattggaaggtctgtcaacgaattg
FJ356715_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
HM117850_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
HM117851_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
FJ356716_FT00000_C-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
AB375161_FT00000_P-H      caaacttcccgtraatagacccattgattggaaggtttgtcaacgaattg
AB205010_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
AY090460_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
AB353764_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
AB818694_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
AB266536_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
EU498228_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
AB179747_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
EF157291_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
AB275308_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
AB375162_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
AB375160_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
AB375159_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
AB375164_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
KX264501_FT00000_P-H      caaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattg
                          ********* ** *** **** *********** ** ******** ****

AY090457_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AY090454_FT00000_C-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB059659_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB059660_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
HM066946_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB059661_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
MT622523_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB064315_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB375163_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
FJ356715_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
HM117850_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
HM117851_FT00000_P-H      tgggtcttttgggctttgcagcccctttcactcaatgtggttatcctgct
FJ356716_FT00000_C-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB375161_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttaccctgct
AB205010_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AY090460_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB353764_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB818694_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB266536_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
EU498228_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB179747_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
EF157291_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB275308_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB375162_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB375160_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB375159_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
AB375164_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
KX264501_FT00000_P-H      tgggtcttttgggctttgcagccccttttactcaatgtggttatcctgct
                          **************************** ************** ******

AY090457_FT00000_P-H      ctcatgcccttatatgcctgtattaccgctaaacaggcttttgttttctc
AY090454_FT00000_C-H      ctcatgcccttatatgcctgtattaccgctaaacaggcttttgttttctc
AB059659_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB059660_FT00000_P-H      ctcatgcccttgtatgcctgtattactgctaagcaggcttttgttttctc
HM066946_FT00000_P-H      ctcatgcccttgtatgcctgtattactgctaagcaggcttttgttttctc
AB059661_FT00000_P-H      ctcatgcccttgtatgcctgcattactgctaaccaggcttttgttttctc
MT622523_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB064315_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB375163_FT00000_P-H      ctcatgcccttgtatgcctgtatcaccgctaagcaggcttttgttttctc
FJ356715_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
HM117850_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
HM117851_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
FJ356716_FT00000_C-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB375161_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB205010_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AY090460_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB353764_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB818694_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB266536_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
EU498228_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB179747_FT00000_P-H      ctcatgcccttgtatgcctgtattrccgctaagcaggcttttgttttctc
EF157291_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB275308_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB375162_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB375160_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB375159_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
AB375164_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
KX264501_FT00000_P-H      ctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctc
                          *********** ******** **  * ***** *****************

AY090457_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AY090454_FT00000_C-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AB059659_FT00000_P-H      gccaacttacaaggcctttctccgtcaacaatacatgaccctttaccccg
AB059660_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacctgaacctttaccccg
HM066946_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacctgaacctttaccccg
AB059661_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacctgaacctttaccccg
MT622523_FT00000_P-H      gccaacttacaaggcctttctctgtaaccaatacatgaacctttaccccg
AB064315_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AB375163_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
FJ356715_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
HM117850_FT00000_P-H      gccaacttacaaggcctttctatgtaaacaatacctgaacctttaccccg
HM117851_FT00000_P-H      gccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccg
FJ356716_FT00000_C-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AB375161_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AB205010_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AY090460_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AB353764_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AB818694_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AB266536_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
EU498228_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AB179747_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
EF157291_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AB275308_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AB375162_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AB375160_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AB375159_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
AB375164_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacctgaacctttaccccg
KX264501_FT00000_P-H      gccaacttacaaggcctttctctgtaaacaatacatgaacctttaccccg
                          *********************  ** * ****** *** ***********

AY090457_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AY090454_FT00000_C-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AB059659_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AB059660_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
HM066946_FT00000_P-H      ttgctcggcaacggccgggcctttgccaagtgtttgctgacgcaaccccc
AB059661_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
MT622523_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AB064315_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AB375163_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
FJ356715_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
HM117850_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
HM117851_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
FJ356716_FT00000_C-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AB375161_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AB205010_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AY090460_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AB353764_FT00000_P-H      ttgctcggcaacgaccaggcctttgccaagtgtttgctgacgcaaccccc
AB818694_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AB266536_FT00000_P-H      ttgctcggcaacgaccaggcctttgccaagtgtttgctgacgcaaccccc
EU498228_FT00000_P-H      ttgctcggcaacgaccaggcctttgccaagtgtttgctgacgcaaccccc
AB179747_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
EF157291_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AB275308_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AB375162_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AB375160_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AB375159_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
AB375164_FT00000_P-H      ttgctcggcaacggccgggcctttgccaagtgtttgctgacgcaaccccc
KX264501_FT00000_P-H      ttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
                          ************* ** *********************************

AY090457_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AY090454_FT00000_C-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB059659_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB059660_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
HM066946_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB059661_FT00000_P-H      actggctggggcttggcgattggccatcagcgcctgcgcggaacctttga
MT622523_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB064315_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttga
AB375163_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
FJ356715_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
HM117850_FT00000_P-H      actggctggggcttggcaattggccatcagcgcatgcgcggaacctttgt
HM117851_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
FJ356716_FT00000_C-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB375161_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB205010_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggcacctttgt
AY090460_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB353764_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB818694_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB266536_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
EU498228_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB179747_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
EF157291_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB275308_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB375162_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB375160_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB375159_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
AB375164_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
KX264501_FT00000_P-H      actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgt
                          ***************** *************** ******* ******* 

AY090457_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
AY090454_FT00000_C-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
AB059659_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
AB059660_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
HM066946_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
AB059661_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
MT622523_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcctgtttcgctc
AB064315_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
AB375163_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
FJ356715_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctcgcagcttgtttcgctc
HM117850_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
HM117851_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
FJ356716_FT00000_C-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
AB375161_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
AB205010_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagccgcttgtttcgctc
AY090460_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
AB353764_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagccgcttgtttcgctc
AB818694_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagccgcttgtttcgctc
AB266536_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagccgcttgtttcgctc
EU498228_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagccgcttgtttcgctc
AB179747_FT00000_P-H      ggctcctctgcccatccatactgcggaactcctagccgcttgtttcgctc
EF157291_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagccgcttgtttcgctc
AB275308_FT00000_P-H      ggctcctctgcccatccatactgcggaactcctagccgcttgtttcgctc
AB375162_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcctgtttcgctc
AB375160_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcctgtttcgctc
AB375159_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcctgtttcgctc
AB375164_FT00000_P-H      ggctcctctgccgatccatactgcagaactcctagcagcttgtttcgctc
KX264501_FT00000_P-H      ggctcctctgccgatccatactgcggaactcctagcagcttgtttcgctc
                          ************ *********** ******** ** ** **********

AY090457_FT00000_P-H      gcagccggtctggagcggacattatcggcactgacaactccgttgtcctg
AY090454_FT00000_C-H      gcagccggtctggagcggacattatcggcactgacaactccgttgtcctg
AB059659_FT00000_P-H      gcagccggtctggagcggacattatcggcactgacaactccgttgtcctt
AB059660_FT00000_P-H      gcagccggtctggagcggacattatcggcactgacaactccgttgtcctt
HM066946_FT00000_P-H      gcagccggtctggagcggacattatcggcactgacaactccgttgtcctt
AB059661_FT00000_P-H      gcagccggtctggagcggacgttatcggcactgacaactctgttgtcctt
MT622523_FT00000_P-H      gcagcaggtctggagcggacgttatcggcactgacaactccgttgtcctt
AB064315_FT00000_P-H      gcagcaggtctggagcggacattatcggcaccgacaactccgttgtcctt
AB375163_FT00000_P-H      gcagcaggtctggagcggacattatcggaactgacaactccgttgtcctt
FJ356715_FT00000_P-H      gcagcaggtctggagcggacattatcggcactgacaactctgttgtcctt
HM117850_FT00000_P-H      gcagcaggtctggagcggacattatcggcactgacaactccgttgtcctt
HM117851_FT00000_P-H      gcagcaggtctggagcggacattatcggcactgacaactccgttgtcctt
FJ356716_FT00000_C-H      gcagcaggtctggagcggacattatcggcactgacaactctgttgtcctt
AB375161_FT00000_P-H      gcagcaggtctggagcggacrttatcggaactgacaactccgttgtcctt
AB205010_FT00000_P-H      gcagcaggtctggagcggacattatcggcactgacaactccgttgtcctt
AY090460_FT00000_P-H      gcagcaggtctggagcggacattatcggcactgacaactctgttgtcctt
AB353764_FT00000_P-H      gcagcaggtctggagcggacattatcggcactgacaactccgttgtcctt
AB818694_FT00000_P-H      gcagcaggtctggagcggacattatcggcactgacaactccgttgtcctt
AB266536_FT00000_P-H      gcagcaggtctggagcggacattatcggcactgacaactccgttgtcctt
EU498228_FT00000_P-H      gcagcaggtctggagcggacattatcggcactgacaactccgttgtcctt
AB179747_FT00000_P-H      gcagcaggtctggagcggacattatcggcactgacaactccgttgtcctt
EF157291_FT00000_P-H      gcagcaggtctggagcggacattatcggcactgacaactccgttgtcctt
AB275308_FT00000_P-H      gcagcaggtctggagcggacattatcggcaccgacaactccgttgtcctt
AB375162_FT00000_P-H      gcagcaggtctggagcggacgttatcggcactgacaactccgttgtcctt
AB375160_FT00000_P-H      gcagcaggtctggagcggacgttatcggcactgacaactccgttgtcctt
AB375159_FT00000_P-H      gcagcaggtctggagcggacgttatcggcactgacaactccgttgtcctt
AB375164_FT00000_P-H      gcagcaggtctggagcggacattatcggcactgacaactctgttgtcctt
KX264501_FT00000_P-H      gcagcaggtctggagcggacattatcggcactgacaactccgttgtcctt
                          ***** ************** ******* ** ******** ******** 

AY090457_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
AY090454_FT00000_C-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
AB059659_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
AB059660_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
HM066946_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
AB059661_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
MT622523_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
AB064315_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
AB375163_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
FJ356715_FT00000_P-H      tctcggaagtacacctccttcccatggctgctcggctgtgctgccaactg
HM117850_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
HM117851_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
FJ356716_FT00000_C-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
AB375161_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
AB205010_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggatgtgctgccaactg
AY090460_FT00000_P-H      tctcggaagtacacctccttcccatggctgctcggctgtgctgccaactg
AB353764_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggttgtgctgccaactg
AB818694_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggttgtgctgccaactg
AB266536_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggttgtgctgccaactg
EU498228_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggttgtgctgccaactg
AB179747_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
EF157291_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
AB275308_FT00000_P-H      tctcggaagtacacctccttcccatggctgataggctgtgctgccaactg
AB375162_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
AB375160_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
AB375159_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
AB375164_FT00000_P-H      tctcggaagtacacctccttcccatggctgctcggctgtgctgccaactg
KX264501_FT00000_P-H      tctcggaagtacacctccttcccatggctgctaggctgtgctgccaactg
                          ****************************** * ** **************

AY090457_FT00000_P-H      gatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctg
AY090454_FT00000_C-H      gatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctg
AB059659_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB059660_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
HM066946_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB059661_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
MT622523_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB064315_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB375163_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
FJ356715_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
HM117850_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
HM117851_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
FJ356716_FT00000_C-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB375161_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB205010_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AY090460_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB353764_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB818694_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB266536_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
EU498228_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB179747_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
EF157291_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB275308_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgcagaatcctg
AB375162_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB375160_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB375159_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
AB375164_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
KX264501_FT00000_P-H      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctg
                          ************************ **************** ********

AY090457_FT00000_P-H      cggacgacccctctcgtggtcgcctggggctctgccgcccccttctccgc
AY090454_FT00000_C-H      cggacgacccctctcgtggtcgcctggggctctgccgcccccttctccgc
AB059659_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctaccgccctcttctccgc
AB059660_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctaccgccctcttctccgc
HM066946_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctaccgccctcttctccgc
AB059661_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
MT622523_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
AB064315_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
AB375163_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgcccccttctccgc
FJ356715_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
HM117850_FT00000_P-H      cggacgacccctctcgtggtcgtttggggctctgccgccctcttctccgc
HM117851_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
FJ356716_FT00000_C-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
AB375161_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgcccccttctccgc
AB205010_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
AY090460_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
AB353764_FT00000_P-H      cggacgacccctctcggggtcgcttggggctctgccgccctcttctccgc
AB818694_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
AB266536_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
EU498228_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
AB179747_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
EF157291_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
AB275308_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
AB375162_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
AB375160_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
AB375159_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
AB375164_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
KX264501_FT00000_P-H      cggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgc
                          **************** *****  ********* ****** *********

AY090457_FT00000_P-H      cttccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AY090454_FT00000_C-H      cttccgttccggccgacgacagggcgcacctctctttacgcggactcccc
AB059659_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AB059660_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
HM066946_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AB059661_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
MT622523_FT00000_P-H      ctaccgttccggccaacaacgggtcgcacctctctttacgcggactcccc
AB064315_FT00000_P-H      ctgccgttccggccaacgacgggtcgcacctctctttacgcggactcccc
AB375163_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
FJ356715_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
HM117850_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
HM117851_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
FJ356716_FT00000_C-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AB375161_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AB205010_FT00000_P-H      ctgccgttccggccgtcgacgggtcgcacctctctttacgcggactcccc
AY090460_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AB353764_FT00000_P-H      ctgtcgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AB818694_FT00000_P-H      ctgtcgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AB266536_FT00000_P-H      ctgtcgttccggccgacgacgggtcgcacctctctttacgcggactcccc
EU498228_FT00000_P-H      ctgtcgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AB179747_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
EF157291_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AB275308_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AB375162_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AB375160_FT00000_P-H      ctaccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AB375159_FT00000_P-H      ctaccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
AB375164_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
KX264501_FT00000_P-H      ctgccgttccggccgacgacgggtcgcacctctctttacgcggactcccc
                          **  **********  * ** ** **************************

AY090457_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AY090454_FT00000_C-H      gcctgtgccttttcatcagccggcccgtgtgcacttcggttcacctctgc
AB059659_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AB059660_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
HM066946_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AB059661_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
MT622523_FT00000_P-H      gcctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB064315_FT00000_P-H      gcctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB375163_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
FJ356715_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
HM117850_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
HM117851_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
FJ356716_FT00000_C-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AB375161_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AB205010_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AY090460_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AB353764_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AB818694_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AB266536_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
EU498228_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AB179747_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
EF157291_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AB275308_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AB375162_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AB375160_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AB375159_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
AB375164_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
KX264501_FT00000_P-H      gcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
                          *********** ***** ***** ************** ***********

AY090457_FT00000_P-H      acgtcgcatggagaccaccgtgaacgcccctcaaagcttgccaacaacct
AY090454_FT00000_C-H      acgtcgcatggagaccaccgtgaacgcccctcaaagcttgccaacaccct
AB059659_FT00000_P-H      acgtcacatggagaccaccgtgaacgccccttggaacttgccaacaacct
AB059660_FT00000_P-H      acgtcgcatggagaccaccgtgaacgcccctcggagcttgccaacaacct
HM066946_FT00000_P-H      acgtcgcatggagaccaccgtgaacgcccctcggagcttgccaacaacct
AB059661_FT00000_P-H      acgtcgcatggagaccaccgtgaacgcccctcggagcttgccaacaacct
MT622523_FT00000_P-H      acgtcacatggagaccaccgtgaacgccccttggaacttgccaacaacct
AB064315_FT00000_P-H      acgtcacatggagaccaccgtgaacgcccctcggaacttgccaacaacct
AB375163_FT00000_P-H      acgtcgcatggagaccaccgtgaacgcccctcagagcttgccaacaacct
FJ356715_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
HM117850_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
HM117851_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
FJ356716_FT00000_C-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
AB375161_FT00000_P-H      acgtcgcatggagaccaccgtgaacgcccctyrgaacttgccaacaacct
AB205010_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
AY090460_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
AB353764_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
AB818694_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
AB266536_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
EU498228_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
AB179747_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
EF157291_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
AB275308_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
AB375162_FT00000_P-H      acgtcgcatggagaccaccgtgaacgcccattggaacttgccaacaacct
AB375160_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
AB375159_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
AB375164_FT00000_P-H      acgtcgcatggagaccmccgtgaacgccccttggaacttgccaacaacct
KX264501_FT00000_P-H      acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaacct
                          ***** ********** ************ *   * ********** ***

AY090457_FT00000_P-H      tacataagaggactcttggactttcaccccggtcaacgacctggattgag
AY090454_FT00000_C-H      tacataaaaggactcttggactttcgccccggtcaacgacctggattgag
AB059659_FT00000_P-H      tatataagaggactcttggactttcgccccggtcaacgacctggattgag
AB059660_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
HM066946_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
AB059661_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
MT622523_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
AB064315_FT00000_P-H      tatataagaggactcttggactttcgccccggtcaatgacctggattgag
AB375163_FT00000_P-H      tacataagagaactcttggactttcgccccggtcaacgacctggattgag
FJ356715_FT00000_P-H      tatataagaggactcttggactttcgccccggtcaacgacctggattgag
HM117850_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
HM117851_FT00000_P-H      tacataagaggactcttggactttcgccccagtcaacgacctggattgag
FJ356716_FT00000_C-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
AB375161_FT00000_P-H      tacataagagaactcttggactttcgccccggtcaacgacctggattgag
AB205010_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
AY090460_FT00000_P-H      tgcataagaggactcttggtctttcgccccggtcaacgacctggattgag
AB353764_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
AB818694_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
AB266536_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
EU498228_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
AB179747_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
EF157291_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
AB275308_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
AB375162_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
AB375160_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
AB375159_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
AB375164_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
KX264501_FT00000_P-H      tacataagaggactcttggactttcgccccggtcaacgacctggattgag
                          *  **** ** ******** ***** **** ***** *************

AY090457_FT00000_P-H      gaatacatcaaagactgtgtgtttaaggactgggaggagtcgggggagga
AY090454_FT00000_C-H      gaatacatcaaagactgtgtgtttaaggactgggaggagtcgggggagga
AB059659_FT00000_P-H      gaatacatcaaggactgtgtatttaaggactgggaggagtcgggggagga
AB059660_FT00000_P-H      gactacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
HM066946_FT00000_P-H      gactacatcaaagactgtgtatttaaggactgggaggagtcaggggagga
AB059661_FT00000_P-H      gactacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
MT622523_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
AB064315_FT00000_P-H      gaatacatcaaagactgtgtatttaagggctgggaggagtcgggggagga
AB375163_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
FJ356715_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
HM117850_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
HM117851_FT00000_P-H      gaatacatcaaagactgtgtgtttaaggactgggaggagtcgggggagga
FJ356716_FT00000_C-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
AB375161_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
AB205010_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
AY090460_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
AB353764_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
AB818694_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
AB266536_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
EU498228_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
AB179747_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
EF157291_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
AB275308_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
AB375162_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
AB375160_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
AB375159_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
AB375164_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
KX264501_FT00000_P-H      gaatacatcaaagactgtgtatttaaggactgggaggagtcgggggagga
                          ** ******** ******** ******* ************ ********

AY090457_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AY090454_FT00000_C-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB059659_FT00000_P-H      gttgaggttaaaggtctttgtactaggaggctgtaggcataaattggtct
AB059660_FT00000_P-H      gctgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
HM066946_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB059661_FT00000_P-H      gctgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
MT622523_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB064315_FT00000_P-H      gttgaggttaatgatttatgtattaggaggctgtaggcataaattggtct
AB375163_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
FJ356715_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
HM117850_FT00000_P-H      gctgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
HM117851_FT00000_P-H      gtcgaggttaatggtttatgtattaggaggctgtaggcataaattggtct
FJ356716_FT00000_C-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB375161_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB205010_FT00000_P-H      gttgaggttaatgatctttgtattaggaggctgtaggcataaattggtct
AY090460_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB353764_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB818694_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB266536_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
EU498228_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB179747_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
EF157291_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB275308_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB375162_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB375160_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB375159_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
AB375164_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
KX264501_FT00000_P-H      gttgaggttaaaggtctttgtattaggaggctgtaggcataaattggtct
                          *  ******** * * * **** ***************************

AY090457_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AY090454_FT00000_C-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB059659_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB059660_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
HM066946_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB059661_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
MT622523_FT00000_P-H      gttcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
AB064315_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB375163_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
FJ356715_FT00000_P-H      gttcaccagcaccattcaactttttcacctctgcctaatcatcttttgtt
HM117850_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
HM117851_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
FJ356716_FT00000_C-H      gttcaccagcaccattcaactttttcacctctgcctaatcatcttttgtt
AB375161_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB205010_FT00000_P-H      gttcaccagcaccatgcaacttttccacctctgcctaatcatcttttgtt
AY090460_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB353764_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB818694_FT00000_P-H      gtgcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB266536_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
EU498228_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB179747_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
EF157291_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB275308_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB375162_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB375160_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB375159_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
AB375164_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
KX264501_FT00000_P-H      gttcaccagcaccatgcaactttttcacctctgcctaatcatcttttgtt
                          ** ************  ******* ******************* *****

AY090457_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AY090454_FT00000_C-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB059659_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttgggac
AB059660_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
HM066946_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB059661_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
MT622523_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttgggac
AB064315_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB375163_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
FJ356715_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
HM117850_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
HM117851_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
FJ356716_FT00000_C-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB375161_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB205010_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AY090460_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB353764_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB818694_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB266536_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
EU498228_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB179747_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
EF157291_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB275308_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB375162_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB375160_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB375159_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
AB375164_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
KX264501_FT00000_P-H      catgtcccactgttcaagcctccaagctgtgccttgggtggctttggggc
                          ************************************************ *

AY090457_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AY090454_FT00000_C-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AB059659_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AB059660_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
HM066946_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AB059661_FT00000_P-H      atggacattgacctttataaagaatttggagcttctgtggagttactctc
MT622523_FT00000_P-H      atggacattgacccttttaaagaatttggagcttctgtggagttactgtc
AB064315_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgcggagttactctc
AB375163_FT00000_P-H      atggacatcgacccttataaagaatttggagcttctgtggagttactctc
FJ356715_FT00000_P-H      atggacatcgacccttataaagaatttggagcttctgtggagttactctc
HM117850_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
HM117851_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
FJ356716_FT00000_C-H      atggacatcgacccttataaagaatttggagcttctgtggagttactctc
AB375161_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AB205010_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AY090460_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AB353764_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AB818694_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AB266536_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
EU498228_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AB179747_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
EF157291_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AB275308_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AB375162_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactcyc
AB375160_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AB375159_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
AB375164_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
KX264501_FT00000_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctc
                          ******** **** ** ******************** *********  *

AY090457_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AY090454_FT00000_C-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AB059659_FT00000_P-H      atttctgccttctgacttctacccgtctgtccgggacctactcgacaccg
AB059660_FT00000_P-H      atttttgcctactgacttcttcccgtctgtccgggacctactcgacaccg
HM066946_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AB059661_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
MT622523_FT00000_P-H      atttttgccttctgatttcttcccgcctgtcggggacctactcgacaccg
AB064315_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AB375163_FT00000_P-H      atttttgccttctgatttcttcccgtctgtccgggacctactcgacaccg
FJ356715_FT00000_P-H      atttttgcctaatgacttcttcccgtctgtccgggatctactcgacaccg
HM117850_FT00000_P-H      atttttgccttctgatttcttcccgtctgtccgggacctactcgacaccg
HM117851_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
FJ356716_FT00000_C-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AB375161_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AB205010_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AY090460_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctgctcgacaccg
AB353764_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AB818694_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AB266536_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
EU498228_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AB179747_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
EF157291_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AB275308_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AB375162_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AB375160_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AB375159_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
AB375164_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
KX264501_FT00000_P-H      atttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
                          **** *****  *** **** **** ***** **** ** **********

AY090457_FT00000_P-H      cttcagccctctaccgagatgccttagaatctcccgaacattgcaccccc
AY090454_FT00000_C-H      cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccc
AB059659_FT00000_P-H      cttcagccctccaccgagatgccttagaatcacccgaacattgctccccc
AB059660_FT00000_P-H      cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccc
HM066946_FT00000_P-H      cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccc
AB059661_FT00000_P-H      cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccc
MT622523_FT00000_P-H      cttcagccctcttccgagatgccttagaatcacccgaacattgcaccccc
AB064315_FT00000_P-H      ctacagccctctaccgagatgccttagaatcacccgaacattgcaccccc
AB375163_FT00000_P-H      cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccc
FJ356715_FT00000_P-H      cttcagccctccaccgagaggccttagaatctcccgatcattgcaccccc
HM117850_FT00000_P-H      cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccc
HM117851_FT00000_P-H      cttcagccctctacagagatgccttagaatcacccgaacattgcaccccc
FJ356716_FT00000_C-H      cttcagccctccaccgagatgccttagaatcacccgatcattgcaccccc
AB375161_FT00000_P-H      cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccc
AB205010_FT00000_P-H      cttcagccctctaccgagatgccttagaatcaccagaacattgcacccct
AY090460_FT00000_P-H      cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccc
AB353764_FT00000_P-H      cttcagccctctaccgagatgccttagaatcaccagaacattgcaccccc
AB818694_FT00000_P-H      cttcagccctctaccgagatgccttagaatcaccagaacattgcaccccc
AB266536_FT00000_P-H      cttcagccctctaccgagatgccttagaatcaccagaacattgcaccccc
EU498228_FT00000_P-H      cttcagccctctaccgagatgccttagaatcaccagaacattgcaccccc
AB179747_FT00000_P-H      cttcagccctctaccgagatgccttagaatcaccagaacattgcaccccc
EF157291_FT00000_P-H      cttcagccctctaccgagatgccttagaatcaccagaacattgcaccccc
AB275308_FT00000_P-H      cttcagccctctaccgagatgccttagaatcacctgaacattgcaccccc
AB375162_FT00000_P-H      cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccc
AB375160_FT00000_P-H      cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccc
AB375159_FT00000_P-H      cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccc
AB375164_FT00000_P-H      cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccc
KX264501_FT00000_P-H      cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccc
                          ** ********  * **** *********** ** ** ****** **** 

AY090457_FT00000_P-H      aaccatactgctctcaggcaagctattctgtgctggggtgagttaatgac
AY090454_FT00000_C-H      aaccatactgctctcaggcaagctattctgtgctggggtgagttaatgac
AB059659_FT00000_P-H      caccacactgctctcaggcaagctgtttcgtgctggcgggaggtgacgga
AB059660_FT00000_P-H      caccatactgccatcaggcaagttattttgtgctggggtgagttgatgac
HM066946_FT00000_P-H      agccatactgctctcaggcaagctattttgtgctggggtgagttgatgac
AB059661_FT00000_P-H      aaccatactgctctcaggcaagctattttgtgctggggtgagttgatgac
MT622523_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgacgat
AB064315_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
AB375163_FT00000_P-H      aaccatactgctctcaggcaagctattttgtgctggggtgagttgatgac
FJ356715_FT00000_P-H      aaccacactgctctcaggcaagctatttcgtgctggggtgagttgatgac
HM117850_FT00000_P-H      aaccatactgctctcaggcaagctattttgtgctggggtgagttgatgac
HM117851_FT00000_P-H      aaccatactgctctcaggcaagctattttgtgctggggtgagttgatgac
FJ356716_FT00000_C-H      aaccacactgctctcaggcaagctatttcgtgctggggtgagttgatgaa
AB375161_FT00000_P-H      aaccatactgctctcaggcaagctattttgtgctggggtgagttgatgac
AB205010_FT00000_P-H      agccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
AY090460_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
AB353764_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
AB818694_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
AB266536_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
EU498228_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
AB179747_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
EF157291_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
AB275308_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
AB375162_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
AB375160_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
AB375159_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
AB375164_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
KX264501_FT00000_P-H      aaccacactgctctcaggcaagctattttgtgctggggtgagttgatgac
                            *** *****  ********* * **  ******* * *** * * *  

AY090457_FT00000_P-H      tttggcttcctgggtgggcaataatttagaggatcctgcggctagagatc
AY090454_FT00000_C-H      tttggcttcctgggtgggcaataatttagaggatcctgcggctagagatc
AB059659_FT00000_P-H      cttcggtgactgggtgggcaataatttacaggatcaggcagcaagagatc
AB059660_FT00000_P-H      cttggcttcctgggtgggcaataatttaaatgatcctgcagccagagatc
HM066946_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagccagagatc
AB059661_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagccagagatc
MT622523_FT00000_P-H      tttcgcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
AB064315_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
AB375163_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagccagagatc
FJ356715_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
HM117850_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagccagagatc
HM117851_FT00000_P-H      tttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
FJ356716_FT00000_C-H      cttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
AB375161_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
AB205010_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctggagcaagagatc
AY090460_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
AB353764_FT00000_P-H      attggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
AB818694_FT00000_P-H      attggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
AB266536_FT00000_P-H      attggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
EU498228_FT00000_P-H      attggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
AB179747_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
EF157291_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
AB275308_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
AB375162_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
AB375160_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
AB375159_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
AB375164_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
KX264501_FT00000_P-H      cttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatc
                           ** * *  ******************* * ****  *  ** *******

AY090457_FT00000_P-H      tagtagttaattatgtcaacactaatatgggcctaaaaattagacaatta
AY090454_FT00000_C-H      tagtagttaattatgtcaacactaatatgggcctaaaaattagacaatta
AB059659_FT00000_P-H      tagtagttaattatgtcaatgctaacataggtctaaaaattagacaatta
AB059660_FT00000_P-H      tagtagttaattatgtcaatactcatatgggcctaaaaattagacaattg
HM066946_FT00000_P-H      ttgtggttaattatgtcaatactaatatgggcctaaaaattagacaatta
AB059661_FT00000_P-H      tagtagttaattatgtcaatactaatatgggcctaaaaattagacaatta
MT622523_FT00000_P-H      tagtagttaattatgtcaatactaacatgggtctaaaaattagacgatta
AB064315_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB375163_FT00000_P-H      tagtagttaattatgtcaatactaatatgggcctaaaaattagacaatta
FJ356715_FT00000_P-H      tagtagttaattatgtcaatgctaacatgggcctaaaaattagacaattc
HM117850_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
HM117851_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
FJ356716_FT00000_C-H      tagtagttaattatgtcaatgctaacatgggcctaaaaattagacaattc
AB375161_FT00000_P-H      tagtagttaattatgtcaatactaacatgggtctaaaaattagacaatta
AB205010_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AY090460_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB353764_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB818694_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB266536_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
EU498228_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB179747_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
EF157291_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB275308_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB375162_FT00000_P-H      tagtagttaattatgtcaatactaacatgggtctaaaaattagacaatta
AB375160_FT00000_P-H      tagtagttaattatgtcaatactaacatgggtctaaaaattagacaatta
AB375159_FT00000_P-H      tagtagttaattatgtcaatactaacatgggtctaaaaattagacaatta
AB375164_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
KX264501_FT00000_P-H      tagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
                          * ** **************  ** * ** ** ************* *** 

AY090457_FT00000_P-H      ctatggtttcatatttcctgccttacatttggaagagatactgttcttga
AY090454_FT00000_C-H      ctatggtttcatatttcctgccttacatttggaagagaaactgttcttga
AB059659_FT00000_P-H      ctatggtttcacatttcctgccttacatttggaagagaaactgtgattga
AB059660_FT00000_P-H      ttgtggtttcatatttcctgccttacgtttggaagagaaattgttcttga
HM066946_FT00000_P-H      ttatggtttcatatttcctgccttacatttggaagagaaactgttcttga
AB059661_FT00000_P-H      ttatggtttcatatttcctgccttacatttggaagagatactgttcttga
MT622523_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaagttgtgcttga
AB064315_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
AB375163_FT00000_P-H      ttatggtttcatatttcctgccttacatttggaagagaaactgttcttga
FJ356715_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
HM117850_FT00000_P-H      ttatggtttcatatttcctgccttacatttggaagagaaactgtgcttga
HM117851_FT00000_P-H      ttatggtttcatatttcctgccttacatttggaagagaaactgtgcttga
FJ356716_FT00000_C-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
AB375161_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
AB205010_FT00000_P-H      ttatggtttcacatttcttgccttacatttggaagagaaactgtgcttga
AY090460_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
AB353764_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
AB818694_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
AB266536_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
EU498228_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
AB179747_FT00000_P-H      ttatggtttcacatttcttgccttacatttggaagagaaactgtgcttga
EF157291_FT00000_P-H      ttatggtttcacatttcttgccttacatttggaagagaaactgtgcttga
AB275308_FT00000_P-H      ttatggtttcacatttcttgccttacatttggaagagaaactgtgcttga
AB375162_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
AB375160_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
AB375159_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
AB375164_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
KX264501_FT00000_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttga
                           * ******** ***** ******** ***********   ***  ****

AY090457_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
AY090454_FT00000_C-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
AB059659_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
AB059660_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
HM066946_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccgcctggttatagac
AB059661_FT00000_P-H      gtatctggtgtcttttggagtgtggattcgcactccacctgcttatagac
MT622523_FT00000_P-H      gtatttggtgtcttttggagtgtggatccgcactccacctgcttacagac
AB064315_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
AB375163_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgtactccacctgcttatagac
FJ356715_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
HM117850_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
HM117851_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
FJ356716_FT00000_C-H      gtatttggtgtcttttggagtgtggattcgcactccacytgcttatagac
AB375161_FT00000_P-H      gtatttggtgtcttttggagtgtggatccgcactccacctgcttacagac
AB205010_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
AY090460_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
AB353764_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
AB818694_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
AB266536_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
EU498228_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
AB179747_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
EF157291_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
AB275308_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
AB375162_FT00000_P-H      gtatttggtgtcttttggagtgtggatccgcactccacctgcttacagac
AB375160_FT00000_P-H      gtatttggtgtcttttggagtgtggatccgcactccacctgcttacagac
AB375159_FT00000_P-H      gtatttggtgtcttttggagtgtggatccgcactccacctgcttacagac
AB375164_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
KX264501_FT00000_P-H      gtatttggtgtcttttggagtgtggattcgcactccacctgcttatagac
                          **** ********************** ** ***** * ** *** ****

AY090457_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AY090454_FT00000_C-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AB059659_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AB059660_FT00000_P-H      caccaaatgcccctatcctgtcaacaattccggagacttgtgttattaga
HM066946_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttattaga
AB059661_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
MT622523_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttattaga
AB064315_FT00000_P-H      caccaaatgcccctatcctatcaacgcttcctgagtgtactgttattaga
AB375163_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
FJ356715_FT00000_P-H      caccaaatgcccctatcctatcaacgcttccggagactactgttgttaga
HM117850_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
HM117851_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
FJ356716_FT00000_C-H      caccaaatgcccctatcctatccacacttccggagactactgttgttaga
AB375161_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AB205010_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AY090460_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AB353764_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AB818694_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AB266536_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
EU498228_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AB179747_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
EF157291_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AB275308_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AB375162_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AB375160_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AB375159_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
AB375164_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
KX264501_FT00000_P-H      caccaaatgcccctatcctatcaacacttccggagactactgttgttaga
                          ******************* ** **  **** ***  *  **** *****

AY090457_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AY090454_FT00000_C-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB059659_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB059660_FT00000_P-H      caacgaggcagggcccctagaggaagaactccctcgcctcgcagacgaag
HM066946_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB059661_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
MT622523_FT00000_P-H      ccacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB064315_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB375163_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
FJ356715_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
HM117850_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
HM117851_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
FJ356716_FT00000_C-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB375161_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB205010_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AY090460_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB353764_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB818694_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB266536_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
EU498228_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB179747_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
EF157291_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB275308_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB375162_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB375160_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB375159_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
AB375164_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
KX264501_FT00000_P-H      caacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
                          * ******************* ****************************

AY090457_FT00000_P-H      atctcaatcaccgcgtcgccgaagatctcaatctccagcttcccaatgtt
AY090454_FT00000_C-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB059659_FT00000_P-H      atctcaatcgccgcgtcgcagaagatctcaatctccatcttccaaatgtt
AB059660_FT00000_P-H      atctaaatcaccgcgtcgcagaagatctccatctccagcttcccaatgtt
HM066946_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB059661_FT00000_P-H      atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgtt
MT622523_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccatcttcccagtgtt
AB064315_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB375163_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
FJ356715_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
HM117850_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
HM117851_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
FJ356716_FT00000_C-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB375161_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB205010_FT00000_P-H      atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AY090460_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB353764_FT00000_P-H      atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB818694_FT00000_P-H      atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB266536_FT00000_P-H      atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgtt
EU498228_FT00000_P-H      atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB179747_FT00000_P-H      atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgtt
EF157291_FT00000_P-H      atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB275308_FT00000_P-H      atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB375162_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB375160_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB375159_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
AB375164_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
KX264501_FT00000_P-H      atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgtt
                          **** **** ********* ********* ******* ***** * ****

AY090457_FT00000_P-H      agtatcccttggactcataaggtgggaaactttaccggtctttactcctc
AY090454_FT00000_C-H      agtatcccttggactcataaggtgggaaactttaccggtctttactcctc
AB059659_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB059660_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
HM066946_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB059661_FT00000_P-H      agtattccgtggactcataaggtgggaaactttaccggtctttactcctc
MT622523_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB064315_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcttc
AB375163_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
FJ356715_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
HM117850_FT00000_P-H      agtattccttggactcataaggtgggaaattttaccggtctttactcctc
HM117851_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
FJ356716_FT00000_C-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB375161_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB205010_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AY090460_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB353764_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB818694_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB266536_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
EU498228_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB179747_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
EF157291_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB275308_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB375162_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB375160_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB375159_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
AB375164_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
KX264501_FT00000_P-H      agtattccttggactcataaggtgggaaactttaccggtctttactcctc
                          ***** ** ******************** ***************** **

AY090457_FT00000_P-H      tactgtacctgttttcaatcctgattggttaactccttcttttcctgaca
AY090454_FT00000_C-H      tactgtacctgttttcaatcctgattggttaactccttcttttcctgaca
AB059659_FT00000_P-H      tactgcacctgttttcaatcctgactggttaactccttcttttcctgaca
AB059660_FT00000_P-H      tactgtacctgttttcaatcctgactggttaactccttcttttcctgaca
HM066946_FT00000_P-H      tactgtacctgttttcaatcctgactggttaactccttcttttcctgaca
AB059661_FT00000_P-H      tactgtacctgttttcaatcctgactggttaactccttcttttcctgaca
MT622523_FT00000_P-H      tactgtacctgttttcaatcctgactggttaactccttcttttcctgaca
AB064315_FT00000_P-H      tactgtacctgttttcaatcctgactggttaactccttcttttcctgaca
AB375163_FT00000_P-H      tactrtacctgttttcaatcctgactggttaactccttcttttcctgaca
FJ356715_FT00000_P-H      tactatacctgttttcaatcctgactggctaactccttcttttcctgaca
HM117850_FT00000_P-H      tactgtacctgttttcaatcctgactggttaactccttcttttcctaaca
HM117851_FT00000_P-H      tactgtacctgttttcaatcctgactggttaactccttcttttcctgaca
FJ356716_FT00000_C-H      tactatacctgttttcaatcctgactggctaactccttcttttcctgaca
AB375161_FT00000_P-H      tactgtacctgttttcaatcctgactggttaactccttcttttcctgaca
AB205010_FT00000_P-H      tactatacctgttttcaatcctgactggttaactccttcttttcctgaca
AY090460_FT00000_P-H      tactatacctgtttttaatcctgactggctaactccctcttttcctgaca
AB353764_FT00000_P-H      tactatacctgttttcaatcctgactggttaactccttcttttcctgaca
AB818694_FT00000_P-H      tactatacctgttttcaatcctgactggttaactccttcttttcctgaca
AB266536_FT00000_P-H      tactatacctgttttcaatcctgactggttaactccttcttttcctgaca
EU498228_FT00000_P-H      tactatacctgttttcaatcctgactggttaactccttcttttcctgaca
AB179747_FT00000_P-H      tactatacctgttttcaatcctgactggttaactccttcttttcctgaca
EF157291_FT00000_P-H      tactatacctgttttcaatcctgactggttaactccttcttttcctgaca
AB275308_FT00000_P-H      tactatacctgttttcaatcctgactggttaactccttcttttcctgaca
AB375162_FT00000_P-H      tactgtacctgttttcaatcctgactggttaactccttcttttcctgaca
AB375160_FT00000_P-H      tactgtacctgttttcaatcctgactggttaactccttcttttcctgaca
AB375159_FT00000_P-H      tactgtacctgttttcaatcctgactggttaactccttcttttcctgaca
AB375164_FT00000_P-H      tactatacctgttttcaatcctgactggttaactccttcttttcctgaca
KX264501_FT00000_P-H      tactatacctgttttcaatcctgactggttaactccttcttttcctgaca
                          ****  ********* ******** *** ******* ********* ***

AY090457_FT00000_P-H      ttcacctacatcaagatttgatacaaaaatgtgaacaatttgtaggccca
AY090454_FT00000_C-H      ttcacctacatcaagatttgatacaaaaatgtgagcaatttgtgcgccca
AB059659_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB059660_FT00000_P-H      ttcacttgcatcaagatttgatacaaaaatgtgaacaatttgtgggccca
HM066946_FT00000_P-H      ttcatttgcatcaagatttgatacaaaaatgtgaacaatttgtgggccca
AB059661_FT00000_P-H      ttcatttgcatcaagatttgatacaaaaatgtgaacaatttgtgggccca
MT622523_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB064315_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB375163_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
FJ356715_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
HM117850_FT00000_P-H      ttcacttgcatcaagatttgatacagaaatgtgagcaatttgtaggccca
HM117851_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
FJ356716_FT00000_C-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB375161_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB205010_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AY090460_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB353764_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB818694_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB266536_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
EU498228_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB179747_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
EF157291_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB275308_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB375162_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB375160_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB375159_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
AB375164_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
KX264501_FT00000_P-H      ttcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggccca
                          ****  * ********* ******* ******** ********  *****

AY090457_FT00000_P-H      ctcactaaaaatgaagtgagacgattgaaattaattatgccagcaagatt
AY090454_FT00000_C-H      ctcactaaaaatgaagtgagacgattgaaattaattatgccagcaaggtt
AB059659_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaattaattatgccagctaggtt
AB059660_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaaatgattatgccagctaggtt
HM066946_FT00000_P-H      ctcactaaaaatgaaaggagacgattgaaactgattatgccagctaggtt
AB059661_FT00000_P-H      ctcactaaaaatgaaaggagacgattgaaactgattatgccagctaggtt
MT622523_FT00000_P-H      ctcactacaaatgaaaggagaagattgaaactaattatgccagctaggtt
AB064315_FT00000_P-H      ctcactaaaaatgaaaggagacgattgaaactaattatgccagctaggtt
AB375163_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
FJ356715_FT00000_P-H      ctcactacaaatgaacggagacgattgaaactaattatgccagctaggtt
HM117850_FT00000_P-H      ctcactaaaaatgaaaggagacgattgaaactaattatgccagctaggtt
HM117851_FT00000_P-H      ctcactaaaaatgaaaggagacgattgaaactaattatgccagctaggtt
FJ356716_FT00000_C-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
AB375161_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
AB205010_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
AY090460_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
AB353764_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
AB818694_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
AB266536_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
EU498228_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
AB179747_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
EF157291_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
AB275308_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
AB375162_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
AB375160_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
AB375159_FT00000_P-H      ctcactaccaatgaaaggagacgattgaaactaattatgccagctaggtt
AB375164_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
KX264501_FT00000_P-H      ctcactacaaatgaaaggagacgattgaaactaattatgccagctaggtt
                          *******  ******  **** ******** * *********** ** **

AY090457_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaaaccat
AY090454_FT00000_C-H      ttatcccaaagctactaaatacttccctttggataaaggtattaaaccat
AB059659_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AB059660_FT00000_P-H      ttatcccaaagctaccaaatatttccctttggataaaggtattaaacctt
HM066946_FT00000_P-H      ttatcccaaagttaccaaatatttccctttggataaaggtattaaacctt
AB059661_FT00000_P-H      ttatcccaaagtaaccaaatatttccctttggataaaggtattaaacctt
MT622523_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AB064315_FT00000_P-H      ttatcccaaagttactaaatactttcctttggataaaggtattaagcctt
AB375163_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
FJ356715_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
HM117850_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagccgt
HM117851_FT00000_P-H      ttatcccaaaggtactaaatacttccctttggataaaggtattaagcctt
FJ356716_FT00000_C-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AB375161_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AB205010_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AY090460_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AB353764_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AB818694_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AB266536_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
EU498228_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AB179747_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
EF157291_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AB275308_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AB375162_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AB375160_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AB375159_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
AB375164_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
KX264501_FT00000_P-H      ttatcccaaagttactaaatacttccctttggataaaggtattaagcctt
                          ***********  ** ***** ** ******************** ** *

AY090457_FT00000_P-H      attatccagagcatgtggttaatcattacttcaaaactagacactattta
AY090454_FT00000_C-H      attatccagagaatgtggttaatcattacttcaaaactacacactattta
AB059659_FT00000_P-H      actatccagagaatgtggttgatcattactttaaaacgagacattatttg
AB059660_FT00000_P-H      actatccagagaatgtggttaatcattacttcaaaactagacactattta
HM066946_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacactattta
AB059661_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacactattta
MT622523_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
AB064315_FT00000_P-H      actatccagagcatgtggttaatcattactttaaaactagacattattta
AB375163_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
FJ356715_FT00000_P-H      actatccagagaatgtggttaatcattactttaaagctagacattattta
HM117850_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
HM117851_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
FJ356716_FT00000_C-H      actatccagagaatgtggttaatcattactttaaaactaaacattattta
AB375161_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
AB205010_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
AY090460_FT00000_P-H      actatccagagaatgtggttaatcattacttcaaaactagacattattta
AB353764_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
AB818694_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
AB266536_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
EU498228_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
AB179747_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
EF157291_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
AB275308_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
AB375162_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
AB375160_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
AB375159_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
AB375164_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
KX264501_FT00000_P-H      actatccagagaatgtggttaatcattactttaaaactagacattattta
                          * ********* ******** ********** *** * * *** ***** 

AY090457_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AY090454_FT00000_C-H      catactttgtggaaggcaagaattctatataagagagaatccacacatag
AB059659_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB059660_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
HM066946_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB059661_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
MT622523_FT00000_P-H      catactttgtggaaggcaggaatcctatataagagagaatccacacatag
AB064315_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB375163_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
FJ356715_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
HM117850_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
HM117851_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
FJ356716_FT00000_C-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB375161_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB205010_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AY090460_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB353764_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB818694_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB266536_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
EU498228_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB179747_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
EF157291_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB275308_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB375162_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB375160_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB375159_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
AB375164_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
KX264501_FT00000_P-H      catactttgtggaaggcaggaattctatataagagagaatccacacatag
                          ****************** **** **************************

AY090457_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AY090454_FT00000_C-H      cgcctcattttgtgggtcaccatattcctgggaacaagaactacagcatg
AB059659_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB059660_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
HM066946_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB059661_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
MT622523_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB064315_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB375163_FT00000_P-H      cgcctcattttgtgggtcaccatattcctkggaacaagagctacagcatg
FJ356715_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
HM117850_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
HM117851_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
FJ356716_FT00000_C-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB375161_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB205010_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AY090460_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB353764_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB818694_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB266536_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
EU498228_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB179747_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
EF157291_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB275308_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB375162_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB375160_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB375159_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
AB375164_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
KX264501_FT00000_P-H      cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatg
                          ***************************** ********* **********

AY090457_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AY090454_FT00000_C-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctctctgt
AB059659_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AB059660_FT00000_P-H      ggagcacctctctccacggcgagaaggggcatgggacagaatctttctgt
HM066946_FT00000_P-H      ggagcacctctctccacggcgagaaggggcatgggacagaatctttctgt
AB059661_FT00000_P-H      ggagcacctctctccacggcgagaaggggcatgggacagaatctttctgt
MT622523_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AB064315_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AB375163_FT00000_P-H      ggagcacctctctcaacggcragaaggggyatgggacagaayctttctgt
FJ356715_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaacctttctgt
HM117850_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
HM117851_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
FJ356716_FT00000_C-H      ggagcacctctctcaacggcgagaaggggcatgggacagaayctttctgt
AB375161_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AB205010_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AY090460_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaacctttctgt
AB353764_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AB818694_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AB266536_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
EU498228_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AB179747_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
EF157291_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AB275308_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AB375162_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AB375160_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AB375159_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
AB375164_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaacctttctgt
KX264501_FT00000_P-H      ggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgt
                          ************** ***** ******** *********** ** *****

AY090457_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AY090454_FT00000_C-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB059659_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB059660_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
HM066946_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB059661_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
MT622523_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatvcactattca
AB064315_FT00000_P-H      gcccaatcctctgggattctttccggaccaccagttggatccactattca
AB375163_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
FJ356715_FT00000_P-H      gcccaatcctctgggattctttccmgaccaccagttggatccactattca
HM117850_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
HM117851_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
FJ356716_FT00000_C-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB375161_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB205010_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AY090460_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB353764_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB818694_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB266536_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
EU498228_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB179747_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
EF157291_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB275308_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB375162_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB375160_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB375159_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
AB375164_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
KX264501_FT00000_P-H      gcccaatcctctgggattctttccagaccaccagttggatccactattca
                          ************************ *************** *********

AY090457_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AY090454_FT00000_C-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB059659_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB059660_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacagacaaggacaat
HM066946_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB059661_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
MT622523_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB064315_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB375163_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
FJ356715_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
HM117850_FT00000_P-H      gagcaaattccagcagtcccgactgggacttcaacacaaacaaggacaat
HM117851_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
FJ356716_FT00000_C-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB375161_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB205010_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AY090460_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB353764_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB818694_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB266536_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
EU498228_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB179747_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
EF157291_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB275308_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB375162_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB375160_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB375159_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
AB375164_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
KX264501_FT00000_P-H      gagcaaattccagcagtcccgattgggacttcaacacaaacaaggacaat
                          ********************** *************** ***********

AY090457_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggctttggtccagggttcac
AY090454_FT00000_C-H      tggccaatggcaaacaaggtaggagtgggaggctttggtccagggttcac
AB059659_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtcccgggttcac
AB059660_FT00000_P-H      tggccaatggcaaacaaggtaggagcgggaggcttcggtccagggttcac
HM066946_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AB059661_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
MT622523_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AB064315_FT00000_P-H      tggccaacagcaaacaaggtaggagtgggaggcttcggtccagggtttac
AB375163_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
FJ356715_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
HM117850_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
HM117851_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggagccttcggtccagggttcac
FJ356716_FT00000_C-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AB375161_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AB205010_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AY090460_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AB353764_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AB818694_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AB266536_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
EU498228_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AB179747_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
EF157291_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AB275308_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AB375162_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AB375160_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AB375159_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
AB375164_FT00000_P-H      tgggcaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
KX264501_FT00000_P-H      tggccaatggcaaacaaggtaggagtgggaggcttcggtccagggttcac
                          *** ***  **************** ***** *** ***** ***** **

AY090457_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AY090454_FT00000_C-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB059659_FT00000_P-H      acccccacacggtgggcttctggggtggagccctcaggcacagggcattc
AB059660_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
HM066946_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB059661_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
MT622523_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB064315_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB375163_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
FJ356715_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
HM117850_FT00000_P-H      acccccacatggtggccttctggggtggagccctcaggcacagggcattc
HM117851_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaagcacagggcattc
FJ356716_FT00000_C-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB375161_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB205010_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AY090460_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB353764_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB818694_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB266536_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
EU498228_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB179747_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
EF157291_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB275308_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB375162_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB375160_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB375159_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
AB375164_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
KX264501_FT00000_P-H      acccccacacggtggccttctggggtggagccctcaggcacagggcattc
                          ********* ***** ******************** *************

AY090457_FT00000_P-H      tgacaacctcgccacccgatccacctcccgcttccaccaatcggaggtca
AY090454_FT00000_C-H      tgacaacctcgccaccagatccacctcccgcttccaccaatcggaggtca
AB059659_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaacaatcggaggtca
AB059660_FT00000_P-H      tgacaaccttgccaccagatccacctcctgcttccaccaatcggaggtca
HM066946_FT00000_P-H      tgacaaccttgccaccagatccacctcctgcttccaccaatcggaggtca
AB059661_FT00000_P-H      tgacaaccttgccaccagatccacctcctgcttccaccaatcggaggtca
MT622523_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccactcggaggtca
AB064315_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
AB375163_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
FJ356715_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
HM117850_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
HM117851_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
FJ356716_FT00000_C-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
AB375161_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
AB205010_FT00000_P-H      taacaacctcgccacccgatccacctcctgcttccaccaatcggaggtca
AY090460_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
AB353764_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
AB818694_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
AB266536_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
EU498228_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
AB179747_FT00000_P-H      taacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
EF157291_FT00000_P-H      taacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
AB275308_FT00000_P-H      taacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
AB375162_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
AB375160_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
AB375159_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
AB375164_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
KX264501_FT00000_P-H      tgacaacctcgccaccagatccacctcctgcttccaccaatcggaggtca
                          * ******* ****** *********** ******* ** **********

AY090457_FT00000_P-H      ggaaggaaaccaaccccagtctctccacctctaagggacacacatccaca
AY090454_FT00000_C-H      ggaaggaaaccaaccccagtctctccacctctaagggacacacatccaca
AB059659_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AB059660_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagagacacacatccaca
HM066946_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AB059661_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
MT622523_FT00000_P-H      ggaagacagccaaccccagtctcttcacctctaaggcacacacatccaca
AB064315_FT00000_P-H      ggaagaaagccaaccccaatctctccacctctaagggacacacatccaca
AB375163_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
FJ356715_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
HM117850_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
HM117851_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
FJ356716_FT00000_C-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AB375161_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AB205010_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AY090460_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AB353764_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AB818694_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AB266536_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
EU498228_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AB179747_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
EF157291_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AB275308_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AB375162_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AB375160_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AB375159_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
AB375164_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
KX264501_FT00000_P-H      ggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
                          *****  * ********* ***** **********  *************

AY090457_FT00000_P-H      ggccatgcagtggaa
AY090454_FT00000_C-H      ggccatgcagtggaa
AB059659_FT00000_P-H      ggccatgcagtggaa
AB059660_FT00000_P-H      ggccatgcagtggaa
HM066946_FT00000_P-H      ggccatgcagtggaa
AB059661_FT00000_P-H      ggccatgcagtggaa
MT622523_FT00000_P-H      nnnnnnnnnnnnnnn
AB064315_FT00000_P-H      ggccatgcagtggaa
AB375163_FT00000_P-H      ggccatgcagtggaa
FJ356715_FT00000_P-H      ggcyatgcagtggaa
HM117850_FT00000_P-H      ggccatgcagtggaa
HM117851_FT00000_P-H      ggccatgcagtggaa
FJ356716_FT00000_C-H      ggccatgcagtggaa
AB375161_FT00000_P-H      ggccatgcagtggaa
AB205010_FT00000_P-H      ggccatgcagtggaa
AY090460_FT00000_P-H      ggccatgcagtggaa
AB353764_FT00000_P-H      ggccatgcagtggaa
AB818694_FT00000_P-H      ggccatgcagtggaa
AB266536_FT00000_P-H      ggccatgcagtggaa
EU498228_FT00000_P-H      ggccatgcagtggaa
AB179747_FT00000_P-H      ggccatgcagtggaa
EF157291_FT00000_P-H      ggccatgcagtggaa
AB275308_FT00000_P-H      ggccatgcagtggaa
AB375162_FT00000_P-H      ggccatgcagtggaa
AB375160_FT00000_P-H      ggccatgcagtggaa
AB375159_FT00000_P-H      ggccatgcagtggaa
AB375164_FT00000_P-H      ggccatgcagtggaa
KX264501_FT00000_P-H      ggccatgcagtggaa

© 1998-2022Legal notice