HBVdb

Dataset for nucleotide sequence C of genotype H

[Download (right click)] [Edit] [Sequences] [Repertoires]

41 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


AB059659_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttctgcct
AB059660_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
FJ356715_C_P-H      atggacatcgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
FJ356716_C_C-H      atggacatcgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AY090454_C_C-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AY090457_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
HM066946_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
HQ285946_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
JX896129_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AB064315_C_P-H      atggacattgacccttataaagaatttggagcttctgcggagttactctcatttttgcct
JX896133_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AB375162_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactcycatttttgcct
JX896130_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactcycatttttgcct
AB375159_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AB375160_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AB375161_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AB205010_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AB266536_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AB353764_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AB818694_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
EU498228_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
KC836867_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AB179747_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
EF157291_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AB275308_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
JX896126_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
HM117851_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
HM117850_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
JX896124_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
JX896134_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
JX915624_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
JX896132_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AB375164_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
KX264501_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AY090460_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AB059661_C_P-H      atggacattgacctttataaagaatttggagcttctgtggagttactctcatttttgcct
JX896128_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
JX896131_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
JX896127_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagtkactctcatttttgcct
AB375163_C_P-H      atggacatcgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
JX896125_C_P-H      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
                    ******** **** *********************** ***** **** ***** *****

AB059659_C_P-H      tctgacttctacccgtctgtccgggacctactcgacaccgcttcagccctccaccgagat
AB059660_C_P-H      actgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
FJ356715_C_P-H      aatgacttcttcccgtctgtccgggatctactcgacaccgcttcagccctccaccgagag
FJ356716_C_C-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctccaccgagat
AY090454_C_C-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
AY090457_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
HM066946_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
HQ285946_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
JX896129_C_P-H      tctgacttcttcccgtctatccgggacctactcgacaccgcttcagccctctaccgagat
AB064315_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgctacagccctctaccgagat
JX896133_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
AB375162_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
JX896130_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
AB375159_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
AB375160_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
AB375161_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
AB205010_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
AB266536_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
AB353764_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
AB818694_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
EU498228_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
KC836867_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
AB179747_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
EF157291_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
AB275308_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
JX896126_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
HM117851_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctacagagat
HM117850_C_P-H      tctgatttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
JX896124_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
JX896134_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
JX915624_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
JX896132_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
AB375164_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
KX264501_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
AY090460_C_P-H      tctgacttcttcccgtctgtccgggacctgctcgacaccgcttcagccctctaccgagat
AB059661_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
JX896128_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
JX896131_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
JX896127_C_P-H      tctgacttcttcccgtctgtccgggacctacycgacaccgcttcagccctctaccgagat
AB375163_C_P-H      tctgatttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
JX896125_C_P-H      tctgacttcttcccgtctgtccgggacctactcgacaccgcttcagccctctaccgagat
                      *** **** ******* ******* ** * ********** ******** ** **** 

AB059659_C_P-H      gccttagaatcacccgaacattgctccccccaccacactgctctcaggcaagctgtttcg
AB059660_C_P-H      gccttagaatcacccgaacattgcaccccccaccatactgccatcaggcaagttattttg
FJ356715_C_P-H      gccttagaatctcccgatcattgcacccccaaccacactgctctcaggcaagctatttcg
FJ356716_C_C-H      gccttagaatcacccgatcattgcacccccaaccacactgctctcaggcaagctatttcg
AY090454_C_C-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattctg
AY090457_C_P-H      gccttagaatctcccgaacattgcacccccaaccatactgctctcaggcaagctattctg
HM066946_C_P-H      gccttagaatcacccgaacattgcacccccagccatactgctctcaggcaagctattttg
HQ285946_C_P-H      gccttagaatcacccgaacattgcacccccagccatactgctctcaggcaagctattttg
JX896129_C_P-H      gccttagaatcacccgaacattgctcccccaaccacactgctatcaggcaagctattttg
AB064315_C_P-H      gccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
JX896133_C_P-H      gccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
AB375162_C_P-H      gccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
JX896130_C_P-H      gccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
AB375159_C_P-H      gccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
AB375160_C_P-H      gccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
AB375161_C_P-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
AB205010_C_P-H      gccttagaatcaccagaacattgcacccctagccacactgctctcaggcaagctattttg
AB266536_C_P-H      gccttagaatcaccagaacattgcacccccaaccacactgctctcaggcaagctattttg
AB353764_C_P-H      gccttagaatcaccagaacattgcacccccaaccacactgctctcaggcaagctattttg
AB818694_C_P-H      gccttagaatcaccagaacattgcacccccaaccacactgctctcaggcaagctattttg
EU498228_C_P-H      gccttagaatcaccagaacattgcacccccaaccacactgctctcaggcaagctattttg
KC836867_C_P-H      gccttagaatcaccagaacattgcacccccaaccacactgctctcaggcaagctattttg
AB179747_C_P-H      gccttagaatcaccagaacattgcacccccaaccacactgctctcaggcaagctattttg
EF157291_C_P-H      gccttagaatcaccagaacattgcacccccaaccacactgctctcaggcaagctattttg
AB275308_C_P-H      gccttagaatcacctgaacattgcacccccaaccacactgctctcaggcaagctattttg
JX896126_C_P-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
HM117851_C_P-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
HM117850_C_P-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
JX896124_C_P-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
JX896134_C_P-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
JX915624_C_P-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
JX896132_C_P-H      gccttagaatcacccgaacattgcacccccaaccrcactgctctcaggcaagctattttg
AB375164_C_P-H      gccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
KX264501_C_P-H      gccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
AY090460_C_P-H      gccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
AB059661_C_P-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
JX896128_C_P-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
JX896131_C_P-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
JX896127_C_P-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
AB375163_C_P-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
JX896125_C_P-H      gccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
                    *********** ** ** ****** ****   **  *****  ********* * **  *

AB059659_C_P-H      tgctggcgggaggtgacggacttcggtgactgggtgggcaataatttacaggatcaggca
AB059660_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttaaatgatcctgca
FJ356715_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
FJ356716_C_C-H      tgctggggtgagttgatgaacttggcttcctgggtgggcaataatttagaggatcctgca
AY090454_C_C-H      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttagaggatcctgcg
AY090457_C_P-H      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttagaggatcctgcg
HM066946_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
HQ285946_C_P-H      tgttggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
JX896129_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggccataatttagaggatcctgca
AB064315_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
JX896133_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
AB375162_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
JX896130_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
AB375159_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
AB375160_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
AB375161_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
AB205010_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgga
AB266536_C_P-H      tgctggggtgagttgatgacattggcttcctgggtgggcaataatttagaggatcctgca
AB353764_C_P-H      tgctggggtgagttgatgacattggcttcctgggtgggcaataatttagaggatcctgca
AB818694_C_P-H      tgctggggtgagttgatgacattggcttcctgggtgggcaataatttagaggatcctgca
EU498228_C_P-H      tgctggggtgagttgatgacattggcttcctgggtgggcaataatttagaggatcctgca
KC836867_C_P-H      tgctggggtgagttgatgacattggcttcctgggtgggcaataatttagaggatcctgca
AB179747_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
EF157291_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
AB275308_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
JX896126_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
HM117851_C_P-H      tgctggggtgagttgatgactttggcttcctgggtgggcaataatttagaggatcctgca
HM117850_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
JX896124_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
JX896134_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
JX915624_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
JX896132_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
AB375164_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
KX264501_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
AY090460_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
AB059661_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
JX896128_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
JX896131_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
JX896127_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
AB375163_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
JX896125_C_P-H      tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgca
                    ** *** * *** * * *   ** * *  ********** ******** * ****  *  

AB059659_C_P-H      gcaagagatctagtagttaattatgtcaatgctaacataggtctaaaaattagacaatta
AB059660_C_P-H      gccagagatctagtagttaattatgtcaatactcatatgggcctaaaaattagacaattg
FJ356715_C_P-H      gcaagagatctagtagttaattatgtcaatgctaacatgggcctaaaaattagacaattc
FJ356716_C_C-H      gcaagagatctagtagttaattatgtcaatgctaacatgggcctaaaaattagacaattc
AY090454_C_C-H      gctagagatctagtagttaattatgtcaacactaatatgggcctaaaaattagacaatta
AY090457_C_P-H      gctagagatctagtagttaattatgtcaacactaatatgggcctaaaaattagacaatta
HM066946_C_P-H      gccagagatcttgtggttaattatgtcaatactaatatgggcctaaaaattagacaatta
HQ285946_C_P-H      gccagagatcttgtagttaattatgtcaatactaatatgggcctaaaaattagacaatta
JX896129_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaatta
AB064315_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
JX896133_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaatta
AB375162_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaatta
JX896130_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaatta
AB375159_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaatta
AB375160_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaatta
AB375161_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaatta
AB205010_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB266536_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB353764_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB818694_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
EU498228_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
KC836867_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB179747_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
EF157291_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB275308_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
JX896126_C_P-H      gcaagagatctagtagttaattatgtcagtactaacatgggcctaaaaattagacaatta
HM117851_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
HM117850_C_P-H      gccagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
JX896124_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
JX896134_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
JX915624_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
JX896132_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB375164_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
KX264501_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AY090460_C_P-H      gcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaatta
AB059661_C_P-H      gccagagatctagtagttaattatgtcaatactaatatgggcctaaaaattagacaatta
JX896128_C_P-H      gccagagatctagtagttaattatgtcaataataatatgggcctaaaaattagacaatta
JX896131_C_P-H      gccagagatctagtagttaattatgtcaatactaatatgggcctaaaaattagacaatta
JX896127_C_P-H      gccagagatctagtagttaattatgtcaatactaatatgggcctaaaaattagacaatta
AB375163_C_P-H      gccagagatctagtagttaattatgtcaatactaatatgggcctaaaaattagacaatta
JX896125_C_P-H      gccagagatctagtagttaattatgtcaatactaatatgggcctaaaaattagacaatta
                    ** ******** ** *************    * * ** ** ***************** 

AB059659_C_P-H      ctatggtttcacatttcctgccttacatttggaagagaaactgtgattgagtatttggtg
AB059660_C_P-H      ttgtggtttcatatttcctgccttacgtttggaagagaaattgttcttgagtatttggtg
FJ356715_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
FJ356716_C_C-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
AY090454_C_C-H      ctatggtttcatatttcctgccttacatttggaagagaaactgttcttgagtatttggtg
AY090457_C_P-H      ctatggtttcatatttcctgccttacatttggaagagatactgttcttgagtatttggtg
HM066946_C_P-H      ttatggtttcatatttcctgccttacatttggaagagaaactgttcttgagtatttggtg
HQ285946_C_P-H      ttatggtttcatatttcctgccttacatttggaagagaaactgttcttgagtatttggtg
JX896129_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
AB064315_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
JX896133_C_P-H      ttatggtttcacatttcctgcctaacatttggaagagaaactgtgcttgagtatttggtg
AB375162_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
JX896130_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
AB375159_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
AB375160_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
AB375161_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
AB205010_C_P-H      ttatggtttcacatttcttgccttacatttggaagagaaactgtgcttgagtatttggtg
AB266536_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
AB353764_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
AB818694_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
EU498228_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
KC836867_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
AB179747_C_P-H      ttatggtttcacatttcttgccttacatttggaagagaaactgtgcttgagtatttggtg
EF157291_C_P-H      ttatggtttcacatttcttgccttacatttggaagagaaactgtgcttgagtatttggtg
AB275308_C_P-H      ttatggtttcacatttcttgccttacatttggaagagaaactgtgcttgagtatttggtg
JX896126_C_P-H      ttatggtttcatatttcctsccttacatttggaagagaaactgtgcttgagtatttggtg
HM117851_C_P-H      ttatggtttcatatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
HM117850_C_P-H      ttatggtttcatatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
JX896124_C_P-H      ttrtggtttcatatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
JX896134_C_P-H      ttatggtttcatatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
JX915624_C_P-H      ttgtggtttcatatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
JX896132_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
AB375164_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
KX264501_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
AY090460_C_P-H      ttatggtttcacatttcctgccttacatttggaagagaaactgtgcttgagtatttggtg
AB059661_C_P-H      ttatggtttcatatttcctgccttacatttggaagagatactgttcttgagtatctggtg
JX896128_C_P-H      ttatggtttcatatttcctgccttacatttggaagagatactgttcttgagtatttggtg
JX896131_C_P-H      ttatggtytcatatttcctgccttacatttggaagagaaactgttcttgagtatttggtg
JX896127_C_P-H      ttatggtttcatatttcctgccttacatttggaagagaaactgttcttgagtatttggtg
AB375163_C_P-H      ttatggtttcatatttcctgccttacatttggaagagaaactgttcttgagtatttggtg
JX896125_C_P-H      ttatggtttcatatttcctgccttacatttggaagagaaactgttcttgagtatttggtg
                     * **** *** ***** * *** ** *********** * ***  ******** *****

AB059659_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB059660_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatcctg
FJ356715_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
FJ356716_C_C-H      tcttttggagtgtggattcgcactccacytgcttatagaccaccaaatgcccctatccta
AY090454_C_C-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AY090457_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
HM066946_C_P-H      tcttttggagtgtggattcgcactccgcctggttatagaccaccaaatgcccctatccta
HQ285946_C_P-H      tcttttggagtgtggattcgcactccgcctggttatagaccaccaaatgcccctatccta
JX896129_C_P-H      tcttttggagtgtggatccgtactccacctccttacagaccaccaaatgcccctatccta
AB064315_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
JX896133_C_P-H      tcttttggagggtggatccgcactccacctgcttacagaccaccaaatgcccctatccta
AB375162_C_P-H      tcttttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccctatccta
JX896130_C_P-H      tcttttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccctatccta
AB375159_C_P-H      tcttttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccctatccta
AB375160_C_P-H      tcttttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccctatccta
AB375161_C_P-H      tcttttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccctatccta
AB205010_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB266536_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB353764_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB818694_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
EU498228_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KC836867_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB179747_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
EF157291_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB275308_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
JX896126_C_P-H      ycttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
HM117851_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
HM117850_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
JX896124_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
JX896134_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
JX915624_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
JX896132_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB375164_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KX264501_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AY090460_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB059661_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
JX896128_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
JX896131_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
JX896127_C_P-H      tcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB375163_C_P-H      tcttttggagtgtggattcgtactccacctgcttatagaccaccaaatgcccctatccta
JX896125_C_P-H      tcttttggagtgtggattcgtactccacctgcttatagaccaccaaatgcccctatccta
                     ********* ****** ** ***** * *  *** *********************** 

AB059659_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB059660_C_P-H      tcaacaattccggagacttgtgttattagacaacgaggcagggcccctagaggaagaact
FJ356715_C_P-H      tcaacgcttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
FJ356716_C_C-H      tccacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AY090454_C_C-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AY090457_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
HM066946_C_P-H      tcaacacttccggagactactgttattagacaacgaggcagggcccctagaagaagaact
HQ285946_C_P-H      tcaacacttccggagactactgttattagacaacgaggcagggcccctagaagaagaact
JX896129_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB064315_C_P-H      tcaacgcttcctgagtgtactgttattagacaacgaggcagggcccctagaagaagaact
JX896133_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB375162_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
JX896130_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB375159_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB375160_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB375161_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB205010_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB266536_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB353764_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB818694_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
EU498228_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
KC836867_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB179747_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
EF157291_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB275308_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
JX896126_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
HM117851_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
HM117850_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
JX896124_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
JX896134_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
JX915624_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
JX896132_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB375164_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
KX264501_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AY090460_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB059661_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
JX896128_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
JX896131_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
JX896127_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
AB375163_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
JX896125_C_P-H      tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
                    ** **  **** ***  *  **** ************************** ********

AB059659_C_P-H      ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatct
AB059660_C_P-H      ccctcgcctcgcagacgaagatctaaatcaccgcgtcgcagaagatctccatctccagct
FJ356715_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
FJ356716_C_C-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
AY090454_C_C-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
AY090457_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgccgaagatctcaatctccagct
HM066946_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
HQ285946_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
JX896129_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
AB064315_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
JX896133_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgagct
AB375162_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
JX896130_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
AB375159_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
AB375160_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
AB375161_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
AB205010_C_P-H      ccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagct
AB266536_C_P-H      ccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagct
AB353764_C_P-H      ccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagct
AB818694_C_P-H      ccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagct
EU498228_C_P-H      ccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagct
KC836867_C_P-H      ccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagct
AB179747_C_P-H      ccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagct
EF157291_C_P-H      ccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagct
AB275308_C_P-H      ccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagct
JX896126_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
HM117851_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
HM117850_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
JX896124_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
JX896134_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
JX915624_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
JX896132_C_P-H      ccctcgcctcgyagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
AB375164_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
KX264501_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
AY090460_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
AB059661_C_P-H      ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagct
JX896128_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
JX896131_C_P-H      ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagct
JX896127_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
AB375163_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
JX896125_C_P-H      ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagct
                    *********** ************ **** ********* ********* ***** * **

AB059659_C_P-H      tccaaatgttag
AB059660_C_P-H      tcccaatgttag
FJ356715_C_P-H      tcccaatgttag
FJ356716_C_C-H      tcccaatgttag
AY090454_C_C-H      tcccaatgttag
AY090457_C_P-H      tcccaatgttag
HM066946_C_P-H      tcccaatgttag
HQ285946_C_P-H      tcccaatgttag
JX896129_C_P-H      tcccaatgttag
AB064315_C_P-H      tcccaatgttag
JX896133_C_P-H      tcccaatgttag
AB375162_C_P-H      tcccaatgttag
JX896130_C_P-H      tcccaatgttag
AB375159_C_P-H      tcccaatgttag
AB375160_C_P-H      tcccaatgttag
AB375161_C_P-H      tcccaatgttag
AB205010_C_P-H      tcccaatgttag
AB266536_C_P-H      tcccaatgttag
AB353764_C_P-H      tcccaatgttag
AB818694_C_P-H      tcccaatgttag
EU498228_C_P-H      tcccaatgttag
KC836867_C_P-H      tcccaatgttag
AB179747_C_P-H      tcccaatgttag
EF157291_C_P-H      tcccaatgttag
AB275308_C_P-H      tcccaatgttag
JX896126_C_P-H      tcccaatgttag
HM117851_C_P-H      tcccaatgttag
HM117850_C_P-H      tcccaatgttag
JX896124_C_P-H      tcccaatgttag
JX896134_C_P-H      tcccaatgttag
JX915624_C_P-H      tcccaatgttag
JX896132_C_P-H      tcccaatgttag
AB375164_C_P-H      tcccaatgttag
KX264501_C_P-H      tcccaatgttag
AY090460_C_P-H      tcccaatgttag
AB059661_C_P-H      tcccaatgttag
JX896128_C_P-H      tcccaatgttag
JX896131_C_P-H      tcccaatgttag
JX896127_C_P-H      tcccaatgttag
AB375163_C_P-H      tcccaatgttag
JX896125_C_P-H      tcccartgttag
                    *** * ******

© 1998-2020Legal notice