Dataset for nucleotide sequence X of genotype G

[Download (right click)] [Edit] [Sequences] [Repertoires]

84 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

EF464097_X_P-G      atggctgctaggctgtgctgccatatcgaccctttcagggacgtcctttgtttacgtccc
JQ707436_X_P-G      ctggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707680_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707677_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707657_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707660_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707668_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707671_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707673_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707678_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707679_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707666_X_P-G      atggctgctaggctgtgctgccacctggatccttcgcgggacgtcctttgtttacgtccc
HE981174_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
GU565217_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
EF464098_X_P-G      atggcagctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB064313_X_C-G      atggctgctaggctgtgccgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB064311_X_P-G      atggctgctaggctgtgccgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB056514_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
GU563556_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR230749_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
MT426120_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KF767452_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KF414679_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
HE981171_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
HE981172_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
EF634480_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
DQ207798_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AF160501_X_C-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB375168_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB056516_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KF767450_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB056513_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AF405706_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB056515_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB064310_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB064312_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB375165_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB375166_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB375167_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB375169_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB375170_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KX264500_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KY004111_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
HE981175_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
HE981176_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ194508_X_P-G      ctggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811774_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811767_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgcccc
KR811806_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811775_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
KR811777_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811791_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811780_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811794_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811785_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KM998716_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811800_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811783_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811792_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811804_X_P-G      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KR811797_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811793_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811790_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811786_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811784_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcccttgtttacgtccc
KR811782_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811788_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811802_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811807_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811768_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811773_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811765_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811770_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811781_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811789_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KF767451_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811460_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811461_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811771_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811772_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811776_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KR811795_X_P-G      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
FJ023674_X_P-G      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FR714503_X_P-G      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
                     **** ************ ****  * ** ***    ********* **** **** ***

EF464097_X_P-G      gtcagcgttgaatccagcggacgacccctcctggggtcgtttggggatctgtcgccccct
JQ707436_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
JQ707680_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
JQ707677_X_P-G      gacagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
JQ707657_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
JQ707660_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
JQ707668_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
JQ707671_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
JQ707673_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
JQ707678_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
JQ707679_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
JQ707666_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
HE981174_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
GU565217_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
EF464098_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AB064313_X_C-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AB064311_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AB056514_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgacccct
GU563556_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR230749_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
MT426120_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KF767452_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KF414679_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
HE981171_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
HE981172_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
EF634480_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
DQ207798_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AF160501_X_C-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AB375168_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AB056516_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KF767450_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
AB056513_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AF405706_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AB056515_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AB064310_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AB064312_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AB375165_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AB375166_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AB375167_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AB375169_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
AB375170_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KX264500_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KY004111_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
HE981175_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
HE981176_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KJ194508_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811774_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811767_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811806_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811775_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811777_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811791_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811780_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811794_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811785_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KM998716_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811800_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811783_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811792_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811804_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811797_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811793_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811790_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811786_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811784_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811782_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811788_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811802_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811807_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811768_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811773_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccct
KR811765_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811770_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811781_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811789_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KF767451_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811460_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811461_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811771_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811772_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811776_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
KR811795_X_P-G      gtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccct
FJ023674_X_P-G      gtcggcgctgaatccagcggacgacccctctcggggccggttggggatctaccgtcccct
FR714503_X_P-G      gtcggcgctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcctct
                    * * *** ******* **************  **** ** ****** ***  ** ** **

EF464097_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccggtc
JQ707436_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707680_X_P-G      tctccgtctgccgttcctgccgcccacggggcgcacctctctttacgcggtctccccgtc
JQ707677_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707657_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707660_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707668_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707671_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707673_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707678_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707679_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707666_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
HE981174_X_P-G      tctccgtctgtcgttcctgccgaccacggggcgcacctctatttacgcggtctccccgtc
GU565217_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
EF464098_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB064313_X_C-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB064311_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB056514_X_P-G      tctccgtttgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
GU563556_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR230749_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
MT426120_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KF767452_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KF414679_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
HE981171_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
HE981172_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
EF634480_X_P-G      tctccgtctgtcgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
DQ207798_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AF160501_X_C-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB375168_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB056516_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KF767450_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB056513_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AF405706_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB056515_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB064310_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB064312_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB375165_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB375166_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB375167_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB375169_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
AB375170_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KX264500_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KY004111_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
HE981175_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
HE981176_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KJ194508_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811774_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811767_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811806_X_P-G      tctccgtctgccgttcctgccgaccacggggcgaacctctctttacgcggtctccccgtc
KR811775_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811777_X_P-G      tctccgtctaccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811791_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811780_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811794_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811785_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KM998716_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811800_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811783_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttccgcggtctccccgtc
KR811792_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811804_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811797_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811793_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811790_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811786_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811784_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811782_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811788_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811802_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811807_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811768_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811773_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811765_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811770_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811781_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811789_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KF767451_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811460_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811461_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811771_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811772_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811776_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
KR811795_X_P-G      tctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtc
FJ023674_X_P-G      tctccgtctgccgtaccggccgwccacggggcgcacctctctttacgcggactccccgag
FR714503_X_P-G      tcttcatctgccgtaccgaccgtccacggggcgcacctctctttacgcggtctccccgtc
                    *** * * *  *** **  *** ********** ****** *** ***** ***** *  

EF464097_X_P-G      tgttccttctcatctgccggaccgtgtgcactttgcttcacctctgcacgttacatggaa
JQ707436_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
JQ707680_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
JQ707677_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
JQ707657_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
JQ707660_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
JQ707668_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
JQ707671_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
JQ707673_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
JQ707678_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
JQ707679_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
JQ707666_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
HE981174_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
GU565217_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
EF464098_X_P-G      tgttccttctcatctgccggaccgtgtgcactttgcttcacctctgcacgttacatggaa
AB064313_X_C-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AB064311_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AB056514_X_P-G      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
GU563556_X_P-G      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR230749_X_P-G      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
MT426120_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KF767452_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KF414679_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
HE981171_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
HE981172_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
EF634480_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
DQ207798_X_P-G      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AF160501_X_C-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AB375168_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AB056516_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KF767450_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AB056513_X_P-G      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AF405706_X_P-G      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AB056515_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AB064310_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AB064312_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AB375165_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AB375166_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AB375167_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AB375169_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
AB375170_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KX264500_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KY004111_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
HE981175_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
HE981176_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KJ194508_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811774_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811767_X_P-G      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811806_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811775_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgctccacctctgcacgttacatggaa
KR811777_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811791_X_P-G      tgttccttctcatctgccggaccgtgtgcactttgcttcacctctgcacgttacatggaa
KR811780_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811794_X_P-G      tgttcctcctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811785_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcaccgctgcacgttacatggaa
KM998716_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811800_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811783_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811792_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811804_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811797_X_P-G      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811793_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811790_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811786_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811784_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811782_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811788_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811802_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811807_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811768_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811773_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811765_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811770_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811781_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811789_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KF767451_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811460_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811461_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811771_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811772_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811776_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
KR811795_X_P-G      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
FJ023674_X_P-G      tgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
FR714503_X_P-G      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
                    *** ***  ************************ *** **** ********  ****** 

EF464097_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
JQ707436_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
JQ707680_X_P-G      accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactg
JQ707677_X_P-G      accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactg
JQ707657_X_P-G      accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactg
JQ707660_X_P-G      accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactg
JQ707668_X_P-G      accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactg
JQ707671_X_P-G      accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactg
JQ707673_X_P-G      accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactg
JQ707678_X_P-G      accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactg
JQ707679_X_P-G      accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactg
JQ707666_X_P-G      accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactg
HE981174_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
GU565217_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactattggactg
EF464098_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
AB064313_X_C-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
AB064311_X_P-G      accgccatgaacacctatcatcatctgccaaggcagttatataagaggactcttggactg
AB056514_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
GU563556_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
KR230749_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
MT426120_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
KF767452_X_P-G      accgccatgaacacctctcatcctctgccaaggcagttatataagaggactcttggactg
KF414679_X_P-G      accgccatgaacacctctcatcctctgccaaggcagttatataagaggactcttggactg
HE981171_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
HE981172_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
EF634480_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
DQ207798_X_P-G      accgccatgaacacctctcatcctctgccaaggcagttatataagaggactcttggactg
AF160501_X_C-G      accgccatgaacacctctcatcatctgccaaggcagttatataagtggactcttggactg
AB375168_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
AB056516_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
KF767450_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
AB056513_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
AF405706_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
AB056515_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
AB064310_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
AB064312_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
AB375165_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
AB375166_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
AB375167_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
AB375169_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
AB375170_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
KX264500_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
KY004111_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
HE981175_X_P-G      accgccatgaacacctctcatcatctaccaaggcagttatataagaggactcttggactg
HE981176_X_P-G      accgccatgaacacctctcatcatctaccaaggcagttatataagaggactcttggactg
KJ194508_X_P-G      accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactg
KR811774_X_P-G      tccgccatgaacaactctcatccactgccaaggcagttatataaggggactcttggactg
KR811767_X_P-G      accgccatgaacaactctcatcctccgccaaggcagttatataagaggactcttggactg
KR811806_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811775_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811777_X_P-G      accgccatgaacaactcccatcctctgccaaggcagttatataagaggactcttggactg
KR811791_X_P-G      accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactg
KR811780_X_P-G      accgccatgaacaaccctcatcatctgccaaggcagttatataagaggactcttggactg
KR811794_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811785_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KM998716_X_P-G      accgccatgaacacctctcatcctctgccaaagcagttatataagaggactcttggactg
KR811800_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811783_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811792_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811804_X_P-G      accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactg
KR811797_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811793_X_P-G      accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactg
KR811790_X_P-G      accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactg
KR811786_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811784_X_P-G      accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactg
KR811782_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811788_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811802_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811807_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811768_X_P-G      accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactg
KR811773_X_P-G      accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactg
KR811765_X_P-G      accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactg
KR811770_X_P-G      accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactg
KR811781_X_P-G      accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactg
KR811789_X_P-G      accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactg
KF767451_X_P-G      accgccatgaacacctctcatcctctgccaaggcagttatataagaggactcttggactg
KR811460_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811461_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811771_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811772_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811776_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
KR811795_X_P-G      accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactg
FJ023674_X_P-G      accaccgtgaacgcccacctggtattgcccaaggtattgcataagaggactcttggactc
FR714503_X_P-G      accaccgtgaacgcccacttgagcttgcccaaggtattgcataagcggactcttggactc
                     ** ** *****  *            ** * *   **  ***** ***** ******* 

EF464097_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
JQ707436_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
JQ707680_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
JQ707677_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
JQ707657_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
JQ707660_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
JQ707668_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
JQ707671_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
JQ707673_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
JQ707678_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
JQ707679_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
JQ707666_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
HE981174_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
GU565217_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
EF464098_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AB064313_X_C-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AB064311_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AB056514_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
GU563556_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
KR230749_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
MT426120_X_P-G      tgtgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
KF767452_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
KF414679_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
HE981171_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
HE981172_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
EF634480_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
DQ207798_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AF160501_X_C-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AB375168_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttgaaggactgtgtttttgctgagtgg
AB056516_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
KF767450_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AB056513_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AF405706_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AB056515_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtgtttgctgagtgg
AB064310_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AB064312_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AB375165_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AB375166_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AB375167_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AB375169_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
AB375170_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
KX264500_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
KY004111_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
HE981175_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
HE981176_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KJ194508_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811774_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811767_X_P-G      tttgctatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811806_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811775_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgcagagtgg
KR811777_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811791_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811780_X_P-G      tttgtagtgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811794_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811785_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KM998716_X_P-G      tttgttatgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgg
KR811800_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811783_X_P-G      tttgctatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811792_X_P-G      tttgctatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811804_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811797_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811793_X_P-G      tttgttacgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811790_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811786_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811784_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811782_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811788_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811802_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811807_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811768_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811773_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811765_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811770_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811781_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811789_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KF767451_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811460_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811461_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811771_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811772_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811776_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
KR811795_X_P-G      tttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgg
FJ023674_X_P-G      tctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgg
FR714503_X_P-G      tcagcaatgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgg
                    *  *    ****** ****   * ***  ****** ** ******** ***   ** ***

EF464097_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
JQ707436_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
JQ707680_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
JQ707677_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
JQ707657_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
JQ707660_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
JQ707668_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
JQ707671_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
JQ707673_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
JQ707678_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
JQ707679_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
JQ707666_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
HE981174_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
GU565217_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
EF464098_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AB064313_X_C-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgcaggcataaa
AB064311_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AB056514_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
GU563556_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
KR230749_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
MT426120_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
KF767452_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
KF414679_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
HE981171_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
HE981172_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
EF634480_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
DQ207798_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AF160501_X_C-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AB375168_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AB056516_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
KF767450_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AB056513_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AF405706_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AB056515_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AB064310_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AB064312_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AB375165_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AB375166_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AB375167_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AB375169_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
AB375170_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
KX264500_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
KY004111_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
HE981175_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
HE981176_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
KJ194508_X_P-G      gaagaattaggcaatgagtccaggttaatgacctttgtattaggaggctgtaggcataaa
KR811774_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtacgcctaaa
KR811767_X_P-G      gaagaattaggcaatgagtccaggttaatgatttatgtattaggaggctgtaggcataaa
KR811806_X_P-G      gaagaattaggcaataggtccaggttaatgatttatgtattaggaggctgtaggcataaa
KR811775_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811777_X_P-G      gaagaattaggcaatgagtccaggttaatgatttatgtattaggaggctgtaggcataaa
KR811791_X_P-G      gaagaattaggcaatgagtccaggttaatgattattgtattaggaggctgtaggcataaa
KR811780_X_P-G      gaagaattaggcaatgagtccaggttaatgatttatgtattaggaggctgtaggcataaa
KR811794_X_P-G      gaagaattaggcaatgagtccaggttaatgatttatgtattaggaggctgtaggcataaa
KR811785_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KM998716_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811800_X_P-G      gaagaattaggcaatgagtccaggttaacgatttatgtattaggaggctgtaggcataaa
KR811783_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811792_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811804_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811797_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811793_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811790_X_P-G      gaagaattaggcaatgagtccaggttaatgatttatgtattaggaggctgtaggcataaa
KR811786_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattagggggctgtaggcataaa
KR811784_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811782_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811788_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811802_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811807_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811768_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811773_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811765_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811770_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811781_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811789_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KF767451_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811460_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811461_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811771_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811772_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811776_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
KR811795_X_P-G      gaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaa
FJ023674_X_P-G      gaggagttgggggaggagattaggttaaaggtctttgtactgggaggctgtaggcataaa
FR714503_X_P-G      gaggagttgggggaggagattaggttaatgatctttgtactaggaggctgtaggcataaa
                    ** ** ** **  *   *   ******* *     **** * ** ***** * ** ****

EF464097_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
JQ707436_X_P-G      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
JQ707680_X_P-G      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
JQ707677_X_P-G      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
JQ707657_X_P-G      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
JQ707660_X_P-G      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
JQ707668_X_P-G      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
JQ707671_X_P-G      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
JQ707673_X_P-G      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
JQ707678_X_P-G      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
JQ707679_X_P-G      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
JQ707666_X_P-G      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
HE981174_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
GU565217_X_P-G      ttggtctgcgcaccagcaccatggaactttttcacctctgcctaa
EF464098_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB064313_X_C-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB064311_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB056514_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
GU563556_X_P-G      tgggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
KR230749_X_P-G      ttggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
MT426120_X_P-G      ttggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
KF767452_X_P-G      ttggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
KF414679_X_P-G      ttggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
HE981171_X_P-G      ttggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
HE981172_X_P-G      ttggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
EF634480_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
DQ207798_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AF160501_X_C-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB375168_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB056516_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KF767450_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB056513_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AF405706_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB056515_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB064310_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB064312_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB375165_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB375166_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB375167_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB375169_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
AB375170_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KX264500_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KY004111_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
HE981175_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
HE981176_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KJ194508_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811774_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811767_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811806_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811775_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811777_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811791_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811780_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811794_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811785_X_P-G      ttggtctgcgcaccagcaccatgtagctttttcacctctgcctaa
KM998716_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811800_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811783_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811792_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811804_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811797_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811793_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811790_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811786_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811784_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811782_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811788_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811802_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811807_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811768_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811773_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811765_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811770_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811781_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811789_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KF767451_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811460_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811461_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811771_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811772_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811776_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
KR811795_X_P-G      ttggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
FJ023674_X_P-G      ttggtctgttcaccaacaccatgcaactttttcacctctgcctaa
FR714503_X_P-G      ttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
                    * ******  ***** ******* * *******************

© 1998-2022Legal notice