HBVdb

Dataset for nucleotide sequence SP of genotype G

[Download (right click)] [Edit] [Sequences] [Repertoires]

89 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


FJ023674_SP_P-G      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FR714503_SP_P-G      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF779267_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AB056515_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439797_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
KY004111_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
KR230749_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
KM998716_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
KF779357_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
KF779235_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
KF767452_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
KF767451_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
KF414679_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JQ707673_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JQ707671_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439796_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439801_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JQ707657_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439794_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439792_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439793_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
HE981174_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
HE981175_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
HE981176_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
HE981171_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
GU565217_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439779_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439787_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439789_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
EF634480_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AB056513_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AB056514_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AB064310_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AB064311_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AB064312_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AB064313_SP_C-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AB375165_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AB375166_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AB375167_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AB375168_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AB375169_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AB375170_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AF160501_SP_C-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
AF405706_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
DQ207798_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
GU563556_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439795_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JQ707436_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JQ707660_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JQ707666_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JQ707668_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JQ707677_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JQ707678_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JQ707679_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JQ707680_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
KF767450_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
KF779233_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
KJ194508_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
KX264500_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
EF464097_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
EF464098_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
HE981172_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439780_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439781_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439782_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439784_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439785_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439786_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439788_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439791_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439799_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439800_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439802_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439803_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439804_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439805_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439806_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439807_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439808_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439809_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439810_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439811_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439812_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439813_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439814_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439815_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439816_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439817_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
JF439818_SP_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
                     *********** **************** ****************** **

FJ023674_SP_P-G      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FR714503_SP_P-G      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF779267_SP_P-G      ggcaggtctcctcgaagaagaactccctcgcctcgcagagccttctccca
AB056515_SP_P-G      gacaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439797_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacaaagatctca
KY004111_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
KR230749_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
KM998716_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
KF779357_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
KF779235_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
KF767452_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
KF767451_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
KF414679_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JQ707673_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JQ707671_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439796_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439801_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JQ707657_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439794_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439792_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439793_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
HE981174_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
HE981175_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
HE981176_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
HE981171_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
GU565217_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439779_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439787_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439789_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
EF634480_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB056513_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB056514_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB064310_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB064311_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB064312_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB064313_SP_C-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB375165_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB375166_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB375167_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB375168_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB375169_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB375170_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AF160501_SP_C-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AF405706_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
DQ207798_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
GU563556_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439795_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JQ707436_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JQ707660_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JQ707666_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JQ707668_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JQ707677_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JQ707678_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JQ707679_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JQ707680_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
KF767450_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
KF779233_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
KJ194508_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
KX264500_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
EF464097_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
EF464098_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
HE981172_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439780_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439781_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439782_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439784_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439785_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439786_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439788_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439791_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439799_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439800_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439802_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439803_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439804_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439805_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439806_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439807_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439808_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439809_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439810_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439811_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439812_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439813_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439814_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439815_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439816_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439817_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
JF439818_SP_P-G      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
                     * ****** *** **************************      ** **

FJ023674_SP_P-G      atcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcga
FR714503_SP_P-G      atcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcctcga
KF779267_SP_P-G      atagccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AB056515_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439797_SP_P-G      atcgccgcgtcgcaaaagatctgcatctccagcttcccaatgatcctcga
KY004111_SP_P-G      atcgccgcgtcgcagaagatctacatctccagcttcccaatgatcctcga
KR230749_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
KM998716_SP_P-G      atcgccgcgtcgccgaagatctgcatctccagcttcccaatgatcctcga
KF779357_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
KF779235_SP_P-G      atcgccgcgtcgcagaagatctgcatcttcagcttcccaatgatcctcga
KF767452_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
KF767451_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
KF414679_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JQ707673_SP_P-G      atcgccgcgtcgcggaagatctgcatctccagcttcccaatgatcctcga
JQ707671_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439796_SP_P-G      atcgccgcgtcgcagaagatctgcatctcaagcttcccaatgatcctcga
JF439801_SP_P-G      atcgccgcgtcgcagaagatctgcatctcaagcttcccaatgatcctcga
JQ707657_SP_P-G      atcgccgcgtcgcagaagatctgcatctcaagcttcccaatgatcctcga
JF439794_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439792_SP_P-G      atcgccgcgtcgcagaagatctgcatctcaagcttcccaatgatcctcga
JF439793_SP_P-G      atcgccgcgtcgcagaagatctgcatctcaagcttcccaatgatcctcga
HE981174_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
HE981175_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
HE981176_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
HE981171_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
GU565217_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439779_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439787_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439789_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
EF634480_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcca
AB056513_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AB056514_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AB064310_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AB064311_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AB064312_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AB064313_SP_C-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AB375165_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AB375166_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AB375167_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AB375168_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AB375169_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AB375170_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AF160501_SP_C-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
AF405706_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
DQ207798_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
GU563556_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439795_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JQ707436_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JQ707660_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JQ707666_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JQ707668_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JQ707677_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JQ707678_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JQ707679_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JQ707680_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
KF767450_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
KF779233_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
KJ194508_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
KX264500_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
EF464097_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
EF464098_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
HE981172_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439780_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439781_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439782_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439784_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439785_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439786_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439788_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439791_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439799_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439800_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439802_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439803_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439804_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439805_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439806_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439807_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439808_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439809_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439810_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439811_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439812_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439813_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439814_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439815_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439816_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439817_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
JF439818_SP_P-G      atcgccgcgtcgcagaagatctgcatctccagcttcccaatgatcctcga
                     ** **********  *******  ****   *   * *********** *

FJ023674_SP_P-G      ccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaac
FR714503_SP_P-G      ccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaac
KF779267_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AB056515_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439797_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
KY004111_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
KR230749_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
KM998716_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
KF779357_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
KF779235_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
KF767452_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgtctcctgctcaaggcaac
KF767451_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
KF414679_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JQ707673_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JQ707671_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439796_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439801_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JQ707657_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439794_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439792_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439793_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
HE981174_SP_P-G      ccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
HE981175_SP_P-G      ccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
HE981176_SP_P-G      ccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
HE981171_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
GU565217_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439779_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439787_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439789_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
EF634480_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AB056513_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AB056514_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AB064310_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AB064311_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AB064312_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AB064313_SP_C-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AB375165_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AB375166_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AB375167_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AB375168_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AB375169_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AB375170_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AF160501_SP_C-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
AF405706_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
DQ207798_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
GU563556_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439795_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JQ707436_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JQ707660_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JQ707666_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JQ707668_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JQ707677_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JQ707678_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JQ707679_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JQ707680_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
KF767450_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
KF779233_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
KJ194508_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
KX264500_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
EF464097_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
EF464098_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
HE981172_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439780_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439781_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439782_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439784_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439785_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439786_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439788_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439791_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439799_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439800_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439802_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439803_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439804_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439805_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439806_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439807_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439808_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439809_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439810_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439811_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439812_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439813_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439814_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439815_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439816_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439817_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
JF439818_SP_P-G      ccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaac
                     ******* ******** **** ********** *****************

FJ023674_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
FR714503_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
KF779267_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacagaaattgcac
AB056515_SP_P-G      tctatgtatccctcatgttgctgtataaaaccttcggaaggaaattgcac
JF439797_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
KY004111_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
KR230749_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacagaaattgcac
KM998716_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
KF779357_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
KF779235_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
KF767452_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
KF767451_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
KF414679_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacagaaattgcac
JQ707673_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JQ707671_SP_P-G      tctatgtatccctcatgttgctgtacaaaactttcggacggaaattgcac
JF439796_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439801_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JQ707657_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439794_SP_P-G      tctatgtatccctcatgttgctgtacaaaactttcggacggaaattgcac
JF439792_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439793_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
HE981174_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
HE981175_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
HE981176_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
HE981171_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
GU565217_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439779_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439787_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439789_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
EF634480_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AB056513_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AB056514_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AB064310_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AB064311_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AB064312_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AB064313_SP_C-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AB375165_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AB375166_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AB375167_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AB375168_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AB375169_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AB375170_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AF160501_SP_C-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
AF405706_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
DQ207798_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
GU563556_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439795_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JQ707436_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JQ707660_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JQ707666_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JQ707668_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JQ707677_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JQ707678_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JQ707679_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JQ707680_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
KF767450_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
KF779233_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
KJ194508_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
KX264500_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
EF464097_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
EF464098_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
HE981172_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439780_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439781_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439782_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439784_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439785_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439786_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439788_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439791_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439799_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439800_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439802_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439803_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439804_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439805_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439806_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439807_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439808_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439809_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439810_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439811_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439812_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439813_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439814_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439815_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439816_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439817_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
JF439818_SP_P-G      tctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcac
                     ************************* ***** ******  **********

FJ023674_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
FR714503_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
KF779267_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AB056515_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439797_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
KY004111_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
KR230749_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
KM998716_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
KF779357_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
KF779235_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
KF767452_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
KF767451_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggact
KF414679_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JQ707673_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JQ707671_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439796_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439801_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JQ707657_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439794_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439792_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439793_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
HE981174_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
HE981175_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
HE981176_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
HE981171_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
GU565217_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggatt
JF439779_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggatt
JF439787_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggatt
JF439789_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggatt
EF634480_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AB056513_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AB056514_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AB064310_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AB064311_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AB064312_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AB064313_SP_C-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AB375165_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AB375166_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AB375167_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AB375168_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AB375169_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AB375170_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AF160501_SP_C-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
AF405706_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
DQ207798_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
GU563556_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439795_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JQ707436_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JQ707660_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JQ707666_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JQ707668_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JQ707677_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JQ707678_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JQ707679_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JQ707680_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
KF767450_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
KF779233_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
KJ194508_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
KX264500_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
EF464097_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
EF464098_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
HE981172_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439780_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439781_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439782_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439784_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439785_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439786_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439788_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439791_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439799_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439800_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439802_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439803_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439804_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439805_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439806_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439807_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439808_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439809_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439810_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439811_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439812_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439813_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439814_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439815_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439816_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439817_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
JF439818_SP_P-G      ctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
                     ************************************************ *

FJ023674_SP_P-G      gggcctcagcccgtttctcctggctcagtttactag
FR714503_SP_P-G      gggcctcagcccgtttctcctggctcagtttactag
KF779267_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
AB056515_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JF439797_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
KY004111_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
KR230749_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
KM998716_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
KF779357_SP_P-G      gggcctcagcccgtttctcttggctcagtttactag
KF779235_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
KF767452_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
KF767451_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
KF414679_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JQ707673_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JQ707671_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JF439796_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JF439801_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JQ707657_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JF439794_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439792_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439793_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
HE981174_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
HE981175_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
HE981176_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
HE981171_SP_P-G      gggtctcagtccgtttctcatggctcagtttactag
GU565217_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439779_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439787_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439789_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
EF634480_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
AB056513_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
AB056514_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
AB064310_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
AB064311_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
AB064312_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
AB064313_SP_C-G      gggcctcagtccgtttctcttggctcagtttactag
AB375165_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
AB375166_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
AB375167_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
AB375168_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
AB375169_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
AB375170_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
AF160501_SP_C-G      gggcctcagtccgtttctcttggctcagtttactag
AF405706_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
DQ207798_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
GU563556_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JF439795_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JQ707436_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JQ707660_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JQ707666_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JQ707668_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JQ707677_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JQ707678_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JQ707679_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
JQ707680_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
KF767450_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
KF779233_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
KJ194508_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
KX264500_SP_P-G      gggcctcagtccgtttctcttggctcagtttactag
EF464097_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
EF464098_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
HE981172_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439780_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439781_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439782_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439784_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439785_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439786_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439788_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439791_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439799_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439800_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439802_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439803_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439804_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439805_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439806_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439807_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439808_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439809_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439810_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439811_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439812_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439813_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439814_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439815_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439816_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439817_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
JF439818_SP_P-G      gggcctcagtccgtttctcatggctcagtttactag
                     *** ***** ********* ****************

© 1998-2020Legal notice