HBVdb

Dataset for nucleotide sequence PreS2 of genotype G

[Download (right click)] [Edit] [Sequences] [Repertoires]

81 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


EF464097_PreS2_P-G      atgcagtggaactccacccagttccaccaagctctacaaaatcccaaagt
EF464098_PreS2_P-G      atgcagtggaactccacccagttccaccaagctctacaaaatcccaaagt
KF779357_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JF439780_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JF439785_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JF439803_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439804_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439805_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439806_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439807_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439808_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439809_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439810_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439811_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439813_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439814_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439815_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439816_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439817_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439818_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
JF439812_PreS2_P-G      atgcagtggaactctacagcagtccaccaagctctacaaaatcccaaagt
KF414679_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JN604208_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AB056515_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
DQ207798_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctgcaaaatcccaaagt
HE981174_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
HE981175_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
HE981176_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AB064310_PreS2_P-G      ctgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
KF779267_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
KR230749_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
EF634480_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AF405706_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AB375166_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AB375167_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AB375168_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AB375169_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AB375170_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AB064313_PreS2_C-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AB064312_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccacagt
AB056513_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AB056514_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AB064311_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AB375165_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AF160501_PreS2_C-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
GU563556_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
KF767450_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
KF779233_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
KF779235_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
KJ194508_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
KX264500_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
KY004111_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
MK568529_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JQ707436_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
KM998716_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JQ707678_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JQ707679_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JQ707677_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JQ707671_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JQ707657_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JQ707666_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JQ707668_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JQ707673_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JQ707680_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JQ707660_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JF439788_PreS2_P-G      atgcagtggaactctacagcattctaccaagctctacaaaatcccaaagt
JF439792_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JF439793_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
KF767452_PreS2_P-G      atgcagtg---ctctacagcattccaccaagctctacaaaatcccaaagt
KF767451_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JF439781_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JF439782_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JF439786_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JF439791_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JF439784_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
GU565217_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JF439779_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JF439789_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JF439787_PreS2_P-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
FJ023674_PreS2_P-G      atgcagtggaactccacaaccttccaccaagctcttcargatcccagagt
FR714503_PreS2_P-G      atgcagtggaactccaccaccttccaccaagctctacaagatcccagaat
                         *******   *** **     ** ********** **  ****** * *

EF464097_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagagacacagaacc
EF464098_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagagacagcagaac
KF779357_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439780_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439785_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439803_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439804_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439805_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439806_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439807_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439808_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439809_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439810_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439811_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439813_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439814_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439815_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439816_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439817_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439818_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JF439812_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
KF414679_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JN604208_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcaggaatagtgaacc
AB056515_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
DQ207798_PreS2_P-G      caggggcctgta---tcctgctggtggctccagttcaggaacagtgagcc
HE981174_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
HE981175_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
HE981176_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
AB064310_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
KF779267_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
KR230749_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
EF634480_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
AF405706_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
AB375166_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
AB375167_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
AB375168_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
AB375169_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
AB375170_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
AB064313_PreS2_C-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
AB064312_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
AB056513_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
AB056514_PreS2_P-G      caggg---------ttcctgctggtggctccagttcagggatagtgaacc
AB064311_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
AB375165_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
AF160501_PreS2_C-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
GU563556_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
KF767450_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
KF779233_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
KF779235_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
KJ194508_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
KX264500_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
KY004111_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
MK568529_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JQ707436_PreS2_P-G      caggggcctgta---tcctgctggtggctccagttcagggatagtgaacc
KM998716_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JQ707678_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JQ707679_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JQ707677_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JQ707671_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JQ707657_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JQ707666_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JQ707668_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JQ707673_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JQ707680_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JQ707660_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JF439788_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JF439792_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JF439793_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
KF767452_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
KF767451_PreS2_P-G      caggggcctgta---tcctgctggtggctccagttcagggatagtgaacc
JF439781_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JF439782_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JF439786_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JF439791_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JF439784_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
GU565217_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JF439779_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JF439789_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JF439787_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
FJ023674_PreS2_P-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FR714503_PreS2_P-G      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
                        *****          ***********************  * *      *

EF464097_PreS2_P-G      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
EF464098_PreS2_P-G      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KF779357_PreS2_P-G      ctgttccgaatattgcctctcacatctcgtcaatcttctccaggattggg
JF439780_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439785_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439803_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439804_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439805_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439806_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439807_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439808_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439809_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439810_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439811_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439813_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439814_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439815_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439816_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439817_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439818_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439812_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KF414679_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JN604208_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB056515_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaagattggg
DQ207798_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
HE981174_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
HE981175_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
HE981176_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB064310_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KF779267_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KR230749_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
EF634480_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AF405706_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB375166_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB375167_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB375168_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB375169_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB375170_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB064313_PreS2_C-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB064312_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB056513_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB056514_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB064311_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB375165_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AF160501_PreS2_C-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
GU563556_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KF767450_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KF779233_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KF779235_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KJ194508_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KX264500_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KY004111_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
MK568529_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JQ707436_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KM998716_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JQ707678_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JQ707679_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JQ707677_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JQ707671_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JQ707657_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JQ707666_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JQ707668_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JQ707673_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JQ707680_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JQ707660_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439788_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttcaccaggattggg
JF439792_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439793_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KF767452_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KF767451_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439781_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttcaccaggattggg
JF439782_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttcaccaggattggg
JF439786_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttcaccaggattggg
JF439791_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttcaccaggattggg
JF439784_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttcaccaggattggg
GU565217_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JF439779_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttcaccaggattggg
JF439789_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttcaccaggattggg
JF439787_PreS2_P-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
FJ023674_PreS2_P-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcaaggactggg
FR714503_PreS2_P-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggg
                        *** ***** *********** **  ** ********* * * ** ****

EF464097_PreS2_P-G      ggccctgcaccgaacatggagaacatcacatcaggactcctaggacccct
EF464098_PreS2_P-G      ggccctgcaccgaacatggagaacatcacatcaggactcctaggacccct
KF779357_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439780_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439785_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439803_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439804_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439805_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439806_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439807_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439808_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439809_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439810_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439811_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439813_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439814_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439815_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439816_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439817_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439818_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439812_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KF414679_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JN604208_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AB056515_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
DQ207798_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
HE981174_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
HE981175_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
HE981176_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AB064310_PreS2_P-G      gaccctgcaccgaatatggagaacatcacatcaggattcctaggacccct
KF779267_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KR230749_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
EF634480_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AF405706_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AB375166_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AB375167_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AB375168_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AB375169_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AB375170_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AB064313_PreS2_C-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AB064312_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AB056513_PreS2_P-G      gaccctgcaccgaacatggagaatatcacatcaggattcctaggacccct
AB056514_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AB064311_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AB375165_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AF160501_PreS2_C-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
GU563556_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KF767450_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KF779233_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KF779235_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KJ194508_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KX264500_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KY004111_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
MK568529_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JQ707436_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KM998716_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JQ707678_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JQ707679_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JQ707677_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JQ707671_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JQ707657_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JQ707666_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JQ707668_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JQ707673_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JQ707680_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JQ707660_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439788_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439792_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439793_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KF767452_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KF767451_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439781_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439782_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439786_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439791_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439784_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
GU565217_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439779_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439789_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JF439787_PreS2_P-G      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
FJ023674_PreS2_P-G      gaccttgcaccgaacatggagaacatcacatcaggattcctcggacccct
FR714503_PreS2_P-G      gaccctgcaacgaacatggagaacatcacatcaggattcctcggacccct
                        * ** **** **** ******** ************ **** ********

EF464097_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
EF464098_PreS2_P-G      gctcgtgttacaggcggtgtgtttcttgttgacaagaatcctcacaatac
KF779357_PreS2_P-G      gctcgtgttacaggcggggtatttcgtgttgacaagattcttcacaatac
JF439780_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439785_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439803_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439804_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439805_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439806_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439807_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439808_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439809_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439810_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439811_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439813_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439814_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439815_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439816_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439817_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439818_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439812_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KF414679_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JN604208_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AB056515_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
DQ207798_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
HE981174_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
HE981175_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
HE981176_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AB064310_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KF779267_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KR230749_PreS2_P-G      gctcgtgttacaggcgggggttttcttgttgacaagaatcctcacaatac
EF634480_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AF405706_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AB375166_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AB375167_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AB375168_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AB375169_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AB375170_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AB064313_PreS2_C-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AB064312_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AB056513_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AB056514_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AB064311_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AB375165_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
AF160501_PreS2_C-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
GU563556_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KF767450_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KF779233_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KF779235_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KJ194508_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KX264500_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KY004111_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
MK568529_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JQ707436_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KM998716_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JQ707678_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JQ707679_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JQ707677_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JQ707671_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JQ707657_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JQ707666_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JQ707668_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JQ707673_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JQ707680_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JQ707660_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439788_PreS2_P-G      gctcgtgtcacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439792_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439793_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KF767452_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KF767451_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439781_PreS2_P-G      gctcgtgtcacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439782_PreS2_P-G      gctcgtgtcacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439786_PreS2_P-G      gctcgtgtcacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439791_PreS2_P-G      gctcgtgtcacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439784_PreS2_P-G      gctcgtgtcacaggcggggtttttcttgttgacaagaatcctcacaatac
GU565217_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439779_PreS2_P-G      gctcgtgtcacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439789_PreS2_P-G      gctcgtgtcacaggcggggtttttcttgttgacaagaatcctcacaatac
JF439787_PreS2_P-G      gctcgtgtcacaggcggggtttttcttgttgacaagaatcctcacaatac
FJ023674_PreS2_P-G      gctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatac
FR714503_PreS2_P-G      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
                        ******** ********    **** ********* * ** *********

EF464097_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctaggggaagtg
EF464098_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctaggggaagtg
KF779357_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439780_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439785_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439803_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439804_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439805_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439806_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439807_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439808_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439809_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439810_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439811_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439813_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439814_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439815_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439816_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439817_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439818_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439812_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
KF414679_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JN604208_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagta
AB056515_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagcg
DQ207798_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
HE981174_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
HE981175_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
HE981176_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
AB064310_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
KF779267_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
KR230749_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
EF634480_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
AF405706_PreS2_P-G      cacagagtctagactcgtggtggacttctctcaattttctagggggagtg
AB375166_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
AB375167_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
AB375168_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
AB375169_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
AB375170_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
AB064313_PreS2_C-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
AB064312_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
AB056513_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
AB056514_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
AB064311_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
AB375165_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
AF160501_PreS2_C-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
GU563556_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
KF767450_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
KF779233_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
KF779235_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
KJ194508_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
KX264500_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
KY004111_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
MK568529_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JQ707436_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
KM998716_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JQ707678_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JQ707679_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JQ707677_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JQ707671_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JQ707657_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JQ707666_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JQ707668_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JQ707673_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JQ707680_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JQ707660_PreS2_P-G      cacagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439788_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439792_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439793_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
KF767452_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
KF767451_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439781_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439782_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439786_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439791_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439784_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
GU565217_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439779_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439789_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
JF439787_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtg
FJ023674_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggaaca
FR714503_PreS2_P-G      cgcagagtctagactcgtggtggacttctctcaattttctagggggagca
                        * ******************************************* *   

EF464097_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
EF464098_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
KF779357_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439780_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439785_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439803_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439804_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439805_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439806_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439807_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439808_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439809_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439810_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439811_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439813_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439814_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439815_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439816_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439817_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439818_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439812_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
KF414679_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcact
JN604208_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AB056515_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
DQ207798_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
HE981174_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
HE981175_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
HE981176_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AB064310_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
KF779267_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
KR230749_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
EF634480_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AF405706_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AB375166_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AB375167_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AB375168_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AB375169_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AB375170_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AB064313_PreS2_C-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AB064312_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AB056513_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AB056514_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AB064311_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AB375165_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
AF160501_PreS2_C-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
GU563556_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
KF767450_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
KF779233_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
KF779235_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
KJ194508_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
KX264500_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
KY004111_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
MK568529_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JQ707436_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
KM998716_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JQ707678_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JQ707679_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JQ707677_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JQ707671_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JQ707657_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JQ707666_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JQ707668_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JQ707673_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JQ707680_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JQ707660_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439788_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439792_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcact
JF439793_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcact
KF767452_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
KF767451_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439781_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439782_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439786_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439791_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439784_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
GU565217_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439779_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439789_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
JF439787_PreS2_P-G      cccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcacc
FJ023674_PreS2_P-G      accgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
FR714503_PreS2_P-G      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
                         ********* ***** ******************************** 

EF464097_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
EF464098_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KF779357_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439780_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439785_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439803_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439804_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439805_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439806_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439807_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439808_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439809_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439810_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439811_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439813_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439814_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439815_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439816_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439817_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439818_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439812_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KF414679_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtggctgcggc
JN604208_PreS2_P-G      aatctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB056515_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
DQ207798_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HE981174_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HE981175_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HE981176_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB064310_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KF779267_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KR230749_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
EF634480_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AF405706_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB375166_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB375167_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB375168_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB375169_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB375170_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB064313_PreS2_C-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB064312_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB056513_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB056514_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB064311_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB375165_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AF160501_PreS2_C-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
GU563556_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KF767450_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KF779233_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KF779235_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ194508_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KX264500_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY004111_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
MK568529_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JQ707436_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KM998716_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JQ707678_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtttgcggc
JQ707679_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtttgcggc
JQ707677_PreS2_P-G      aatctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggc
JQ707671_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JQ707657_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JQ707666_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JQ707668_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JQ707673_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JQ707680_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JQ707660_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439788_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439792_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439793_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KF767452_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KF767451_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439781_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439782_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439786_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439791_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439784_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
GU565217_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439779_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439789_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JF439787_PreS2_P-G      aatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
FJ023674_PreS2_P-G      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
FR714503_PreS2_P-G      aacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
                        ** *** ********** ********* **************  ******

EF464097_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
EF464098_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KF779357_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439780_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439785_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439803_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439804_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439805_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439806_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439807_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439808_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439809_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439810_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439811_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439813_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439814_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439815_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439816_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439817_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439818_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439812_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KF414679_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JN604208_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AB056515_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
DQ207798_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
HE981174_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
HE981175_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
HE981176_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AB064310_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KF779267_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KR230749_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
EF634480_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AF405706_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AB375166_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AB375167_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AB375168_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AB375169_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AB375170_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AB064313_PreS2_C-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AB064312_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AB056513_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AB056514_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AB064311_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AB375165_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
AF160501_PreS2_C-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
GU563556_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KF767450_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KF779233_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KF779235_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KJ194508_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KX264500_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KY004111_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
MK568529_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JQ707436_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KM998716_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JQ707678_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JQ707679_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JQ707677_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JQ707671_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JQ707657_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JQ707666_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JQ707668_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JQ707673_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JQ707680_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JQ707660_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439788_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439792_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439793_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KF767452_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KF767451_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439781_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439782_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439786_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439791_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439784_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
GU565217_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439779_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439789_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
JF439787_PreS2_P-G      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
FJ023674_PreS2_P-G      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FR714503_PreS2_P-G      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
                        ********** ***************************************

EF464097_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
EF464098_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
KF779357_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439780_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439785_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439803_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439804_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439805_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439806_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439807_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439808_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439809_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439810_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439811_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439813_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439814_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439815_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439816_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439817_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439818_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439812_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
KF414679_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JN604208_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
AB056515_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
DQ207798_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
HE981174_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
HE981175_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
HE981176_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
AB064310_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
KF779267_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
KR230749_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
EF634480_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
AF405706_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
AB375166_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgatttcagg
AB375167_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgatttcagg
AB375168_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgatttcagg
AB375169_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgatttcagg
AB375170_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgatttcagg
AB064313_PreS2_C-G      gttcttctggactatcaaggtatgttgcccgtttgtcccctgattccagg
AB064312_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
AB056513_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
AB056514_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
AB064311_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
AB375165_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
AF160501_PreS2_C-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
GU563556_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
KF767450_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
KF779233_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
KF779235_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
KJ194508_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
KX264500_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
KY004111_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
MK568529_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JQ707436_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
KM998716_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JQ707678_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JQ707679_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JQ707677_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JQ707671_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JQ707657_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JQ707666_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JQ707668_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JQ707673_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JQ707680_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JQ707660_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439788_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439792_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439793_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
KF767452_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
KF767451_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439781_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439782_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439786_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439791_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439784_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
GU565217_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439779_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439789_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
JF439787_PreS2_P-G      gttcttctggactatcaaggtatgttgcccgtttgtcctctgattccagg
FJ023674_PreS2_P-G      gttcttctggattatcarggtatgttgcccgtttgtcctctaattccagg
FR714503_PreS2_P-G      gttcttctggattatcaaggtatgttgcccgtttgtcctctaattccagg
                        *********** ***** ******************** ** *** ****

EF464097_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
EF464098_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
KF779357_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439780_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439785_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439803_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439804_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439805_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439806_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439807_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439808_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439809_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439810_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439811_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439813_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439814_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439815_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439816_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439817_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439818_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439812_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
KF414679_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JN604208_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AB056515_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
DQ207798_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
HE981174_PreS2_P-G      atcctcgaccaccagcacgggaccctgcaaaacctgcacgactcctgctc
HE981175_PreS2_P-G      atcctcgaccaccagcacgggaccctgcaaaacctgcacgactcctgctc
HE981176_PreS2_P-G      atcctcgaccaccagcacgggaccctgcaaaacctgcacgactcctgctc
AB064310_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
KF779267_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
KR230749_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
EF634480_PreS2_P-G      atcctccaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AF405706_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AB375166_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AB375167_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AB375168_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AB375169_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AB375170_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AB064313_PreS2_C-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AB064312_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AB056513_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AB056514_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AB064311_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AB375165_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
AF160501_PreS2_C-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
GU563556_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
KF767450_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
KF779233_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
KF779235_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
KJ194508_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
KX264500_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
KY004111_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
MK568529_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JQ707436_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
KM998716_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JQ707678_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JQ707679_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JQ707677_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JQ707671_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JQ707657_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JQ707666_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JQ707668_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JQ707673_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JQ707680_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JQ707660_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439788_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439792_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439793_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
KF767452_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgtctcctgctc
KF767451_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439781_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439782_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439786_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439791_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439784_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
GU565217_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439779_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439789_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
JF439787_PreS2_P-G      atcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctc
FJ023674_PreS2_P-G      atcctcgaccaccagtacgggaccctgcagaacctgcacgactcctgctc
FR714503_PreS2_P-G      atcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctc
                        ****** ******** ******** **** ********** *********

EF464097_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
EF464098_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
KF779357_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439780_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439785_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439803_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439804_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439805_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439806_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439807_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439808_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439809_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439810_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439811_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439813_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439814_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439815_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439816_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439817_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439818_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439812_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
KF414679_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacaga
JN604208_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AB056515_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtataaaaccttcggaagga
DQ207798_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
HE981174_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
HE981175_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
HE981176_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AB064310_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
KF779267_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacaga
KR230749_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacaga
EF634480_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AF405706_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AB375166_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AB375167_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AB375168_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AB375169_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AB375170_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AB064313_PreS2_C-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AB064312_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AB056513_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AB056514_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AB064311_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AB375165_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
AF160501_PreS2_C-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
GU563556_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
KF767450_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
KF779233_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
KF779235_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
KJ194508_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
KX264500_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
KY004111_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
MK568529_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JQ707436_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
KM998716_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JQ707678_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JQ707679_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JQ707677_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JQ707671_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaactttcggacgga
JQ707657_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JQ707666_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JQ707668_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JQ707673_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JQ707680_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JQ707660_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439788_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439792_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439793_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
KF767452_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
KF767451_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439781_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439782_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439786_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439791_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439784_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
GU565217_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439779_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439789_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
JF439787_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
FJ023674_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
FR714503_PreS2_P-G      aaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacgga
                        ********************************* ***** ******  **

EF464097_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
EF464098_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
KF779357_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439780_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439785_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439803_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439804_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439805_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439806_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439807_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439808_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439809_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439810_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439811_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439813_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439814_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439815_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439816_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439817_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439818_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439812_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
KF414679_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JN604208_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AB056515_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
DQ207798_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
HE981174_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
HE981175_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
HE981176_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AB064310_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
KF779267_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
KR230749_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
EF634480_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AF405706_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AB375166_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AB375167_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AB375168_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AB375169_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AB375170_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AB064313_PreS2_C-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AB064312_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AB056513_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AB056514_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AB064311_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AB375165_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
AF160501_PreS2_C-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
GU563556_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
KF767450_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
KF779233_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
KF779235_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
KJ194508_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
KX264500_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
KY004111_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
MK568529_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JQ707436_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
KM998716_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JQ707678_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JQ707679_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JQ707677_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JQ707671_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JQ707657_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JQ707666_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JQ707668_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JQ707673_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JQ707680_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JQ707660_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439788_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439792_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439793_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
KF767452_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
KF767451_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439781_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439782_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439786_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439791_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439784_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
GU565217_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439779_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439789_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
JF439787_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
FJ023674_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
FR714503_PreS2_P-G      aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacct
                        **************************************************

EF464097_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
EF464098_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
KF779357_PreS2_P-G      atgggagtgggcctcagcccgtttctcttggctcagtttactagtgccat
JF439780_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439785_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439803_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439804_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439805_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439806_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439807_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439808_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439809_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439810_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439811_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439813_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439814_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439815_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439816_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439817_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439818_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439812_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
KF414679_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JN604208_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AB056515_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
DQ207798_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
HE981174_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
HE981175_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
HE981176_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AB064310_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
KF779267_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
KR230749_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
EF634480_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AF405706_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AB375166_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AB375167_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AB375168_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AB375169_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AB375170_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AB064313_PreS2_C-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AB064312_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AB056513_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AB056514_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AB064311_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AB375165_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
AF160501_PreS2_C-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
GU563556_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
KF767450_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
KF779233_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
KF779235_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
KJ194508_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
KX264500_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
KY004111_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
MK568529_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
JQ707436_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
KM998716_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
JQ707678_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
JQ707679_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
JQ707677_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
JQ707671_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
JQ707657_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
JQ707666_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
JQ707668_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
JQ707673_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
JQ707680_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
JQ707660_PreS2_P-G      atgggagtgggcctcagtccgtttctcttggctcagtttactagtgccat
JF439788_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439792_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439793_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
KF767452_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
KF767451_PreS2_P-G      atgggactgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439781_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439782_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439786_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439791_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439784_PreS2_P-G      atgggagtgggcctcagtccgtttctcatggctcagtttactagtgccat
GU565217_PreS2_P-G      atgggattgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439779_PreS2_P-G      atgggattgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439789_PreS2_P-G      atgggattgggcctcagtccgtttctcatggctcagtttactagtgccat
JF439787_PreS2_P-G      atgggattgggcctcagtccgtttctcatggctcagtttactagtgccat
FJ023674_PreS2_P-G      atgggagtgggcctcagcccgtttctcctggctcagtttactagcgccat
FR714503_PreS2_P-G      atgggagtgggcctcagcccgtttctcctggctcagtttactagtgccat
                        ****** ********** ********* **************** *****

EF464097_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
EF464098_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
KF779357_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
JF439780_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439785_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439803_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439804_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439805_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439806_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439807_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439808_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439809_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439810_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439811_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439813_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439814_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439815_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439816_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439817_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439818_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439812_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctctcagctatg
KF414679_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtttggctttcagctatg
JN604208_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagttata
AB056515_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
DQ207798_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
HE981174_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
HE981175_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
HE981176_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AB064310_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
KF779267_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
KR230749_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
EF634480_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AF405706_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AB375166_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AB375167_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AB375168_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AB375169_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AB375170_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AB064313_PreS2_C-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AB064312_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AB056513_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AB056514_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AB064311_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AB375165_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
AF160501_PreS2_C-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
GU563556_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
KF767450_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
KF779233_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
KF779235_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
KJ194508_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
KX264500_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
KY004111_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
MK568529_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
JQ707436_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
KM998716_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
JQ707678_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
JQ707679_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
JQ707677_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
JQ707671_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
JQ707657_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
JQ707666_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
JQ707668_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
JQ707673_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
JQ707680_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
JQ707660_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctata
JF439788_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439792_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439793_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
KF767452_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
KF767451_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439781_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439782_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439786_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439791_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439784_PreS2_P-G      ttgttcagtggttcgtagggctttcccacactgtctggctttcagctatg
GU565217_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439779_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439789_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
JF439787_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagctatg
FJ023674_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagttata
FR714503_PreS2_P-G      ttgttcagtggttcgtagggctttcccccactgtctggctttcagttata
                        *************************** ****** ***** **** *** 

EF464097_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
EF464098_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
KF779357_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439780_PreS2_P-G      tggatgatgtggtattggggaccaaatctgtacaacatcttgagtccctt
JF439785_PreS2_P-G      tggatgatgtggtattggggaccaaatctgtacaacatcttgagtccctt
JF439803_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439804_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439805_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439806_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439807_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439808_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439809_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439810_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439811_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439813_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439814_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439815_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439816_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439817_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439818_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439812_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
KF414679_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JN604208_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AB056515_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
DQ207798_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
HE981174_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
HE981175_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
HE981176_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AB064310_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
KF779267_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
KR230749_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
EF634480_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AF405706_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AB375166_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AB375167_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AB375168_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AB375169_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AB375170_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AB064313_PreS2_C-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AB064312_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AB056513_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AB056514_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AB064311_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AB375165_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
AF160501_PreS2_C-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
GU563556_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
KF767450_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
KF779233_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
KF779235_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
KJ194508_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
KX264500_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
KY004111_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
MK568529_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JQ707436_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
KM998716_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JQ707678_PreS2_P-G      tcgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JQ707679_PreS2_P-G      ttgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JQ707677_PreS2_P-G      ttgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JQ707671_PreS2_P-G      ttgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JQ707657_PreS2_P-G      ttgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JQ707666_PreS2_P-G      ttgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JQ707668_PreS2_P-G      ttgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JQ707673_PreS2_P-G      ttgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JQ707680_PreS2_P-G      ttgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JQ707660_PreS2_P-G      ttgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439788_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439792_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439793_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
KF767452_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
KF767451_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctt
JF439781_PreS2_P-G      tggatgatattgtattgggggccaaatctgtacaacatcttgagtccctt
JF439782_PreS2_P-G      tggatgatattgtattgggggccaaatctgtacaacatcttgagtccctt
JF439786_PreS2_P-G      tggatgatattgtattgggggccaaatctgtacaacatcttgagtccctt
JF439791_PreS2_P-G      tggatgatattgtattgggggccaaatctgtacaacatcttgagtccctt
JF439784_PreS2_P-G      tggatgatattgtattgggggccaaatctgtacaacatcttgagtccctt
GU565217_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439779_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439789_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
JF439787_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
FJ023674_PreS2_P-G      tggatgatgtggtattgggggccaaatctgtacamcaccttgagtccatt
FR714503_PreS2_P-G      tggatgatgtggtattgggggccaagtctgtacaacatcttgaggccatt
                        * ****** * ********* **** ******** ** ****** ** **

EF464097_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatttaa
EF464098_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatttaa
KF779357_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JF439780_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439785_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439803_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439804_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439805_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439806_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439807_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439808_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439809_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439810_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439811_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439813_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439814_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439815_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439816_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439817_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439818_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
JF439812_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatctaa
KF414679_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JN604208_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AB056515_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
DQ207798_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
HE981174_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
HE981175_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
HE981176_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AB064310_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
KF779267_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
KR230749_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
EF634480_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AF405706_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AB375166_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AB375167_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AB375168_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AB375169_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AB375170_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AB064313_PreS2_C-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AB064312_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AB056513_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AB056514_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AB064311_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AB375165_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
AF160501_PreS2_C-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
GU563556_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
KF767450_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
KF779233_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
KF779235_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
KJ194508_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
KX264500_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
KY004111_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
MK568529_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JQ707436_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
KM998716_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JQ707678_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JQ707679_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JQ707677_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JQ707671_PreS2_P-G      tttaccgctgttaccaattttcttttgtctttgggtatacatctaa
JQ707657_PreS2_P-G      tttaccgctgttaccaattttcttttgtctttgggtatacatctaa
JQ707666_PreS2_P-G      tttaccgctgttaccaattttcttttgtctttgggtatacatctaa
JQ707668_PreS2_P-G      tttaccgctgttaccaattttcttttgtctttgggtatacatctaa
JQ707673_PreS2_P-G      tttaccgctgttaccaattttcttttgtctttgggtatacatctaa
JQ707680_PreS2_P-G      tttaccgctgttaccaattttcttttgtctttgggtatacatctaa
JQ707660_PreS2_P-G      tttaccgctgttaccaattttcttttgtctttgggtatacatctaa
JF439788_PreS2_P-G      tataccgctgttaccaattttcttgtgtctttgggtatacatccaa
JF439792_PreS2_P-G      tttaccgctgttaccaattttcttttgtctttgggtatacatctaa
JF439793_PreS2_P-G      tttaccgctgttaccaattttcttttgtctttgggtatacatctaa
KF767452_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
KF767451_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JF439781_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JF439782_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JF439786_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JF439791_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JF439784_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
GU565217_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JF439779_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JF439789_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
JF439787_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatctaa
FJ023674_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatttaa
FR714503_PreS2_P-G      tataccgctgttaccaattttcttttgtctttgggtatacatttaa
                        * ********************** *****************  **

© 1998-2020Legal notice