Dataset for nucleotide sequence PreS1 of genotype G

[Download (right click)] [Edit] [Sequences] [Repertoires]

83 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

EF464097_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
EF464098_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JN604208_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----ggggaaga
KF414679_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
DQ207798_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
KF779357_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439792_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439793_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439780_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439785_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439803_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439804_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439805_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439806_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439807_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439808_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439809_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439810_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439811_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439813_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439814_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439815_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439816_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439817_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439818_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439812_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
KF767452_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439788_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439787_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439779_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439789_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439781_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439782_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439786_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439791_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JF439784_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
GU565217_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
KF767451_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AB056515_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
HE981171_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
HE981172_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
KF779267_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
EF634480_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JQ707678_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JQ707679_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JQ707677_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JQ707671_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JQ707657_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JQ707666_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JQ707668_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JQ707673_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JQ707680_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JQ707660_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AB064312_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaagga
AB064310_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
KR230749_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AB064311_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
KF779235_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
MT426120_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AF405706_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AF160501_PreS1_C-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AB375166_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AB375167_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AB375168_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AB375169_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AB375170_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AB064313_PreS1_C-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AB056513_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AB056514_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
AB375165_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
GU563556_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
KF767450_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
KF779233_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
KJ194508_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
KX264500_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
KY004111_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
JQ707436_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
KM998716_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
HE981174_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
HE981175_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
HE981176_PreS1_P-G      atggggctttcttggacggtc-----cctctcgagtg-----gggaaaga
FJ023674_PreS1_P-G      atggga-------gggtggacatccacccctcggaaaggcatggggacga
FR714503_PreS1_P-G      atggga-------ggttggtcttccaaacctcgaaaaggcatggggacga
                        *****        **  ** *        ****         *** * **

EF464097_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
EF464098_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JN604208_PreS1_P-G      atctttccaccagcaatcctctaggattccttcccgatcaccagttggac
KF414679_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
DQ207798_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
KF779357_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439792_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439793_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439780_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439785_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439803_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439804_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439805_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439806_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439807_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439808_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439809_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439810_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439811_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439813_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439814_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439815_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439816_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439817_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439818_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439812_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
KF767452_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439788_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439787_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439779_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439789_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439781_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439782_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439786_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439791_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JF439784_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
GU565217_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
KF767451_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AB056515_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
HE981171_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
HE981172_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
KF779267_PreS1_P-G      acctttccaccagcaatcctctgggattctttcccgatcaccagttggac
EF634480_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JQ707678_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JQ707679_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JQ707677_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JQ707671_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JQ707657_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JQ707666_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JQ707668_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JQ707673_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JQ707680_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JQ707660_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AB064312_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AB064310_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
KR230749_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AB064311_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
KF779235_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
MT426120_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AF405706_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AF160501_PreS1_C-G      acctttccgccagcaatcctctaggattccttcccgatcaccagttggac
AB375166_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AB375167_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AB375168_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AB375169_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AB375170_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AB064313_PreS1_C-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AB056513_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AB056514_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
AB375165_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
GU563556_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
KF767450_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
KF779233_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
KJ194508_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
KX264500_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
KY004111_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
JQ707436_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
KM998716_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
HE981174_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
HE981175_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
HE981176_PreS1_P-G      acctttccaccagcaatcctctaggattccttcccgatcaccagttggac
FJ023674_PreS1_P-G      atctttctgtacccaatcctctgggatttcttcccgatcatcagttggat
FR714503_PreS1_P-G      atctttctgttcccaatcctctgggatttcttcccgatcatcagttggac
                        * *****      ********* *****  ********** ******** 

EF464097_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
EF464098_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JN604208_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
KF414679_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
DQ207798_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
KF779357_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439792_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439793_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439780_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439785_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439803_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439804_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439805_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439806_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439807_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439808_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439809_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439810_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439811_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439813_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439814_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439815_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439816_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439817_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439818_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439812_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
KF767452_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439788_PreS1_P-G      ccggcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439787_PreS1_P-G      ccggcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439779_PreS1_P-G      ccggcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439789_PreS1_P-G      ccggcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439781_PreS1_P-G      ccggcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439782_PreS1_P-G      ccggcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439786_PreS1_P-G      ccggcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439791_PreS1_P-G      ccggcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JF439784_PreS1_P-G      ccggcattcagagcaaataccaacaatccagattgggacttcaatcccaa
GU565217_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
KF767451_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AB056515_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
HE981171_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
HE981172_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
KF779267_PreS1_P-G      ccagccttcagagcaaataccaacaatccagattgggacttcaatcccaa
EF634480_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JQ707678_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JQ707679_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JQ707677_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JQ707671_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JQ707657_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JQ707666_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JQ707668_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JQ707673_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JQ707680_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JQ707660_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AB064312_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AB064310_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
KR230749_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AB064311_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
KF779235_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
MT426120_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AF405706_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AF160501_PreS1_C-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AB375166_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AB375167_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AB375168_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AB375169_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AB375170_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AB064313_PreS1_C-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AB056513_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AB056514_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
AB375165_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
GU563556_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
KF767450_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
KF779233_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
KJ194508_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
KX264500_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
KY004111_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
JQ707436_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
KM998716_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
HE981174_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
HE981175_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
HE981176_PreS1_P-G      ccagcattcagagcaaataccaacaatccagattgggacttcaatcccaa
FJ023674_PreS1_P-G      cctgcgttcggagccaactcaaacaatccagattgggacttcaaccccaa
FR714503_PreS1_P-G      cctgcgttcggagccaactcaaacaatccagattgggacttcaaccccaa
                        ** ** *** **** **  * *********************** *****

EF464097_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
EF464098_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JN604208_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
KF414679_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
DQ207798_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
KF779357_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439792_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439793_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439780_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439785_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439803_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439804_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439805_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439806_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439807_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439808_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439809_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439810_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439811_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439813_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439814_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439815_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439816_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439817_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439818_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439812_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
KF767452_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagtcggagcctatggac
JF439788_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439787_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439779_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439789_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439781_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439782_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439786_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439791_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JF439784_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
GU565217_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
KF767451_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AB056515_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
HE981171_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
HE981172_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
KF779267_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
EF634480_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JQ707678_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JQ707679_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JQ707677_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JQ707671_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JQ707657_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JQ707666_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JQ707668_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JQ707673_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JQ707680_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JQ707660_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AB064312_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AB064310_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
KR230749_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AB064311_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
KF779235_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctacggac
MT426120_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctacggac
AF405706_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AF160501_PreS1_C-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AB375166_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AB375167_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AB375168_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AB375169_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AB375170_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AB064313_PreS1_C-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AB056513_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AB056514_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
AB375165_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
GU563556_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
KF767450_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
KF779233_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
KJ194508_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
KX264500_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
KY004111_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
JQ707436_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
KM998716_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
HE981174_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
HE981175_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
HE981176_PreS1_P-G      aaaggacccttggccagaggccaacaaggtaggagttggagcctatggac
FJ023674_PreS1_P-G      caaggaccattggccacaagcccatcaggtaggagcgggagcattcgggc
FR714503_PreS1_P-G      caaggaccattggccacaagcccatcaggtaggagcgggagcattcgggc
                         ******* ******* * *** *  *********  ***** *  ** *

EF464097_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
EF464098_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JN604208_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
KF414679_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
DQ207798_PreS1_P-G      ccgggttcacccctccgcacggaggccttttggggtggagccctcagtct
KF779357_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439792_PreS1_P-G      ccgggttcacccctccacacggaggccttctggggtggagccctcagtct
JF439793_PreS1_P-G      ccgggttcacccctccacacggaggccttctggggtggagccctcagtct
JF439780_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439785_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439803_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439804_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439805_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439806_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439807_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439808_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439809_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439810_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439811_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439813_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439814_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439815_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439816_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439817_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439818_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439812_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
KF767452_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439788_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439787_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439779_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439789_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439781_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439782_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439786_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439791_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JF439784_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
GU565217_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctccgtct
KF767451_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AB056515_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
HE981171_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
HE981172_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
KF779267_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
EF634480_PreS1_P-G      ccgggttcacccctccacacggaggccttctggggtggagccctcagtct
JQ707678_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JQ707679_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JQ707677_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JQ707671_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JQ707657_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JQ707666_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JQ707668_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JQ707673_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JQ707680_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JQ707660_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AB064312_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AB064310_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
KR230749_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AB064311_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
KF779235_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
MT426120_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AF405706_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AF160501_PreS1_C-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AB375166_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AB375167_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AB375168_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AB375169_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AB375170_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AB064313_PreS1_C-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AB056513_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AB056514_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
AB375165_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
GU563556_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
KF767450_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
KF779233_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
KJ194508_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
KX264500_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
KY004111_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
JQ707436_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
KM998716_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccctcagtct
HE981174_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccttcaatct
HE981175_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccttcagtct
HE981176_PreS1_P-G      ccgggttcacccctccacacggaggccttttggggtggagccttcagtct
FJ023674_PreS1_P-G      cagggttcacccctccacacggaggtctgttggggtggagccctcaggct
FR714503_PreS1_P-G      cagggttcacccctcctcacggaggtcttttggggtggagccctcaggct
                        * ************** ******** **  ************ **   **

EF464097_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
EF464098_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JN604208_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
KF414679_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
DQ207798_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
KF779357_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439792_PreS1_P-G      cagggcacactaacaactttaccagcagatccgcctcctgcctccaccaa
JF439793_PreS1_P-G      cagggcacactaacaactttaccagcagatccgcctcctgcctccaccaa
JF439780_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439785_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439803_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439804_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439805_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439806_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439807_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439808_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439809_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439810_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439811_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439813_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439814_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439815_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439816_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439817_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439818_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439812_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
KF767452_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439788_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439787_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439779_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439789_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439781_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439782_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439786_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439791_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JF439784_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
GU565217_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
KF767451_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AB056515_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
HE981171_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
HE981172_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
KF779267_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
EF634480_PreS1_P-G      cagggcacactaacaactttaccagcagatccgcctcctgcctccaccaa
JQ707678_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JQ707679_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JQ707677_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JQ707671_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JQ707657_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JQ707666_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JQ707668_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JQ707673_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JQ707680_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JQ707660_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AB064312_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AB064310_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
KR230749_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AB064311_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcccactgcctccaccaa
KF779235_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
MT426120_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AF405706_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AF160501_PreS1_C-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AB375166_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AB375167_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AB375168_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AB375169_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AB375170_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AB064313_PreS1_C-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AB056513_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AB056514_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
AB375165_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
GU563556_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
KF767450_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
KF779233_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
KJ194508_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
KX264500_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
KY004111_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
JQ707436_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
KM998716_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
HE981174_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
HE981175_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
HE981176_PreS1_P-G      cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaa
FJ023674_PreS1_P-G      cagggcatattaacaaatgtgccagcagttcctcctcctgcctcaaccaa
FR714503_PreS1_P-G      cagggcatattaacaaacgtgccagcagttcctcctcctgcctccaccaa
                        ******* * ******   * ******* *** **  ******* *****

EF464097_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
EF464098_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JN604208_PreS1_P-G      tcgtcagtcaaggaggcagcctactcccatctctccaccactaagagaca
KF414679_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
DQ207798_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactgagagaca
KF779357_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JF439792_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JF439793_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JF439780_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JF439785_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JF439803_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439804_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439805_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439806_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439807_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439808_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439809_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439810_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439811_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439813_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439814_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439815_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439816_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439817_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439818_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
JF439812_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctttccaccactaagagaca
KF767452_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JF439788_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JF439787_PreS1_P-G      tcgtcagtcaaggaggcagcctactcccatctctccaccactaagagaca
JF439779_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JF439789_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JF439781_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JF439782_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JF439786_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JF439791_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JF439784_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
GU565217_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
KF767451_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AB056515_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccacctctaagagaca
HE981171_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
HE981172_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
KF779267_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
EF634480_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JQ707678_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JQ707679_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JQ707677_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JQ707671_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JQ707657_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JQ707666_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JQ707668_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JQ707673_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JQ707680_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JQ707660_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AB064312_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AB064310_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
KR230749_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AB064311_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
KF779235_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
MT426120_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AF405706_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AF160501_PreS1_C-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AB375166_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AB375167_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AB375168_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AB375169_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AB375170_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AB064313_PreS1_C-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AB056513_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AB056514_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
AB375165_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
GU563556_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
KF767450_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
KF779233_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
KJ194508_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
KX264500_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
KY004111_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
JQ707436_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
KM998716_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
HE981174_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
HE981175_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
HE981176_PreS1_P-G      tcgtcagtcagggaggcagcctactcccatctctccaccactaagagaca
FJ023674_PreS1_P-G      tcggcagtcaggacggcagcccactcccatctctccacctctgagagaca
FR714503_PreS1_P-G      tcggcagtcaggaaggcagccaactcccatatctccacctctaagagaca
                        *** ****** *  ******* ******** * ****** ** *******

EF464097_PreS1_P-G      gtcatcctcaggccatgcagtggaactccacccagttccaccaagctcta
EF464098_PreS1_P-G      gtcatcctcaggccatgcagtggaactccacccagttccaccaagctcta
JN604208_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
KF414679_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
DQ207798_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctctg
KF779357_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JF439792_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JF439793_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JF439780_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JF439785_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JF439803_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439804_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439805_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439806_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439807_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439808_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439809_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439810_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439811_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439813_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439814_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439815_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439816_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439817_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439818_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
JF439812_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcagtccaccaagctcta
KF767452_PreS1_P-G      gtcatcctcaggccatgcagtg---ctctacagcattccaccaagctcta
JF439788_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattctaccaagctcta
JF439787_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JF439779_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JF439789_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JF439781_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JF439782_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JF439786_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JF439791_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JF439784_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
GU565217_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
KF767451_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AB056515_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
HE981171_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
HE981172_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
KF779267_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
EF634480_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JQ707678_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JQ707679_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JQ707677_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JQ707671_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JQ707657_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JQ707666_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JQ707668_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JQ707673_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JQ707680_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JQ707660_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AB064312_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AB064310_PreS1_P-G      gtcatcctcaggccctgcagtggaactctacagcattccaccaagctcta
KR230749_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AB064311_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
KF779235_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
MT426120_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AF405706_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AF160501_PreS1_C-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AB375166_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AB375167_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AB375168_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AB375169_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AB375170_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AB064313_PreS1_C-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AB056513_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AB056514_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
AB375165_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
GU563556_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
KF767450_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
KF779233_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
KJ194508_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
KX264500_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
KY004111_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
JQ707436_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
KM998716_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
HE981174_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
HE981175_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
HE981176_PreS1_P-G      gtcatcctcaggccatgcagtggaactctacagcattccaccaagctcta
FJ023674_PreS1_P-G      gycatcctcaggccatgcagtggaactccacaaccttccaccaagctctt
FR714503_PreS1_P-G      gtcatcctcaggccatgcagtggaactccaccaccttccaccaagctcta
                        * ************ *******   *** **     ** ********** 

EF464097_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
EF464098_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JN604208_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
KF414679_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
DQ207798_PreS1_P-G      caaaatcccaaagtcaggggcctgta---tcctgctggtggctccagttc
KF779357_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439792_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JF439793_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JF439780_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439785_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439803_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439804_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439805_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439806_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439807_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439808_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439809_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439810_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439811_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439813_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439814_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439815_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439816_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439817_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439818_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439812_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
KF767452_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JF439788_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JF439787_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JF439779_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JF439789_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JF439781_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JF439782_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JF439786_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JF439791_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JF439784_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
GU565217_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
KF767451_PreS1_P-G      caaaatcccaaagtcaggggcctgta---tcctgctggtggctccagttc
AB056515_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
HE981171_PreS1_P-G      caaaatcccaaagtcag------------tcctgctggtggctccagttc
HE981172_PreS1_P-G      caaaatcccaaagtcag------------tcctgctggtggctccagttc
KF779267_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
EF634480_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JQ707678_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JQ707679_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JQ707677_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JQ707671_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JQ707657_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JQ707666_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JQ707668_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JQ707673_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JQ707680_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
JQ707660_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
AB064312_PreS1_P-G      caaaatcccacagtcaggggcctgtatcttcctgctggtggctccagttc
AB064310_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
KR230749_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
AB064311_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
KF779235_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
MT426120_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
AF405706_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
AF160501_PreS1_C-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
AB375166_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
AB375167_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
AB375168_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
AB375169_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
AB375170_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
AB064313_PreS1_C-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
AB056513_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
AB056514_PreS1_P-G      caaaatcccaaagtcaggg---------ttcctgctggtggctccagttc
AB375165_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
GU563556_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
KF767450_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
KF779233_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
KJ194508_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
KX264500_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
KY004111_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
JQ707436_PreS1_P-G      caaaatcccaaagtcaggggcctgta---tcctgctggtggctccagttc
KM998716_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
HE981174_PreS1_P-G      caaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttc
HE981175_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
HE981176_PreS1_P-G      caaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttc
FJ023674_PreS1_P-G      cargatcccagagtcaggggcctgtattttcctgctggtggctccagttc
FR714503_PreS1_P-G      caagatcccagaatcaggggcctgtatcttcctgctggtggctccagttc
                        **  ****** * ****            *********************

EF464097_PreS1_P-G      agagacacagaaccctgttccgactattgcctctctcacatcatcaatct
EF464098_PreS1_P-G      agagacagcagaacctgctccgactattgcctctctcacatcatcaatct
JN604208_PreS1_P-G      aggaatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
KF414679_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
DQ207798_PreS1_P-G      aggaacagtgagccctgttccgactattgcctctcacatctcgtcaatct
KF779357_PreS1_P-G      agggatagtgaaccctgttccgaatattgcctctcacatctcgtcaatct
JF439792_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439793_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439780_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439785_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439803_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439804_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439805_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439806_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439807_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439808_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439809_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439810_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439811_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439813_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439814_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439815_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439816_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439817_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439818_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439812_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
KF767452_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439788_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439787_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439779_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439789_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439781_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439782_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439786_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439791_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JF439784_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
GU565217_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
KF767451_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AB056515_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
HE981171_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
HE981172_PreS1_P-G      agggatagtgaaccttgttccgactattgcctctcacatctcgtcaatct
KF779267_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
EF634480_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JQ707678_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JQ707679_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JQ707677_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JQ707671_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JQ707657_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JQ707666_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JQ707668_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JQ707673_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JQ707680_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JQ707660_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AB064312_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AB064310_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
KR230749_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AB064311_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
KF779235_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
MT426120_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AF405706_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AF160501_PreS1_C-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AB375166_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AB375167_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AB375168_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AB375169_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AB375170_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AB064313_PreS1_C-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AB056513_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AB056514_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
AB375165_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
GU563556_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
KF767450_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
KF779233_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
KJ194508_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
KX264500_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
KY004111_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
JQ707436_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
KM998716_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
HE981174_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
HE981175_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
HE981176_PreS1_P-G      agggatagtgaaccctgttccgactattgcctctcacatctcgtcaatct
FJ023674_PreS1_P-G      aggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatct
FR714503_PreS1_P-G      aggaacagtaaaccctgctccgaatattgcctctcacatctcatcaatct
                        **  * *      * ** ***** *********** **  ** *******

EF464097_PreS1_P-G      tctcgaagactgggggccctgcaccgaacatggagaacatcacatcagga
EF464098_PreS1_P-G      tctcgaagactgggggccctgcaccgaacatggagaacatcacatcagga
JN604208_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
KF414679_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
DQ207798_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
KF779357_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439792_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439793_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439780_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439785_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439803_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439804_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439805_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439806_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439807_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439808_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439809_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439810_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439811_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439813_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439814_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439815_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439816_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439817_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439818_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439812_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
KF767452_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439788_PreS1_P-G      tcaccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439787_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439779_PreS1_P-G      tcaccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439789_PreS1_P-G      tcaccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439781_PreS1_P-G      tcaccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439782_PreS1_P-G      tcaccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439786_PreS1_P-G      tcaccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439791_PreS1_P-G      tcaccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JF439784_PreS1_P-G      tcaccaggattggggaccctgcaccgaacatggagaacatcacatcagga
GU565217_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
KF767451_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AB056515_PreS1_P-G      tctccaagattggggaccctgcaccgaacatggagaacatcacatcagga
HE981171_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
HE981172_PreS1_P-G      tctccaggattggggaccctgtaccgaacatggagaacatcacatcagga
KF779267_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
EF634480_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JQ707678_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JQ707679_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JQ707677_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JQ707671_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JQ707657_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JQ707666_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JQ707668_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JQ707673_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JQ707680_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JQ707660_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AB064312_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AB064310_PreS1_P-G      tctccaggattggggaccctgcaccgaatatggagaacatcacatcagga
KR230749_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AB064311_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
KF779235_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
MT426120_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AF405706_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AF160501_PreS1_C-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AB375166_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AB375167_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AB375168_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AB375169_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AB375170_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AB064313_PreS1_C-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AB056513_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaatatcacatcagga
AB056514_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
AB375165_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
GU563556_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
KF767450_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
KF779233_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
KJ194508_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
KX264500_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
KY004111_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
JQ707436_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
KM998716_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
HE981174_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
HE981175_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
HE981176_PreS1_P-G      tctccaggattggggaccctgcaccgaacatggagaacatcacatcagga
FJ023674_PreS1_P-G      tcgcaaggactggggaccttgcaccgaacatggagaacatcacatcagga
FR714503_PreS1_P-G      tcacgaggattggggaccctgcaacgaacatggagaacatcacatcagga
                        ** * * ** ***** ** ** * **** ******** ************

EF464097_PreS1_P-G      ctcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
EF464098_PreS1_P-G      ctcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaag
JN604208_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
KF414679_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
DQ207798_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
KF779357_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtatttcgtgttgacaag
JF439792_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439793_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439780_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439785_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439803_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439804_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439805_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439806_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439807_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439808_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439809_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439810_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439811_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439813_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439814_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439815_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439816_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439817_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439818_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439812_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
KF767452_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JF439788_PreS1_P-G      ttcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaag
JF439787_PreS1_P-G      ttcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaag
JF439779_PreS1_P-G      ttcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaag
JF439789_PreS1_P-G      ttcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaag
JF439781_PreS1_P-G      ttcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaag
JF439782_PreS1_P-G      ttcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaag
JF439786_PreS1_P-G      ttcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaag
JF439791_PreS1_P-G      ttcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaag
JF439784_PreS1_P-G      ttcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaag
GU565217_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
KF767451_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AB056515_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
HE981171_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
HE981172_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
KF779267_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
EF634480_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JQ707678_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JQ707679_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JQ707677_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JQ707671_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JQ707657_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JQ707666_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JQ707668_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JQ707673_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JQ707680_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JQ707660_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AB064312_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AB064310_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
KR230749_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcgggggttttcttgttgacaag
AB064311_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
KF779235_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
MT426120_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AF405706_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AF160501_PreS1_C-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AB375166_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AB375167_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AB375168_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AB375169_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AB375170_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AB064313_PreS1_C-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AB056513_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AB056514_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
AB375165_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
GU563556_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
KF767450_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
KF779233_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
KJ194508_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
KX264500_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
KY004111_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
JQ707436_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
KM998716_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
HE981174_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
HE981175_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
HE981176_PreS1_P-G      ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
FJ023674_PreS1_P-G      ttcctcggacccctgctcgtgttacaggcgggatttttcttgttgacaaa
FR714503_PreS1_P-G      ttcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaa
                         **** **************** ********    **** ********* 

EF464097_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
EF464098_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JN604208_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
KF414679_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
DQ207798_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
KF779357_PreS1_P-G      attcttcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439792_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439793_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439780_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439785_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439803_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439804_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439805_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439806_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439807_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439808_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439809_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439810_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439811_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439813_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439814_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439815_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439816_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439817_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439818_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439812_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
KF767452_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439788_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439787_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439779_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439789_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439781_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439782_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439786_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439791_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JF439784_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
GU565217_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
KF767451_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
AB056515_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
HE981171_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
HE981172_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
KF779267_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
EF634480_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JQ707678_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JQ707679_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JQ707677_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JQ707671_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JQ707657_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JQ707666_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JQ707668_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JQ707673_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JQ707680_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JQ707660_PreS1_P-G      aatcctcacaataccacagagtctagactcgtggtggacttctctcaatt
AB064312_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
AB064310_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
KR230749_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
AB064311_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
KF779235_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
MT426120_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
AF405706_PreS1_P-G      aatcctcacaataccacagagtctagactcgtggtggacttctctcaatt
AF160501_PreS1_C-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
AB375166_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
AB375167_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
AB375168_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
AB375169_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
AB375170_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
AB064313_PreS1_C-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
AB056513_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
AB056514_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
AB375165_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
GU563556_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
KF767450_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
KF779233_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
KJ194508_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
KX264500_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
KY004111_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
JQ707436_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
KM998716_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
HE981174_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
HE981175_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
HE981176_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
FJ023674_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
FR714503_PreS1_P-G      aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
                        * ** ********** **********************************

EF464097_PreS1_P-G      ttctaggggaagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
EF464098_PreS1_P-G      ttctaggggaagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JN604208_PreS1_P-G      ttctagggggagtacccgtgtgtcctggcctaaattcgcagtccccaacc
KF414679_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
DQ207798_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
KF779357_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439792_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439793_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439780_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439785_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439803_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439804_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439805_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439806_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439807_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439808_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439809_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439810_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439811_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439813_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439814_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439815_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439816_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439817_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439818_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439812_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
KF767452_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439788_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439787_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439779_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439789_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439781_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439782_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439786_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439791_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JF439784_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
GU565217_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
KF767451_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AB056515_PreS1_P-G      ttctagggggagcgcccgtgtgtcctggcctaaattcgcagtccccaacc
HE981171_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
HE981172_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
KF779267_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
EF634480_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JQ707678_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JQ707679_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JQ707677_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JQ707671_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JQ707657_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JQ707666_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JQ707668_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JQ707673_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JQ707680_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JQ707660_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AB064312_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AB064310_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
KR230749_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AB064311_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
KF779235_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
MT426120_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AF405706_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AF160501_PreS1_C-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AB375166_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AB375167_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AB375168_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AB375169_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AB375170_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AB064313_PreS1_C-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AB056513_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AB056514_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
AB375165_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
GU563556_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
KF767450_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
KF779233_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
KJ194508_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
KX264500_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
KY004111_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
JQ707436_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
KM998716_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
HE981174_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
HE981175_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
HE981176_PreS1_P-G      ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacc
FJ023674_PreS1_P-G      ttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaacc
FR714503_PreS1_P-G      ttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacc
                        ********* *    ********* ***** *******************

EF464097_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
EF464098_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JN604208_PreS1_P-G      tccaatcactcaccaatctcttgtcctccaacttgtcctggctatcgctg
KF414679_PreS1_P-G      tccaatcactcactaatctcctgtcctccaacttgtcctggctatcgctg
DQ207798_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
KF779357_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439792_PreS1_P-G      tccaatcactcactaatctcctgtcctccaacttgtcctggctatcgctg
JF439793_PreS1_P-G      tccaatcactcactaatctcctgtcctccaacttgtcctggctatcgctg
JF439780_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439785_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439803_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439804_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439805_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439806_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439807_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439808_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439809_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439810_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439811_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439813_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439814_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439815_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439816_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439817_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439818_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439812_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
KF767452_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439788_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439787_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439779_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439789_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439781_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439782_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439786_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439791_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JF439784_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
GU565217_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
KF767451_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AB056515_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
HE981171_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
HE981172_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
KF779267_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
EF634480_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JQ707678_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JQ707679_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JQ707677_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggatatcgctg
JQ707671_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JQ707657_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JQ707666_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JQ707668_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JQ707673_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JQ707680_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JQ707660_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AB064312_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AB064310_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
KR230749_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AB064311_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
KF779235_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
MT426120_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AF405706_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AF160501_PreS1_C-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AB375166_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AB375167_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AB375168_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AB375169_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AB375170_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AB064313_PreS1_C-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AB056513_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AB056514_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
AB375165_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
GU563556_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
KF767450_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
KF779233_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
KJ194508_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
KX264500_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
KY004111_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
JQ707436_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
KM998716_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
HE981174_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
HE981175_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
HE981176_PreS1_P-G      tccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctg
FJ023674_PreS1_P-G      tccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctg
FR714503_PreS1_P-G      tccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctg
                        ************* ** *** ********** ********* ********

EF464097_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
EF464098_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JN604208_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
KF414679_PreS1_P-G      gatgtggctgcggcgttttatcatattcctcttcatcctgctgctatgcc
DQ207798_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
KF779357_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439792_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439793_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439780_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439785_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439803_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439804_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439805_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439806_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439807_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439808_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439809_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439810_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439811_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439813_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439814_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439815_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439816_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439817_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439818_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439812_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
KF767452_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439788_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439787_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439779_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439789_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439781_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439782_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439786_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439791_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JF439784_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
GU565217_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
KF767451_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AB056515_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
HE981171_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
HE981172_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
KF779267_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
EF634480_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JQ707678_PreS1_P-G      gatgtgtttgcggcgttttatcatattcctcttcatcctgctgctatgcc
JQ707679_PreS1_P-G      gatgtgtttgcggcgttttatcatattcctcttcatcctgctgctatgcc
JQ707677_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JQ707671_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JQ707657_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JQ707666_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JQ707668_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JQ707673_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JQ707680_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JQ707660_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AB064312_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AB064310_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
KR230749_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AB064311_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
KF779235_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
MT426120_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AF405706_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AF160501_PreS1_C-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AB375166_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AB375167_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AB375168_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AB375169_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AB375170_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AB064313_PreS1_C-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AB056513_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AB056514_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
AB375165_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
GU563556_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
KF767450_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
KF779233_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
KJ194508_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
KX264500_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
KY004111_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
JQ707436_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
KM998716_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
HE981174_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
HE981175_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
HE981176_PreS1_P-G      gatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcc
FJ023674_PreS1_P-G      gatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcc
FR714503_PreS1_P-G      gatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcc
                        ******  **************** *************************

EF464097_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
EF464098_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JN604208_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
KF414679_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
DQ207798_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
KF779357_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439792_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439793_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439780_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439785_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439803_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439804_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439805_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439806_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439807_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439808_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439809_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439810_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439811_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439813_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439814_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439815_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439816_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439817_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439818_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439812_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
KF767452_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439788_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439787_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439779_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439789_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439781_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439782_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439786_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439791_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JF439784_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
GU565217_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
KF767451_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AB056515_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
HE981171_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
HE981172_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
KF779267_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
EF634480_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JQ707678_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JQ707679_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JQ707677_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JQ707671_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JQ707657_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JQ707666_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JQ707668_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JQ707673_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JQ707680_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JQ707660_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AB064312_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AB064310_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
KR230749_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AB064311_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
KF779235_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
MT426120_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AF405706_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AF160501_PreS1_C-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AB375166_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AB375167_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AB375168_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AB375169_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AB375170_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AB064313_PreS1_C-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AB056513_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AB056514_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
AB375165_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
GU563556_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
KF767450_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
KF779233_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
KJ194508_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
KX264500_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
KY004111_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
JQ707436_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
KM998716_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
HE981174_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
HE981175_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
HE981176_PreS1_P-G      tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
FJ023674_PreS1_P-G      tcatcttcttgttggttcttctggattatcarggtatgttgcccgtttgt
FR714503_PreS1_P-G      tcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgt
                        ************************* ***** ******************

EF464097_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
EF464098_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JN604208_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
KF414679_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
DQ207798_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
KF779357_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439792_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439793_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439780_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439785_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439803_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439804_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439805_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439806_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439807_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439808_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439809_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439810_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439811_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439813_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439814_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439815_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439816_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439817_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439818_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439812_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
KF767452_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439788_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439787_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439779_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439789_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439781_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439782_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439786_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439791_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JF439784_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
GU565217_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
KF767451_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
AB056515_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
HE981171_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
HE981172_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
KF779267_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
EF634480_PreS1_P-G      cctctgattccaggatcctccaccaccagtacgggaccctgcaaaacctg
JQ707678_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JQ707679_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JQ707677_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JQ707671_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JQ707657_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JQ707666_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JQ707668_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JQ707673_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JQ707680_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JQ707660_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
AB064312_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
AB064310_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
KR230749_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
AB064311_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
KF779235_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
MT426120_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
AF405706_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
AF160501_PreS1_C-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
AB375166_PreS1_P-G      cctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctg
AB375167_PreS1_P-G      cctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctg
AB375168_PreS1_P-G      cctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctg
AB375169_PreS1_P-G      cctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctg
AB375170_PreS1_P-G      cctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctg
AB064313_PreS1_C-G      cccctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
AB056513_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
AB056514_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
AB375165_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
GU563556_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
KF767450_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
KF779233_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
KJ194508_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
KX264500_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
KY004111_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
JQ707436_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
KM998716_PreS1_P-G      cctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctg
HE981174_PreS1_P-G      cctctgattccaggatcctcgaccaccagcacgggaccctgcaaaacctg
HE981175_PreS1_P-G      cctctgattccaggatcctcgaccaccagcacgggaccctgcaaaacctg
HE981176_PreS1_P-G      cctctgattccaggatcctcgaccaccagcacgggaccctgcaaaacctg
FJ023674_PreS1_P-G      cctctaattccaggatcctcgaccaccagtacgggaccctgcagaacctg
FR714503_PreS1_P-G      cctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctg
                        ** ** *** ********** ******** ******** **** ******

EF464097_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
EF464098_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JN604208_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
KF414679_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
DQ207798_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
KF779357_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439792_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439793_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439780_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439785_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439803_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439804_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439805_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439806_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439807_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439808_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439809_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439810_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439811_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439813_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439814_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439815_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439816_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439817_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439818_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439812_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
KF767452_PreS1_P-G      cacgtctcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439788_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439787_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439779_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439789_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439781_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439782_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439786_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439791_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JF439784_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
GU565217_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
KF767451_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AB056515_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtataa
HE981171_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
HE981172_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
KF779267_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
EF634480_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JQ707678_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JQ707679_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JQ707677_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JQ707671_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JQ707657_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JQ707666_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JQ707668_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JQ707673_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JQ707680_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JQ707660_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AB064312_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AB064310_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
KR230749_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AB064311_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
KF779235_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
MT426120_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AF405706_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AF160501_PreS1_C-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AB375166_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AB375167_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AB375168_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AB375169_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AB375170_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AB064313_PreS1_C-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AB056513_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AB056514_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
AB375165_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
GU563556_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
KF767450_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
KF779233_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
KJ194508_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
KX264500_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
KY004111_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
JQ707436_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
KM998716_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
HE981174_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
HE981175_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
HE981176_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
FJ023674_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
FR714503_PreS1_P-G      cacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaa
                        **** ****************************************** **

EF464097_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
EF464098_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JN604208_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
KF414679_PreS1_P-G      aaccttcggacagaaattgcacctgtattcccatcccatcatcttgggct
DQ207798_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
KF779357_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439792_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439793_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439780_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439785_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439803_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439804_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439805_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439806_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439807_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439808_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439809_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439810_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439811_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439813_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439814_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439815_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439816_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439817_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439818_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439812_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
KF767452_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439788_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439787_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439779_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439789_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439781_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439782_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439786_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439791_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JF439784_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
GU565217_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
KF767451_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AB056515_PreS1_P-G      aaccttcggaaggaaattgcacctgtattcccatcccatcatcttgggct
HE981171_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
HE981172_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
KF779267_PreS1_P-G      aaccttcggacagaaattgcacctgtattcccatcccatcatcttgggct
EF634480_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JQ707678_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JQ707679_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JQ707677_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JQ707671_PreS1_P-G      aactttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JQ707657_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JQ707666_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JQ707668_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JQ707673_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JQ707680_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JQ707660_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AB064312_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AB064310_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
KR230749_PreS1_P-G      aaccttcggacagaaattgcacctgtattcccatcccatcatcttgggct
AB064311_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
KF779235_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
MT426120_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AF405706_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AF160501_PreS1_C-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AB375166_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AB375167_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AB375168_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AB375169_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AB375170_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AB064313_PreS1_C-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AB056513_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AB056514_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
AB375165_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
GU563556_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
KF767450_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
KF779233_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
KJ194508_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
KX264500_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
KY004111_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
JQ707436_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
KM998716_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
HE981174_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
HE981175_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
HE981176_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
FJ023674_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
FR714503_PreS1_P-G      aaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
                        *** ******  **************************************

EF464097_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
EF464098_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JN604208_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
KF414679_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
DQ207798_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
KF779357_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggctcag
JF439792_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439793_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439780_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439785_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439803_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439804_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439805_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439806_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439807_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439808_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439809_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439810_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439811_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439813_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439814_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439815_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439816_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439817_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439818_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439812_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
KF767452_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439788_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439787_PreS1_P-G      ttcgcaaaatacctatgggattgggcctcagtccgtttctcatggctcag
JF439779_PreS1_P-G      ttcgcaaaatacctatgggattgggcctcagtccgtttctcatggctcag
JF439789_PreS1_P-G      ttcgcaaaatacctatgggattgggcctcagtccgtttctcatggctcag
JF439781_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439782_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439786_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439791_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
JF439784_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
GU565217_PreS1_P-G      ttcgcaaaatacctatgggattgggcctcagtccgtttctcatggctcag
KF767451_PreS1_P-G      ttcgcaaaatacctatgggactgggcctcagtccgtttctcatggctcag
AB056515_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
HE981171_PreS1_P-G      ttcgcaaaatacctatgggagtgggtctcagtccgtttctcatggctcag
HE981172_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
KF779267_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
EF634480_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
JQ707678_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
JQ707679_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
JQ707677_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
JQ707671_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
JQ707657_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
JQ707666_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
JQ707668_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
JQ707673_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
JQ707680_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
JQ707660_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AB064312_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AB064310_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
KR230749_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AB064311_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
KF779235_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
MT426120_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AF405706_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AF160501_PreS1_C-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AB375166_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AB375167_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AB375168_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AB375169_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AB375170_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AB064313_PreS1_C-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AB056513_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AB056514_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
AB375165_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
GU563556_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
KF767450_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
KF779233_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
KJ194508_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
KX264500_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
KY004111_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
JQ707436_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
KM998716_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
HE981174_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
HE981175_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
HE981176_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
FJ023674_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcag
FR714503_PreS1_P-G      ttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcag
                        ******************** **** ***** ********* ********

EF464097_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
EF464098_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JN604208_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
KF414679_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgttt
DQ207798_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
KF779357_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439792_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439793_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439780_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439785_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439803_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439804_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439805_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439806_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439807_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439808_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439809_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439810_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439811_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439813_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439814_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439815_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439816_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439817_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439818_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439812_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
KF767452_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439788_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439787_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439779_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439789_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439781_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439782_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439786_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439791_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JF439784_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccacactgtct
GU565217_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
KF767451_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AB056515_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
HE981171_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
HE981172_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
KF779267_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
EF634480_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JQ707678_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JQ707679_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JQ707677_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JQ707671_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JQ707657_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JQ707666_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JQ707668_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JQ707673_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JQ707680_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JQ707660_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AB064312_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AB064310_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
KR230749_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AB064311_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
KF779235_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
MT426120_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AF405706_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AF160501_PreS1_C-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AB375166_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AB375167_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AB375168_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AB375169_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AB375170_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AB064313_PreS1_C-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AB056513_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AB056514_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
AB375165_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
GU563556_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
KF767450_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
KF779233_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
KJ194508_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
KX264500_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
KY004111_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
JQ707436_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
KM998716_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
HE981174_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
HE981175_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
HE981176_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
FJ023674_PreS1_P-G      tttactagcgccatttgttcagtggttcgtagggctttcccccactgtct
FR714503_PreS1_P-G      tttactagtgccatttgttcagtggttcgtagggctttcccccactgtct
                        ******** ******************************** ****** *

EF464097_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
EF464098_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JN604208_PreS1_P-G      ggctttcagttatatggatgatgtggtattgggggccaaatctgtacaac
KF414679_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
DQ207798_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
KF779357_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
JF439792_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439793_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439780_PreS1_P-G      ggctttcagctatgtggatgatgtggtattggggaccaaatctgtacaac
JF439785_PreS1_P-G      ggctttcagctatgtggatgatgtggtattggggaccaaatctgtacaac
JF439803_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439804_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439805_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439806_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439807_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439808_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439809_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439810_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439811_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439813_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439814_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439815_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439816_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439817_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439818_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439812_PreS1_P-G      ggctctcagctatgtggatgatgtggtattgggggccaaatctgtacaac
KF767452_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439788_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439787_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439779_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439789_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
JF439781_PreS1_P-G      ggctttcagctatgtggatgatattgtattgggggccaaatctgtacaac
JF439782_PreS1_P-G      ggctttcagctatgtggatgatattgtattgggggccaaatctgtacaac
JF439786_PreS1_P-G      ggctttcagctatgtggatgatattgtattgggggccaaatctgtacaac
JF439791_PreS1_P-G      ggctttcagctatgtggatgatattgtattgggggccaaatctgtacaac
JF439784_PreS1_P-G      ggctttcagctatgtggatgatattgtattgggggccaaatctgtacaac
GU565217_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaac
KF767451_PreS1_P-G      ggctttcagctatgtggatgatgtggtattgggggccaaatctgtacagc
AB056515_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
HE981171_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
HE981172_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
KF779267_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
EF634480_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
JQ707678_PreS1_P-G      ggctttcagctatatcgatgatgtggtattgggggccaaatctgtacaac
JQ707679_PreS1_P-G      ggctttcagctatattgatgatgtggtattgggggccaaatctgtacaac
JQ707677_PreS1_P-G      ggctttcagctatattgatgatgtggtattgggggccaaatctgtacaac
JQ707671_PreS1_P-G      ggctttcagctatattgatgatgtggtattgggggccaaatctgtacaac
JQ707657_PreS1_P-G      ggctttcagctatattgatgatgtggtattgggggccaaatctgtacaac
JQ707666_PreS1_P-G      ggctttcagctatattgatgatgtggtattgggggccaaatctgtacaac
JQ707668_PreS1_P-G      ggctttcagctatattgatgatgtggtattgggggccaaatctgtacaac
JQ707673_PreS1_P-G      ggctttcagctatattgatgatgtggtattgggggccaaatctgtacaac
JQ707680_PreS1_P-G      ggctttcagctatattgatgatgtggtattgggggccaaatctgtacaac
JQ707660_PreS1_P-G      ggctttcagctatattgatgatgtggtattgggggccaaatctgtacaac
AB064312_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
AB064310_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
KR230749_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
AB064311_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
KF779235_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
MT426120_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
AF405706_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
AF160501_PreS1_C-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
AB375166_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
AB375167_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
AB375168_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
AB375169_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
AB375170_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
AB064313_PreS1_C-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
AB056513_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
AB056514_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
AB375165_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
GU563556_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
KF767450_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
KF779233_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
KJ194508_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
KX264500_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
KY004111_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
JQ707436_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
KM998716_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
HE981174_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
HE981175_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
HE981176_PreS1_P-G      ggctttcagctatatggatgatgtggtattgggggccaaatctgtacaac
FJ023674_PreS1_P-G      ggctttcagttatatggatgatgtggtattgggggccaaatctgtacamc
FR714503_PreS1_P-G      ggctttcagttatatggatgatgtggtattgggggccaagtctgtacaac
                        **** **** *** * ****** * ********* **** ******** *

EF464097_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
EF464098_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JN604208_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
KF414679_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
DQ207798_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
KF779357_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JF439792_PreS1_P-G      atcttgagtccctttttaccgctgttaccaattttcttttgtctttgggt
JF439793_PreS1_P-G      atcttgagtccctttttaccgctgttaccaattttcttttgtctttgggt
JF439780_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439785_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439803_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439804_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439805_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439806_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439807_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439808_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439809_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439810_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439811_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439813_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439814_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439815_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439816_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439817_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439818_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439812_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
KF767452_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JF439788_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttgtgtctttgggt
JF439787_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JF439779_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JF439789_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JF439781_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JF439782_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JF439786_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JF439791_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JF439784_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
GU565217_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
KF767451_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AB056515_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
HE981171_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttttctttgggt
HE981172_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttttctttgggt
KF779267_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
EF634480_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JQ707678_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JQ707679_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JQ707677_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JQ707671_PreS1_P-G      atcttgagtccctttttaccgctgttaccaattttcttttgtctttgggt
JQ707657_PreS1_P-G      atcttgagtccctttttaccgctgttaccaattttcttttgtctttgggt
JQ707666_PreS1_P-G      atcttgagtccctttttaccgctgttaccaattttcttttgtctttgggt
JQ707668_PreS1_P-G      atcttgagtccctttttaccgctgttaccaattttcttttgtctttgggt
JQ707673_PreS1_P-G      atcttgagtccctttttaccgctgttaccaattttcttttgtctttgggt
JQ707680_PreS1_P-G      atcttgagtccctttttaccgctgttaccaattttcttttgtctttgggt
JQ707660_PreS1_P-G      atcttgagtccctttttaccgctgttaccaattttcttttgtctttgggt
AB064312_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AB064310_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
KR230749_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AB064311_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
KF779235_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
MT426120_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AF405706_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AF160501_PreS1_C-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AB375166_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AB375167_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AB375168_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AB375169_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AB375170_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AB064313_PreS1_C-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AB056513_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AB056514_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
AB375165_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
GU563556_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
KF767450_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
KF779233_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
KJ194508_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
KX264500_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
KY004111_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
JQ707436_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
KM998716_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
HE981174_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
HE981175_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
HE981176_PreS1_P-G      atcttgagtccctttataccgctgttaccaattttcttttgtctttgggt
FJ023674_PreS1_P-G      accttgagtccatttataccgctgttaccaattttcttttgtctttgggt
FR714503_PreS1_P-G      atcttgaggccatttataccgctgttaccaattttcttttgtctttgggt
                        * ****** ** *** ********************** * *********

EF464097_PreS1_P-G      atacatttaa
EF464098_PreS1_P-G      atacatttaa
JN604208_PreS1_P-G      atacatctaa
KF414679_PreS1_P-G      atacatctaa
DQ207798_PreS1_P-G      atacatctaa
KF779357_PreS1_P-G      atacatctaa
JF439792_PreS1_P-G      atacatctaa
JF439793_PreS1_P-G      atacatctaa
JF439780_PreS1_P-G      atacatctaa
JF439785_PreS1_P-G      atacatctaa
JF439803_PreS1_P-G      atacatctaa
JF439804_PreS1_P-G      atacatctaa
JF439805_PreS1_P-G      atacatctaa
JF439806_PreS1_P-G      atacatctaa
JF439807_PreS1_P-G      atacatctaa
JF439808_PreS1_P-G      atacatctaa
JF439809_PreS1_P-G      atacatctaa
JF439810_PreS1_P-G      atacatctaa
JF439811_PreS1_P-G      atacatctaa
JF439813_PreS1_P-G      atacatctaa
JF439814_PreS1_P-G      atacatctaa
JF439815_PreS1_P-G      atacatctaa
JF439816_PreS1_P-G      atacatctaa
JF439817_PreS1_P-G      atacatctaa
JF439818_PreS1_P-G      atacatctaa
JF439812_PreS1_P-G      atacatctaa
KF767452_PreS1_P-G      atacatctaa
JF439788_PreS1_P-G      atacatccaa
JF439787_PreS1_P-G      atacatctaa
JF439779_PreS1_P-G      atacatctaa
JF439789_PreS1_P-G      atacatctaa
JF439781_PreS1_P-G      atacatctaa
JF439782_PreS1_P-G      atacatctaa
JF439786_PreS1_P-G      atacatctaa
JF439791_PreS1_P-G      atacatctaa
JF439784_PreS1_P-G      atacatctaa
GU565217_PreS1_P-G      atacatctaa
KF767451_PreS1_P-G      atacatctaa
AB056515_PreS1_P-G      atacatctaa
HE981171_PreS1_P-G      atacatctaa
HE981172_PreS1_P-G      atacatctaa
KF779267_PreS1_P-G      atacatctaa
EF634480_PreS1_P-G      atacatctaa
JQ707678_PreS1_P-G      atacatctaa
JQ707679_PreS1_P-G      atacatctaa
JQ707677_PreS1_P-G      atacatctaa
JQ707671_PreS1_P-G      atacatctaa
JQ707657_PreS1_P-G      atacatctaa
JQ707666_PreS1_P-G      atacatctaa
JQ707668_PreS1_P-G      atacatctaa
JQ707673_PreS1_P-G      atacatctaa
JQ707680_PreS1_P-G      atacatctaa
JQ707660_PreS1_P-G      atacatctaa
AB064312_PreS1_P-G      atacatctaa
AB064310_PreS1_P-G      atacatctaa
KR230749_PreS1_P-G      atacatctaa
AB064311_PreS1_P-G      atacatctaa
KF779235_PreS1_P-G      atacatctaa
MT426120_PreS1_P-G      atacatctaa
AF405706_PreS1_P-G      atacatctaa
AF160501_PreS1_C-G      atacatctaa
AB375166_PreS1_P-G      atacatctaa
AB375167_PreS1_P-G      atacatctaa
AB375168_PreS1_P-G      atacatctaa
AB375169_PreS1_P-G      atacatctaa
AB375170_PreS1_P-G      atacatctaa
AB064313_PreS1_C-G      atacatctaa
AB056513_PreS1_P-G      atacatctaa
AB056514_PreS1_P-G      atacatctaa
AB375165_PreS1_P-G      atacatctaa
GU563556_PreS1_P-G      atacatctaa
KF767450_PreS1_P-G      atacatctaa
KF779233_PreS1_P-G      atacatctaa
KJ194508_PreS1_P-G      atacatctaa
KX264500_PreS1_P-G      atacatctaa
KY004111_PreS1_P-G      atacatctaa
JQ707436_PreS1_P-G      atacatctaa
KM998716_PreS1_P-G      atacatctaa
HE981174_PreS1_P-G      atacatctaa
HE981175_PreS1_P-G      atacatctaa
HE981176_PreS1_P-G      atacatctaa
FJ023674_PreS1_P-G      atacatttaa
FR714503_PreS1_P-G      atacatttaa
                        ******  **

© 1998-2022Legal notice