HBVdb

Dataset for nucleotide sequence PreC of genotype G

[Download (right click)] [Edit] [Sequences] [Repertoires]

47 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


KY004111_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF767451_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB056515_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB056513_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
JQ707673_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
JQ707671_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
JQ707657_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
JQ707436_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
JQ707660_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
JQ707666_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
JQ707668_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
JQ707677_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
JQ707678_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
JQ707679_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
JQ707680_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
GU565217_PreC_P-G      atggaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HE981171_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HE981172_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KM998716_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF767450_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB064310_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB064313_PreC_C-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB375165_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB375166_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB375167_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB375168_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB375169_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB375170_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF767452_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HE981174_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HE981175_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HE981176_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KJ194508_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
M74502_PreC_P-G        atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GU563556_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
DQ207798_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB064312_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB056514_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB064311_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF160501_PreC_C-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF405706_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
EF464097_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
EF464098_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
EF634480_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KX264500_PreC_P-G      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF414679_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KR230749_PreC_P-G      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
                       *** **************************************** *****

KY004111_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
KF767451_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AB056515_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AB056513_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
JQ707673_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
JQ707671_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
JQ707657_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
JQ707436_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
JQ707660_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
JQ707666_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
JQ707668_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
JQ707677_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
JQ707678_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
JQ707679_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
JQ707680_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
GU565217_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
HE981171_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
HE981172_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
KM998716_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
KF767450_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AB064310_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AB064313_PreC_C-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AB375165_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AB375166_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AB375167_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AB375168_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AB375169_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AB375170_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
KF767452_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
HE981174_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
HE981175_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
HE981176_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
KJ194508_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
M74502_PreC_P-G        tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
GU563556_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
DQ207798_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AB064312_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AB056514_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AB064311_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AF160501_PreC_C-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
AF405706_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
EF464097_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
EF464098_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
EF634480_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
KX264500_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
KF414679_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
KR230749_PreC_P-G      tcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaa
                       **************************************************

KY004111_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
KF767451_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AB056515_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AB056513_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
JQ707673_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
JQ707671_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
JQ707657_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
JQ707436_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
JQ707660_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
JQ707666_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
JQ707668_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
JQ707677_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
JQ707678_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
JQ707679_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
JQ707680_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
GU565217_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
HE981171_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
HE981172_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
KM998716_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
KF767450_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AB064310_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AB064313_PreC_C-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AB375165_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AB375166_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AB375167_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AB375168_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AB375169_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AB375170_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
KF767452_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
HE981174_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
HE981175_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
HE981176_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
KJ194508_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
M74502_PreC_P-G        ctttgccatatggcctttttggcttagacattgacccttataaagaattt
GU563556_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
DQ207798_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AB064312_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AB056514_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AB064311_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AF160501_PreC_C-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
AF405706_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
EF464097_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
EF464098_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
EF634480_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
KX264500_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
KF414679_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
KR230749_PreC_P-G      ctttgccatatggcctttttggcttagacattgacccttataaagaattt
                       **************************************************

KY004111_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
KF767451_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AB056515_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AB056513_PreC_P-G      ggagctactgtggagttactctcgtttttgccttctgactttttcccgtc
JQ707673_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
JQ707671_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
JQ707657_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
JQ707436_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
JQ707660_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
JQ707666_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
JQ707668_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
JQ707677_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
JQ707678_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
JQ707679_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
JQ707680_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
GU565217_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
HE981171_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
HE981172_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
KM998716_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
KF767450_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AB064310_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AB064313_PreC_C-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AB375165_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AB375166_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AB375167_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AB375168_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AB375169_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AB375170_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
KF767452_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
HE981174_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
HE981175_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
HE981176_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
KJ194508_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
M74502_PreC_P-G        ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
GU563556_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
DQ207798_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AB064312_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AB056514_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AB064311_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AF160501_PreC_C-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
AF405706_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
EF464097_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
EF464098_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
EF634480_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
KX264500_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
KF414679_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
KR230749_PreC_P-G      ggagctactgtggagttgctctcgtttttgccttctgactttttcccgtc
                       ***************** ********************************

KY004111_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaagccttag
KF767451_PreC_P-G      tgttcgtgatcttctcgacaccgcttcasctttgtaccgggaatccttag
AB056515_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AB056513_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
JQ707673_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
JQ707671_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
JQ707657_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
JQ707436_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
JQ707660_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
JQ707666_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
JQ707668_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
JQ707677_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
JQ707678_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
JQ707679_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
JQ707680_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
GU565217_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
HE981171_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
HE981172_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
KM998716_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
KF767450_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AB064310_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AB064313_PreC_C-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AB375165_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AB375166_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AB375167_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AB375168_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AB375169_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AB375170_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
KF767452_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
HE981174_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
HE981175_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
HE981176_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
KJ194508_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
M74502_PreC_P-G        tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
GU563556_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
DQ207798_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AB064312_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AB056514_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AB064311_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AF160501_PreC_C-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
AF405706_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
EF464097_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
EF464098_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
EF634480_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
KX264500_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
KF414679_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
KR230749_PreC_P-G      tgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttag
                       **************************** ************** ******

KY004111_PreC_P-G      agtcctttgatcattgttcgcctcaccatacagcactcaggcaagcaatc
KF767451_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
AB056515_PreC_P-G      agtcctctgttcattgttcgcctcaccatacagcactcaggcaagcaatc
AB056513_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
JQ707673_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
JQ707671_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
JQ707657_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
JQ707436_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
JQ707660_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
JQ707666_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
JQ707668_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
JQ707677_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
JQ707678_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
JQ707679_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
JQ707680_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
GU565217_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
HE981171_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
HE981172_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
KM998716_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
KF767450_PreC_P-G      agtcctctgatcattcttcgcctcaccatacagcactcaggcaagcaatc
AB064310_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
AB064313_PreC_C-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
AB375165_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
AB375166_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
AB375167_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
AB375168_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
AB375169_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
AB375170_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
KF767452_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
HE981174_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatt
HE981175_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatt
HE981176_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatt
KJ194508_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatt
M74502_PreC_P-G        agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatt
GU563556_PreC_P-G      agtcctctgagcattgttcgcctcaccatacagcactcaggcaagcaatc
DQ207798_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
AB064312_PreC_P-G      agtcctctgatcattgttcgcctcaccatgcagcactcaggcaagcaatc
AB056514_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
AB064311_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
AF160501_PreC_C-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
AF405706_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
EF464097_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
EF464098_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
EF634480_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
KX264500_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
KF414679_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
KR230749_PreC_P-G      agtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatc
                       ****** **  **** ************* ******************* 

KY004111_PreC_P-G      ctgtgctggggtgagttgatgactctagccacctgggtgggtaataattt
KF767451_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
AB056515_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
AB056513_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
JQ707673_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
JQ707671_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
JQ707657_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
JQ707436_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
JQ707660_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
JQ707666_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
JQ707668_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
JQ707677_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
JQ707678_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
JQ707679_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
JQ707680_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
GU565217_PreC_P-G      ctgtgctggggtgagttgatgactctagccacctgggtgggtaataattt
HE981171_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
HE981172_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
KM998716_PreC_P-G      ctgtgctggggtgagttgatgactctagccacctgggtgggtaataattt
KF767450_PreC_P-G      ctgtgctggggtgagttgatgactctagccacctgggtgggtaataattt
AB064310_PreC_P-G      ctgtgctggggtgagttgatgactctagccacctgggtgggtaataattt
AB064313_PreC_C-G      ctgtgctggggtgagttgatgactctagccacctgggtgggtaataattt
AB375165_PreC_P-G      ctgtgctggggtgagttgatgactctagccacctgggtgggtaataattt
AB375166_PreC_P-G      ctgtgctggggtgagttgatgactctagccacctgggtgggtaataattt
AB375167_PreC_P-G      ctgtgctggggtgagttgatgactctagccacctgggtgggtaataattt
AB375168_PreC_P-G      ctgtgctggggtgagttgatgactctagccacctgggtgggtaataattt
AB375169_PreC_P-G      ctgtgctggggtgagttgatgactctagccacctgggtgggtaataattt
AB375170_PreC_P-G      ctgtgctggggtgagttgatgactctagccacctgggtgggtaataattt
KF767452_PreC_P-G      ctgtgctggggtgagttgatgactctagccacctgggtgggtaataattt
HE981174_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
HE981175_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
HE981176_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
KJ194508_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
M74502_PreC_P-G        ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
GU563556_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
DQ207798_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
AB064312_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
AB056514_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
AB064311_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
AF160501_PreC_C-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
AF405706_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
EF464097_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
EF464098_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
EF634480_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
KX264500_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
KF414679_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
KR230749_PreC_P-G      ctgtgctggggtgagttgatgactctagctacctgggtgggtaataattt
                       ***************************** ********************

KY004111_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
KF767451_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AB056515_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AB056513_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaatt
JQ707673_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
JQ707671_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
JQ707657_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
JQ707436_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaatc
JQ707660_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
JQ707666_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
JQ707668_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
JQ707677_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
JQ707678_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
JQ707679_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
JQ707680_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
GU565217_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
HE981171_PreC_P-G      ggaagatccagcatccagagatttggcggtcaattatgttaatactaata
HE981172_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
KM998716_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
KF767450_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AB064310_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AB064313_PreC_C-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AB375165_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AB375166_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AB375167_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AB375168_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AB375169_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AB375170_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
KF767452_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
HE981174_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
HE981175_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
HE981176_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
KJ194508_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
M74502_PreC_P-G        ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
GU563556_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
DQ207798_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AB064312_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AB056514_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AB064311_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AF160501_PreC_C-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
AF405706_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
EF464097_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
EF464098_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
EF634480_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
KX264500_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
KF414679_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
KR230749_PreC_P-G      ggaagatccagcatccagagatttggtggtcaattatgttaatactaata
                       ************************** ********************** 

KY004111_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
KF767451_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AB056515_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AB056513_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
JQ707673_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
JQ707671_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
JQ707657_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
JQ707436_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
JQ707660_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
JQ707666_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
JQ707668_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
JQ707677_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
JQ707678_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
JQ707679_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
JQ707680_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
GU565217_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
HE981171_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
HE981172_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
KM998716_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
KF767450_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AB064310_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AB064313_PreC_C-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AB375165_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AB375166_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AB375167_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AB375168_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AB375169_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AB375170_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
KF767452_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
HE981174_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
HE981175_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
HE981176_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
KJ194508_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
M74502_PreC_P-G        tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
GU563556_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
DQ207798_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacg
AB064312_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AB056514_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AB064311_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AF160501_PreC_C-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
AF405706_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
EF464097_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
EF464098_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
EF634480_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
KX264500_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
KF414679_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
KR230749_PreC_P-G      tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttact
                       ************************************************* 

KY004111_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
KF767451_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AB056515_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AB056513_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
JQ707673_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
JQ707671_PreC_P-G      tttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
JQ707657_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
JQ707436_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
JQ707660_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
JQ707666_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
JQ707668_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
JQ707677_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
JQ707678_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
JQ707679_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
JQ707680_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
GU565217_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
HE981171_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
HE981172_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
KM998716_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
KF767450_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AB064310_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AB064313_PreC_C-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AB375165_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AB375166_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AB375167_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AB375168_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AB375169_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AB375170_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
KF767452_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
HE981174_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
HE981175_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
HE981176_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
KJ194508_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
M74502_PreC_P-G        tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
GU563556_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
DQ207798_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AB064312_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AB056514_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AB064311_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AF160501_PreC_C-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
AF405706_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
EF464097_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
EF464098_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
EF634480_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
KX264500_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
KF414679_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
KR230749_PreC_P-G      tttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggat
                       ***** ********************************************

KY004111_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
KF767451_PreC_P-G      tcgcactccgcttgcttatagaccaccaaatgcccctatcctatcaacac
AB056515_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AB056513_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
JQ707673_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
JQ707671_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
JQ707657_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
JQ707436_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
JQ707660_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
JQ707666_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
JQ707668_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
JQ707677_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
JQ707678_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
JQ707679_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
JQ707680_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
GU565217_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
HE981171_PreC_P-G      tcgcactcctcttgcttatagaccaccaaatgcccctatcctatcaacac
HE981172_PreC_P-G      tcgcactcctcttgcttatagaccaccaaatgcccctatcctatcaacac
KM998716_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
KF767450_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AB064310_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AB064313_PreC_C-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AB375165_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AB375166_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AB375167_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AB375168_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AB375169_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AB375170_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
KF767452_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
HE981174_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
HE981175_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
HE981176_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
KJ194508_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
M74502_PreC_P-G        tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
GU563556_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
DQ207798_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AB064312_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AB056514_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AB064311_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AF160501_PreC_C-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
AF405706_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
EF464097_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
EF464098_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
EF634480_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
KX264500_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
KF414679_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
KR230749_PreC_P-G      tcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacac
                       ********* * **************************************

KY004111_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
KF767451_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AB056515_PreC_P-G      ttccggagactactgttgttagacgaagagacaggtcccctcgaagaaga
AB056513_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
JQ707673_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
JQ707671_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
JQ707657_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
JQ707436_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
JQ707660_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
JQ707666_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
JQ707668_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
JQ707677_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
JQ707678_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
JQ707679_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
JQ707680_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
GU565217_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
HE981171_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
HE981172_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
KM998716_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
KF767450_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AB064310_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AB064313_PreC_C-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AB375165_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AB375166_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AB375167_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AB375168_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AB375169_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AB375170_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
KF767452_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
HE981174_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
HE981175_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
HE981176_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
KJ194508_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
M74502_PreC_P-G        ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
GU563556_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
DQ207798_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AB064312_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AB056514_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AB064311_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AF160501_PreC_C-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
AF405706_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
EF464097_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
EF464098_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
EF634480_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
KX264500_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
KF414679_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
KR230749_PreC_P-G      ttccggagactactgttgttagacgaagaggcaggtcccctcgaagaaga
                       ****************************** *******************

KY004111_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
KF767451_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AB056515_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AB056513_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
JQ707673_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcggaagatc
JQ707671_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
JQ707657_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
JQ707436_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
JQ707660_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
JQ707666_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
JQ707668_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
JQ707677_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
JQ707678_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
JQ707679_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
JQ707680_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
GU565217_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
HE981171_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
HE981172_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
KM998716_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatc
KF767450_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AB064310_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AB064313_PreC_C-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AB375165_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AB375166_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AB375167_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AB375168_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AB375169_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AB375170_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
KF767452_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
HE981174_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
HE981175_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
HE981176_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
KJ194508_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
M74502_PreC_P-G        actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
GU563556_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
DQ207798_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AB064312_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AB056514_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AB064311_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AF160501_PreC_C-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
AF405706_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
EF464097_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
EF464098_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
EF634480_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
KX264500_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
KF414679_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
KR230749_PreC_P-G      actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
                       ****************************************** *******

KY004111_PreC_P-G      tacatctccagcttcccaatgttag
KF767451_PreC_P-G      tgcatctccagcttcccaatgttag
AB056515_PreC_P-G      tgcatctccagcttcccaatgttag
AB056513_PreC_P-G      tgcatctccagcttcccaatgttag
JQ707673_PreC_P-G      tgcatctccagcttcccaatgttag
JQ707671_PreC_P-G      tgcatctccagcttcccaatgttag
JQ707657_PreC_P-G      tgcatctcaagcttcccaatgttag
JQ707436_PreC_P-G      tgcatctccagcttcccaatgttag
JQ707660_PreC_P-G      tgcatctccagcttcccaatgttag
JQ707666_PreC_P-G      tgcatctccagcttcccaatgttag
JQ707668_PreC_P-G      tgcatctccagcttcccaatgttag
JQ707677_PreC_P-G      tgcatctccagcttcccaatgttag
JQ707678_PreC_P-G      tgcatctccagcttcccaatgttag
JQ707679_PreC_P-G      tgcatctccagcttcccaatgttag
JQ707680_PreC_P-G      tgcatctccagcttcccaatgttag
GU565217_PreC_P-G      tgcatctccagcttcccaatgatag
HE981171_PreC_P-G      tgcatctccagcttcccaatgttag
HE981172_PreC_P-G      tgcatctccagcttcccaatgttag
KM998716_PreC_P-G      tgcatctccagcttcccaatgttag
KF767450_PreC_P-G      tgcatctccagcttcccaatgttag
AB064310_PreC_P-G      tgcatctccagcttcccaatgttag
AB064313_PreC_C-G      tgcatctccagcttcccaatgttag
AB375165_PreC_P-G      tgcatctccagcttcccaatgttag
AB375166_PreC_P-G      tgcatctccagcttcccaatgttag
AB375167_PreC_P-G      tgcatctccagcttcccaatgttag
AB375168_PreC_P-G      tgcatctccagcttcccaatgttag
AB375169_PreC_P-G      tgcatctccagcttcccaatgttag
AB375170_PreC_P-G      tgcatctccagcttcccaatgttag
KF767452_PreC_P-G      tgcatctccagcttcccaatgttag
HE981174_PreC_P-G      tgcatctccagcttcccaatgttag
HE981175_PreC_P-G      tgcatctccagcttcccaatgttag
HE981176_PreC_P-G      tgcatctccagcttcccaatgttag
KJ194508_PreC_P-G      tgcatctccagcttcccaatgttag
M74502_PreC_P-G        tgcatctccagcttcccaatgttag
GU563556_PreC_P-G      tgcatctccagcttcccaatgttag
DQ207798_PreC_P-G      tgcatctccagcttcccaatgttag
AB064312_PreC_P-G      tgcatctccagcttcccaatgttag
AB056514_PreC_P-G      tgcatctccagcttcccaatgttag
AB064311_PreC_P-G      tgcatctccagcttcccaatgttag
AF160501_PreC_C-G      tgcatctccagcttcccaatgttag
AF405706_PreC_P-G      tgcatctccagcttcccaatgttag
EF464097_PreC_P-G      tgcatctccagcttcccaatgttag
EF464098_PreC_P-G      tgcatctccagcttcccaatgttag
EF634480_PreC_P-G      tgcatctccagcttcccaatgttag
KX264500_PreC_P-G      tgcatctccagcttcccaatgttag
KF414679_PreC_P-G      tgcatctccagcttcccaatgttag
KR230749_PreC_P-G      tgcatctccagcttcccaatgttag
                       * ****** ************ ***

© 1998-2020Legal notice