HBVdb

Dataset for nucleotide sequence X of genotype F

[Download (right click)] [Edit] [Sequences] [Repertoires]

394 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


AB214516_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ272888_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688720_X_P-F      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP995101_X_P-F      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995105_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ589066_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995118_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ899148_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
X75663_X_P-F        atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP718106_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995106_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP718103_X_P-F      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ589067_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH051986_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH051987_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995111_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995117_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995126_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ899150_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF397982_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995123_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995119_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP718111_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY311370_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995124_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB116550_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB116549_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ638659_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995125_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036905_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036906_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036907_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036908_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036909_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036912_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036913_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX264498_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036911_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036920_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036914_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036915_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036916_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036917_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036918_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036919_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM659861_X_P-F      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP718109_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP718112_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995109_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB116551_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB036910_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ899149_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629930_X_P-F      atggctgctaggttgtgctgccaactgggtcctccgcgggacggcctttatctacatccc
JN792921_X_P-F      atggctgctmggwtgtgctgcmaactggatcctrcgcgggacgtcctttgtttacgtccc
KF199901_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
DQ629947_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KJ638663_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ638656_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ638657_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ638664_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KP718107_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM590474_X_P-F      atggctgcttggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HM585186_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HM590471_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HM590472_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM233681_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB116654_X_P-F      atggctgctcggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KP718110_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KY476322_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KY476332_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KY476330_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ657525_X_P-F      atggctgctcggttgcgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JF911673_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
EU670261_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
AB086397_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY476329_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KY476331_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KY476324_X_P-F      atggctgctcggttgtactgccaactggatcctacgmgggacgtcctttgtttacgtccc
JQ272890_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN792918_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JF911676_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
EU670262_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
EU670260_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MF593354_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KY476325_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcgtttgtttacgtccc
KY476328_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcgtttgtttacgtccc
JQ272894_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272891_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN688699_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843181_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843193_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
DQ823091_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
EF026750_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843170_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585194_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM627320_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JX079936_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KY382417_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MG001258_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MF593380_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MF593376_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MF593360_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MF593356_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843205_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843202_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843169_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843168_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843194_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843204_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843164_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843163_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN792920_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN792919_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtacc
JN792917_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KY476327_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN792914_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
AB064316_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
AF223963_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
EU366133_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KY382416_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN792916_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN792922_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272905_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
FJ709458_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
FJ709459_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
FJ709465_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
FJ709494_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HE981182_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HE981183_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585187_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585188_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585189_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585191_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585195_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585196_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585199_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM590473_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272901_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272904_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272908_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843171_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585190_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM622135_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843195_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ586805_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272898_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272907_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843200_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN688691_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN688703_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KC494400_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ586806_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ586807_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ586808_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843167_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843201_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585200_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843177_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
AB116552_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KP995116_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MK058437_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MF593371_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MF593367_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KY458062_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KP995098_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KM998715_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843196_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843199_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843178_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843176_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272895_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272892_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KY476323_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JF911677_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JF911675_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585198_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
FJ709457_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
DQ823095_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
EF026754_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843180_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
AF223964_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
DQ823093_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
DQ823094_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
EF026752_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
EF026753_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
EU366118_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
FJ657529_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
FJ709460_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
FJ709462_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
FJ709463_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
FJ709464_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585192_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585193_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HM585197_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HQ378247_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JF911674_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272889_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272893_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272899_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272909_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272910_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272913_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ272914_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KC494404_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843174_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KX264496_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KY382415_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KY458061_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MK808039_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
AY179735_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
DQ823092_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
EF026751_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843179_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843190_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843197_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843198_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843203_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ843206_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
DQ629996_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
FJ589065_X_P-F      atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtttacgtccc
KX757665_X_P-F      atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtttacgtccc
DQ629959_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629985_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629988_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ629983_X_P-F      atggctgctcggttgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtccc
DQ629944_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629932_X_P-F      atggctgctggtatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629973_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AY090459_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KP718104_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KP718113_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
AY090461_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629960_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629938_X_P-F      atggctgctcggttgcgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629943_X_P-F      atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtccc
DQ629978_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ629993_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629989_X_P-F      atggctgctcggttgtgcttccaacttgatcctacgcgggacgtcctttgtctacgtccc
DQ629935_X_P-F      atggctgctcggttgtgctgccaaatggatcctacgcgggacgtcctttgtctacgtccc
DQ629951_X_P-F      atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtccc
DQ629955_X_P-F      atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtccc
DQ629994_X_P-F      atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtccc
DQ629972_X_P-F      atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtccc
DQ629987_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629975_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629969_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629968_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629966_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY090458_X_C-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629981_X_P-F      atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtccc
DQ629971_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629963_X_P-F      atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtccc
DQ629949_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629931_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629948_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629961_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629964_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629945_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629977_X_P-F      atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtccc
AY090456_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629962_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629974_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629979_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629990_X_P-F      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ629992_X_P-F      atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtccc
KJ676694_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF911695_X_P-F      atgggtgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098584_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF911693_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098569_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB166850_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843225_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ823088_X_P-F      atggctgctcggwtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF026747_X_P-F      atggctgctcggwtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF911694_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098580_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098566_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098582_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
X75658_X_C-F        atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098578_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688709_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF911692_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ823087_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF026746_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098570_X_P-F      atggctgctcggctgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843223_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098565_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843185_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY476326_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF911696_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098575_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843209_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098577_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843175_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843189_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629986_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ272900_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098579_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843226_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843220_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HE981181_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC494398_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629958_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ776247_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU366116_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ657519_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ657522_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF911679_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF911680_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843213_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843212_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843207_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843208_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843210_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688701_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ657528_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843219_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843221_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843222_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843224_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY382411_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098564_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK808040_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF223962_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ823090_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF026749_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843211_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098583_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB365446_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098573_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ823089_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF026748_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU366132_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF911678_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG001259_X_P-F      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN811656_X_P-F      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF576812_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF576808_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ823086_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF026745_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG098574_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX079937_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB365450_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB365449_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF223965_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN811655_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ272906_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX264499_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ638660_X_P-F      atggctgctcggttgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ638662_X_P-F      atggctgctcggttgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629946_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995104_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629941_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ899145_X_P-F      atggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ899144_X_P-F      atggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ899146_X_P-F      atggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtgctttgtttacgtccc
DQ899147_X_P-F      atggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843191_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629937_X_P-F      atggctgctcggttgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629991_X_P-F      atggctgctcggctgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KC494396_X_P-F      atggctgctcggatgtgctgcaaactggatactgcgcgggacgtcctttgtttacgtccc
KP995110_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995097_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995107_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995113_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995114_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995115_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KC494394_X_P-F      atggctgctcggatgtgctgcaaactggatcctgagcgggacgtcctttgtttacgtccc
KC494399_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ899143_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KC494405_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KC494401_X_P-F      atggctgctcggctgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KC494397_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ899142_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KT896494_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KC494402_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KC494403_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KX264497_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
KC494395_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
X69798_X_P-F        atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629934_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995120_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
AY311369_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629956_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629967_X_P-F      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629965_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629954_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629995_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629953_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgagacgtcctttgtttacgtccc
DQ629940_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629933_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629950_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
AY090455_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ629997_X_P-F      atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
                    **** **** *  **  ** * ** * * * **  * * ****   *** * *** * **

AB214516_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
JQ272888_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
JN688720_X_P-F      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctctcgtcccct
KP995101_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
KP995105_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
FJ589066_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
KP995118_X_P-F      gtcggcgctgaatcccgcggacgacccctccaggggtcgcttggggctgtaccgccccct
DQ899148_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcctggggctgtaccgccccct
X75663_X_P-F        gtcggcgctgaatccagcggacgaaccctcccggggtcgcttggggctgtaccgccccct
KP718106_X_P-F      gtcggcgctgaatcccgcggacgacccctctcggggtcgcttggggctgtaccgccccct
KP995106_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
KP718103_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgccccct
FJ589067_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
MH051986_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
MH051987_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
KP995111_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
KP995117_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
KP995126_X_P-F      gtcggcgctgaatcccgcggacgacccctccaggggtcgcctggggctgtaccgccccct
DQ899150_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
EF397982_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
KP995123_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
KP995119_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtatcgccccct
KP718111_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
AY311370_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcctggggctgtaccgccccct
KP995124_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcctggggctgtaccgccccct
AB116550_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
AB116549_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
KJ638659_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
KP995125_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
AB036905_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctgtaccgccccct
AB036906_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctgtaccgccccct
AB036907_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctgtaccgccccct
AB036908_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctgtaccgccccct
AB036909_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctgtaccgccccct
AB036912_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctgtaccgccccct
AB036913_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctgtaccgccccct
KX264498_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctgtaccgccccct
AB036911_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctctaccgccccct
AB036920_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctctaccgccccct
AB036914_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctataccgccccct
AB036915_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctataccgccccct
AB036916_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctataccgccccct
AB036917_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctataccgccccct
AB036918_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctataccgccccct
AB036919_X_P-F      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctataccgccccct
KM659861_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
KP718109_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
KP718112_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
KP995109_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
AB116551_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
AB036910_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
DQ899149_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccccct
DQ629930_X_P-F      gtcggcgctgactcccgcggacgatccctctcggggtcgcttggggttgtaccgcaccct
JN792921_X_P-F      rtcggcgctgaatccmgcggacgayccctcycggggtcgcttggggctgtaycgcccyct
KF199901_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
DQ629947_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
KJ638663_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtttcgccccct
KJ638656_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtttcgccccct
KJ638657_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtwtcgccccct
KJ638664_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtctcgccccct
KP718107_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
HM590474_X_P-F      gtcagcgctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgccccct
HM585186_X_P-F      gtcagcgctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgccccct
HM590471_X_P-F      gtcagcgctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgccccct
HM590472_X_P-F      gtcagcgctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KM233681_X_P-F      gtcagcgctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgccccct
AB116654_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccctct
KP718110_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtttcgccccct
KY476322_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KY476332_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KY476330_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
FJ657525_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JF911673_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
EU670261_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
AB086397_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtttcgccccct
KY476329_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtgtcgccccct
KY476331_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KY476324_X_P-F      gtcggcgctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272890_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JN792918_X_P-F      gtccgcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JF911676_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
EU670262_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
EU670260_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
MF593354_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KY476325_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KY476328_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272894_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctatatcgccccct
JQ272891_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JN688699_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843181_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843193_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
DQ823091_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
EF026750_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843170_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
HM585194_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttagggctgtatcgccccct
HM627320_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttagggctgtatcgccccct
JX079936_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KY382417_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
MG001258_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
MF593380_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
MF593376_X_P-F      gtaggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
MF593360_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
MF593356_X_P-F      gtmggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843205_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843202_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843169_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843168_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843194_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843204_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843164_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843163_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JN792920_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JN792919_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JN792917_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KY476327_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JN792914_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
AB064316_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
AF223963_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
EU366133_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KY382416_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JN792916_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JN792922_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272905_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
FJ709458_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
FJ709459_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
FJ709465_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
FJ709494_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
HE981182_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
HE981183_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
HM585187_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
HM585188_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
HM585189_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
HM585191_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
HM585195_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
HM585196_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
HM585199_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
HM590473_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
JQ272901_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
JQ272904_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
JQ272908_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
KJ843171_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
HM585190_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgccccct
HM622135_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843195_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ586805_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272898_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272907_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843200_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
JN688691_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
JN688703_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KC494400_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ586806_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ586807_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ586808_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843167_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843201_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
HM585200_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttagggctgtatcgccccct
KJ843177_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
AB116552_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KP995116_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
MK058437_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
MF593371_X_P-F      gtcggcgctgaatccagcggacgacccctctcggggtcgcttggggctgtatcgccccct
MF593367_X_P-F      gtmggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KY458062_X_P-F      gtcggcgctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KP995098_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttagggctgtatcgccccct
KM998715_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843196_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843199_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843178_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843176_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272895_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272892_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KY476323_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JF911677_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JF911675_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
HM585198_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
FJ709457_X_P-F      gtcggcgctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgccccct
DQ823095_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
EF026754_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843180_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
AF223964_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
DQ823093_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
DQ823094_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
EF026752_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
EF026753_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
EU366118_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
FJ657529_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
FJ709460_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
FJ709462_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
FJ709463_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
FJ709464_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
HM585192_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
HM585193_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
HM585197_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
HQ378247_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JF911674_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272889_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272893_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272899_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272909_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272910_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272913_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
JQ272914_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KC494404_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843174_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KX264496_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KY382415_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KY458061_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
MK808039_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
AY179735_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
DQ823092_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
EF026751_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843179_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843190_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843197_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843198_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843203_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
KJ843206_X_P-F      gtcggcgctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgccccct
DQ629996_X_P-F      gtcggcgctgaatcccgcggacgacccctctcgaggtcgcttggggctgtaccgccccct
FJ589065_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgtttggggctgtatcgccccct
KX757665_X_P-F      gtcggcgctgaatcccgcggacgacccctctcggggtcgtttggggctgtatcgccccct
DQ629959_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggttgtaccgccccct
DQ629985_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629988_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629983_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629944_X_P-F      gtcggcgctgaatcccgcggacgattcctctcggggtcgcttggggttgtaccgccccct
DQ629932_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629973_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
AY090459_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KP718104_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
KP718113_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
AY090461_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccccct
DQ629960_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629938_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629943_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629978_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629993_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629989_X_P-F      gtcggcgctaaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629935_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629951_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629955_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629994_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629972_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629987_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggttgtaccgccccct
DQ629975_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629969_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629968_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629966_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
AY090458_X_C-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629981_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629971_X_P-F      gtcggcgctaaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629963_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629949_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629931_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629948_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629961_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629964_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629945_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629977_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
AY090456_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629962_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629974_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629979_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629990_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
DQ629992_X_P-F      gtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgccccct
KJ676694_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
JF911695_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
MG098584_X_P-F      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggggtctaccgccctct
JF911693_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctcacgccctct
MG098569_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
AB166850_X_P-F      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgccctct
KJ843225_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcc
DQ823088_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctstaccgccctct
EF026747_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctstaccgccctct
JF911694_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
MG098580_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
MG098566_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
MG098582_X_P-F      gtcggcgctgaatcccgcggacgacccctctcggggccgcttagggctctaccgccctct
X75658_X_C-F        gtcggcgctgaatccagcggacgaaccctcccggggccgcttggggctctaccgccctct
MG098578_X_P-F      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgccctct
JN688709_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
JF911692_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
DQ823087_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
EF026746_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
MG098570_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
KJ843223_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcctgggggtctaccgacctct
MG098565_X_P-F      gtcggggctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
KJ843185_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgtttggggctctaccgccctct
KY476326_X_P-F      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgccctct
JF911696_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggatctaccgccctct
MG098575_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
KJ843209_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
MG098577_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
KJ843175_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgtttggggctctaccgccctct
KJ843189_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgtttggggctctaccgccctct
DQ629986_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
JQ272900_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
MG098579_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
KJ843226_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
KJ843220_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
HE981181_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggagtctaccgccctct
KC494398_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggagtctaccgccctct
DQ629958_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
DQ776247_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
EU366116_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
FJ657519_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
FJ657522_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
JF911679_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
JF911680_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
KJ843213_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
KJ843212_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
KJ843207_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
KJ843208_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
KJ843210_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
JN688701_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
FJ657528_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
KJ843219_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
KJ843221_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
KJ843222_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
KJ843224_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
KY382411_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
MG098564_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
MK808040_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
AF223962_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
DQ823090_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
EF026749_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
KJ843211_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
MG098583_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
AB365446_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
MG098573_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
DQ823089_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
EF026748_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
EU366132_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctct
JF911678_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
MG001259_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
JN811656_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
EF576812_X_P-F      gtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctaccgccctct
EF576808_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
DQ823086_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
EF026745_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
MG098574_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
JX079937_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
AB365450_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
AB365449_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
AF223965_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
JN811655_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
JQ272906_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
KX264499_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctct
KJ638660_X_P-F      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctttrccgccctct
KJ638662_X_P-F      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctttgccgccctct
DQ629946_X_P-F      gtcggcgctgaatcccgcggacgacccctcccgggcccgcttggggcttacccgccctct
KP995104_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccttt
DQ629941_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtatcgccccat
DQ899145_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
DQ899144_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
DQ899146_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
DQ899147_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
KJ843191_X_P-F      atcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
DQ629937_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgccctct
DQ629991_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgccctct
KC494396_X_P-F      atcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
KP995110_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
KP995097_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccctct
KP995107_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
KP995113_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggatgtaccgccctct
KP995114_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcctggggctgtaccgccctct
KP995115_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgattggggctgtaccgccctct
KC494394_X_P-F      atcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
KC494399_X_P-F      atcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
DQ899143_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
KC494405_X_P-F      atcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
KC494401_X_P-F      ctcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
KC494397_X_P-F      atcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
DQ899142_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
KT896494_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
KC494402_X_P-F      ctcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
KC494403_X_P-F      ctcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
KX264497_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
KC494395_X_P-F      atcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
X69798_X_P-F        atcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
DQ629934_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgccctct
KP995120_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
AY311369_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctct
DQ629956_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgccccct
DQ629967_X_P-F      gtcggcgctgaatcccgcggacgacccctcccgaggccgcttggggctataccgccctct
DQ629965_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgccctct
DQ629954_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgccctct
DQ629995_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgccctct
DQ629953_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgccctct
DQ629940_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgccctct
DQ629933_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgccctct
DQ629950_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgccctct
AY090455_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgccctct
DQ629997_X_P-F      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgccctct
                     *  * *** * *** ********  * **  * *  **  * **  *    **  *   

AB214516_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggtctcgcctgc
JQ272888_X_P-F      tctgcgtctgccgttccagccaaccacgggtcgcacctctctttacgcggactccccgtc
JN688720_X_P-F      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KP995101_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcatctctctttacgcggactccccgtc
KP995105_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
FJ589066_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995118_X_P-F      tcttcgtctgccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
DQ899148_X_P-F      tcttcgtccgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
X75663_X_P-F        tcttcgtctgccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
KP718106_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995106_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP718103_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
FJ589067_X_P-F      tcttcgtctgccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
MH051986_X_P-F      tcttcgtctgccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
MH051987_X_P-F      tcttcgtctgccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
KP995111_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995117_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995126_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
DQ899150_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
EF397982_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995123_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995119_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP718111_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AY311370_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995124_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB116550_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB116549_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KJ638659_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995125_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036905_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036906_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036907_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036908_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036909_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036912_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036913_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KX264498_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036911_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036920_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036914_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036915_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036916_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036917_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036918_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AB036919_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KM659861_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP718109_X_P-F      tcttcgtctgccgttccagccgacaacgggtcgtacctctctttacgcggactccccgtc
KP718112_X_P-F      tcttcgtctgccgttccagccgacaacgggtcgtacctctctttacgcggactccccgtc
KP995109_X_P-F      tcttcgtctgccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
AB116551_X_P-F      tcttcgtctgccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
AB036910_X_P-F      tcttcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
DQ899149_X_P-F      tcttcgtctgccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
DQ629930_X_P-F      tctcagtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JN792921_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggmctccccgtc
KF199901_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629947_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ638663_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ638656_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ638657_X_P-F      tctccgtctgccgttccagccracgacgggtcgcccctctctttacgcggcctccccgtc
KJ638664_X_P-F      tctccgtctgccgttccacccgacgacgggtcgcacctctctttacgcggcctccccgtc
KP718107_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM590474_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585186_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM590471_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM590472_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KM233681_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
AB116654_X_P-F      tctccgtctgccgttccagccgacgacgggtcgtacctctctttacgcggcctccccgtc
KP718110_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY476322_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY476332_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY476330_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
FJ657525_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JF911673_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
EU670261_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
AB086397_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY476329_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY476331_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY476324_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272890_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JN792918_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JF911676_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
EU670262_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
EU670260_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
MF593354_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY476325_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY476328_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272894_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272891_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JN688699_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843181_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843193_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ823091_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
EF026750_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843170_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585194_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM627320_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JX079936_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY382417_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
MG001258_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
MF593380_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
MF593376_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
MF593360_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
MF593356_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843205_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843202_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843169_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843168_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843194_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843204_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843164_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843163_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JN792920_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JN792919_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JN792917_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY476327_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JN792914_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
AB064316_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
AF223963_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
EU366133_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY382416_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JN792916_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JN792922_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272905_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
FJ709458_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
FJ709459_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
FJ709465_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
FJ709494_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HE981182_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HE981183_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585187_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585188_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585189_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585191_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585195_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585196_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585199_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM590473_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272901_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272904_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272908_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843171_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585190_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM622135_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843195_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ586805_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272898_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272907_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843200_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JN688691_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
JN688703_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
KC494400_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ586806_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ586807_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ586808_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843167_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843201_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585200_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843177_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
AB116552_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
KP995116_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
MK058437_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
MF593371_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
MF593367_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY458062_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
KP995098_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KM998715_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843196_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843199_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843178_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843176_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272895_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272892_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY476323_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JF911677_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
JF911675_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585198_X_P-F      tctccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
FJ709457_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ823095_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
EF026754_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843180_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
AF223964_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ823093_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ823094_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
EF026752_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
EF026753_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
EU366118_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
FJ657529_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
FJ709460_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
FJ709462_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
FJ709463_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
FJ709464_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585192_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585193_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HM585197_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
HQ378247_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JF911674_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272889_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272893_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272899_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272909_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272910_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272913_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
JQ272914_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KC494404_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843174_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KX264496_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY382415_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KY458061_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
MK808039_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
AY179735_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ823092_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
EF026751_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843179_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843190_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843197_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843198_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843203_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ843206_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629996_X_P-F      ttaccgtctgccactccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
FJ589065_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
KX757665_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629959_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629985_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629988_X_P-F      tctacgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629983_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629944_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629932_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629973_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
AY090459_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KP718104_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KP718113_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
AY090461_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629960_X_P-F      tcttcgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629938_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629943_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629978_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629993_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629989_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629935_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629951_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629955_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629994_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629972_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629987_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629975_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629969_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629968_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629966_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
AY090458_X_C-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629981_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629971_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629963_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629949_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629931_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629948_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629961_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629964_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629945_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629977_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
AY090456_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629962_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629974_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629979_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629990_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629992_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggcctccccgtc
KJ676694_X_P-F      tctccgtctgccgttcctkccracgacgggtcgcacctctctttacgcggactccccgtc
JF911695_X_P-F      tctccgtctgccgttccttccgacgacgggtcgcacctctctttacgcggactccccatc
MG098584_X_P-F      tctccgtctgccgttccttccgacaacgggtcgcacctctctttacgcggactccccgtc
JF911693_X_P-F      tctccgtctgccgttccttccgacaacgggtcgcacctctctttacgcggactccccgtc
MG098569_X_P-F      yctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
AB166850_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843225_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
DQ823088_X_P-F      actgcgtctgcygttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
EF026747_X_P-F      actgcgtctgcygttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
JF911694_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
MG098580_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
MG098566_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
MG098582_X_P-F      tctccgtctgccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
X75658_X_C-F        tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
MG098578_X_P-F      tctgcgtctgccgttccagccgactacgggtcgcacctctctttacgcggactccccgtc
JN688709_X_P-F      tctgcgtctgctgttccagccgacnacgggtcgcacctctctttacgcggactccccgtc
JF911692_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
DQ823087_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
EF026746_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
MG098570_X_P-F      tctgcgtctgccgttccagccaaccacgggtcgcacctctctttacgcggactccccgtc
KJ843223_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
MG098565_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggaccccccgtc
KJ843185_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggtctccccgtc
KY476326_X_P-F      cttgcgtctgccgttccggccgacaacgggtcgcacctctctttacgcggactccccgtc
JF911696_X_P-F      tctgcgtctgccgttccggccgaccacgggtcgcacctctctttacgcggactccccgtc
MG098575_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843209_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
MG098577_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843175_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggtctccccgtc
KJ843189_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggtctccccgtc
DQ629986_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
JQ272900_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgtacctctctttacgcggactccccgtc
MG098579_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843226_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843220_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
HE981181_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KC494398_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
DQ629958_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
DQ776247_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
EU366116_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
FJ657519_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
FJ657522_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
JF911679_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
JF911680_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843213_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843212_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843207_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843208_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843210_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
JN688701_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
FJ657528_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843219_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843221_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843222_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843224_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KY382411_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
MG098564_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
MK808040_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
AF223962_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
DQ823090_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
EF026749_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ843211_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
MG098583_X_P-F      tctgcatctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
AB365446_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
MG098573_X_P-F      tctgcgtctgccgttccagccaaccacgggtcgcacctctctttacgcggactccccgtc
DQ823089_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
EF026748_X_P-F      tctgcgtctgctgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
EU366132_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
JF911678_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
MG001259_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
JN811656_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
EF576812_X_P-F      tctgcgtctgccgttccagccaaccacgggtcgcacctctctttacgcggactccccgtc
EF576808_X_P-F      tctgcgtctgccgttccggccgaccacgggtcgcacctctctttacgcggactccccgtc
DQ823086_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
EF026745_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
MG098574_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
JX079937_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
AB365450_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
AB365449_X_P-F      tctgcrtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
AF223965_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
JN811655_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
JQ272906_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KX264499_X_P-F      tctgcgtctgccgttccagccgaccacgggtcgcacctctctttacgcggactccccgtc
KJ638660_X_P-F      tctccgtctcccgttccagccgacgacgggtcgcacctctcttttcgcggactccccgty
KJ638662_X_P-F      tctccgtctcccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
DQ629946_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995104_X_P-F      tttccgtctaccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
DQ629941_X_P-F      ctcccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
DQ899145_X_P-F      tctccgtctgccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
DQ899144_X_P-F      tctccgtctgccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
DQ899146_X_P-F      tctccgtctgccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
DQ899147_X_P-F      tctccgtctgccgttccagccgacaacgggtcgcacctctctttacgcggactccccgtc
KJ843191_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
DQ629937_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctatttacgcggactccccgtc
DQ629991_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggactccccgtc
KC494396_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995110_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995097_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995107_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995113_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995114_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KP995115_X_P-F      tctccgtctgccgttccagccgacgacgggtcccacctctctttacgcggactccccgtc
KC494394_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KC494399_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
DQ899143_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KC494405_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KC494401_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KC494397_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
DQ899142_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KT896494_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KC494402_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KC494403_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KX264497_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
KC494395_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
X69798_X_P-F        tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
DQ629934_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggactccccgtc
KP995120_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
AY311369_X_P-F      tctccgtctactgttcaagcctacgacgggtcgcacctctctttacgcggactccccgtc
DQ629956_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggactccccgtc
DQ629967_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggactccccgtc
DQ629965_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggactccccgtc
DQ629954_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggcctccccgtc
DQ629995_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggactccccgtc
DQ629953_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggactccccgtc
DQ629940_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggactccccgtc
DQ629933_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggactccccgtc
DQ629950_X_P-F      tctccgtctgccgttccagccaacgacgggtcgcacctctctttacgcggactccccgtc
AY090455_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
DQ629997_X_P-F      tctccgtctgccgttccagccgacgacgggtcgcacctctctttacgcggactccccgtc
                          **  *   **   ** ** ***** *    **** *** ***** * * **   

AB214516_X_P-F      tgttccttctcatgtgccgcatcgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272888_X_P-F      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN688720_X_P-F      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
KP995101_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
KP995105_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcctggag
FJ589066_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995118_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ899148_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
X75663_X_P-F        tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP718106_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995106_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
KP718103_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ589067_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
MH051986_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH051987_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995111_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995117_X_P-F      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995126_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ899150_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF397982_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995123_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcccatggag
KP995119_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP718111_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY311370_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995124_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB116550_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB116549_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ638659_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995125_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036905_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036906_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036907_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036908_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036909_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036912_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036913_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KX264498_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036911_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036920_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036914_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036915_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036916_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036917_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036918_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036919_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KM659861_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP718109_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP718112_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995109_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB116551_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB036910_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ899149_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629930_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN792921_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF199901_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629947_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttaacctctgcacgtcgcatggag
KJ638663_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
KJ638656_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ638657_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ638664_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP718107_X_P-F      tgttccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM590474_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585186_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM590471_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM590472_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KM233681_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB116654_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP718110_X_P-F      tgttcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY476322_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY476332_X_P-F      tgttccttcacatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY476330_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
FJ657525_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JF911673_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtagcatggag
EU670261_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB086397_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY476329_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY476331_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY476324_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272890_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcccctctgcacgtcgcatggag
JN792918_X_P-F      tgttccttctcatctgccggaccgtgtgcacttctcttcacctctgcacgtctcatggag
JF911676_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU670262_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU670260_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF593354_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY476325_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY476328_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272894_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272891_X_P-F      tgttccttctcatctgccggaccgtgtgcacttctcttcatctctgcacgtcgcatggag
JN688699_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843181_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843193_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ823091_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF026750_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843170_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585194_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM627320_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JX079936_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY382417_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG001258_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF593380_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF593376_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF593360_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF593356_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843205_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843202_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843169_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843168_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843194_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843204_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843164_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843163_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN792920_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN792919_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN792917_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY476327_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN792914_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB064316_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AF223963_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU366133_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY382416_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN792916_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN792922_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272905_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ709458_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ709459_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ709465_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ709494_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HE981182_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HE981183_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585187_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585188_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585189_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585191_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585195_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585196_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585199_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM590473_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272901_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272904_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272908_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843171_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585190_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM622135_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843195_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ586805_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272898_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272907_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843200_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN688691_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN688703_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KC494400_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ586806_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ586807_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ586808_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843167_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843201_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585200_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843177_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB116552_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995116_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MK058437_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF593371_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF593367_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY458062_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995098_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KM998715_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843196_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843199_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843178_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843176_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272895_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272892_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY476323_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JF911677_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JF911675_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585198_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ709457_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ823095_X_P-F      tgttccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF026754_X_P-F      tgttccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843180_X_P-F      tgttccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AF223964_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ823093_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ823094_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF026752_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF026753_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU366118_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ657529_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ709460_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ709462_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ709463_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ709464_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585192_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585193_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM585197_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HQ378247_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JF911674_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272889_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272893_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272899_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272909_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272910_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272913_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272914_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KC494404_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843174_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KX264496_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY382415_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY458061_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MK808039_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY179735_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ823092_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF026751_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843179_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843190_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843197_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843198_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843203_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843206_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629996_X_P-F      ttttccttctcatctgccttaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ589065_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KX757665_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629959_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcacttcacatctgtaggtcccttgggg
DQ629985_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629988_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629983_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629944_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629932_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629973_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY090459_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP718104_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP718113_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY090461_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629960_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629938_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629943_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629978_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629993_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgctacacctctgcacgtcgcatggag
DQ629989_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629935_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629951_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629955_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629994_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629972_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629987_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629975_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629969_X_P-F      tgttccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629968_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629966_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY090458_X_C-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629981_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629971_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629963_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629949_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629931_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629948_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629961_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629964_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629945_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629977_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY090456_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629962_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629974_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629979_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629990_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629992_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ676694_X_P-F      tgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgmatggag
JF911695_X_P-F      tgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG098584_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JF911693_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG098569_X_P-F      tgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcacatggag
AB166850_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843225_X_P-F      tgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ823088_X_P-F      tgttccttctcatctgccggwccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF026747_X_P-F      tgttccttctcatctgccggwccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JF911694_X_P-F      tgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgacgcatggag
MG098580_X_P-F      tgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgacgcatggag
MG098566_X_P-F      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG098582_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
X75658_X_C-F        tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG098578_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN688709_X_P-F      tgttccttctcntctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JF911692_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ823087_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF026746_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG098570_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843223_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG098565_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843185_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY476326_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JF911696_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG098575_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843209_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG098577_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843175_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843189_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629986_X_P-F      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272900_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG098579_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
KJ843226_X_P-F      tgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843220_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HE981181_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KC494398_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629958_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ776247_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU366116_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ657519_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ657522_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JF911679_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JF911680_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843213_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843212_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843207_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843208_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843210_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN688701_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ657528_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843219_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843221_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843222_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843224_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KY382411_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG098564_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MK808040_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AF223962_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ823090_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF026749_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843211_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG098583_X_P-F      tgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB365446_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcctggag
MG098573_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ823089_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF026748_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU366132_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JF911678_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG001259_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN811656_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF576812_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF576808_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ823086_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EF026745_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG098574_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JX079937_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB365450_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB365449_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AF223965_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JN811655_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272906_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KX264499_X_P-F      tgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ638660_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ638662_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629946_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcgcgtcgcatggag
KP995104_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
DQ629941_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ899145_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ899144_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ899146_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ899147_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KJ843191_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629937_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629991_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KC494396_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995110_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995097_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995107_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
KP995113_X_P-F      tgttccttctcatcagccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995114_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995115_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KC494394_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KC494399_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ899143_X_P-F      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
KC494405_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KC494401_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KC494397_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
DQ899142_X_P-F      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KT896494_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KC494402_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KC494403_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KX264497_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KC494395_X_P-F      tgttccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
X69798_X_P-F        tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629934_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KP995120_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY311369_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629956_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629967_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629965_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629954_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629995_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629953_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629940_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgctttacctctgcacgtcgcatggag
DQ629933_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629950_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY090455_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ629997_X_P-F      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
                    * * *** * *    ***    * ********** **     ****   *     ***  

AB214516_X_P-F      accaccgtgaacgcccgccaaatcttgcccaaggtcttacataagaggactcttggactc
JQ272888_X_P-F      accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactc
JN688720_X_P-F      accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactt
KP995101_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataaaaggactcttggactt
KP995105_X_P-F      accaccgtgaacaccccctggaatctgccaacagtcttacataagaggactcttggactt
FJ589066_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KP995118_X_P-F      accaccgtgaacgccccctggaatatgccaacagtcttatataagaggactcttggactt
DQ899148_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
X75663_X_P-F        accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KP718106_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KP995106_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KP718103_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
FJ589067_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
MH051986_X_P-F      accaccatgaacgccccctggagtctgccaacagtcttacataagaggactcttggactt
MH051987_X_P-F      accaccatgaacgccccctggagtctgccaacagtcttacataagaggactcttggactt
KP995111_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KP995117_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KP995126_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
DQ899150_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
EF397982_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataaaaggactcttggactt
KP995123_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KP995119_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KP718111_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AY311370_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KP995124_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB116550_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB116549_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KJ638659_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KP995125_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036905_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036906_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036907_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036908_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036909_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036912_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036913_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KX264498_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036911_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036920_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036914_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036915_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036916_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036917_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036918_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB036919_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KM659861_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KP718109_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KP718112_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
KP995109_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
AB116551_X_P-F      accaccgtgaacgccccatggaatctgccaacagtcttacataagaggactcttggactt
AB036910_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
DQ899149_X_P-F      accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactt
DQ629930_X_P-F      accaccgtgaacgcccctcgcagcttgccaacagtcttacataagcggactcttggactc
JN792921_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KF199901_X_P-F      accaccgtgaacgcccctagaaacttkyymacmkyykymyawwmryskwytsttsatsty
DQ629947_X_P-F      accaccgtgaacgcccctcggagcctaccaacagtcttacatcagcggactcttggactc
KJ638663_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactc
KJ638656_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
KJ638657_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
KJ638664_X_P-F      accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactc
KP718107_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
HM590474_X_P-F      accaccgtgaacgcccctcggagcttgccaacagccttacataagcggactcttggactt
HM585186_X_P-F      accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactt
HM590471_X_P-F      accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactt
HM590472_X_P-F      accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactt
KM233681_X_P-F      accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactt
AB116654_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KP718110_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KY476322_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactattggactt
KY476332_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactattggactt
KY476330_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactt
FJ657525_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JF911673_X_P-F      acccccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
EU670261_X_P-F      accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactt
AB086397_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KY476329_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactt
KY476331_X_P-F      accaccgtgaacgccccgcgaagcttgccaacagtcttacataagcggactcttggactt
KY476324_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272890_X_P-F      accaccgtaaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JN792918_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JF911676_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
EU670262_X_P-F      accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactt
EU670260_X_P-F      accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactt
MF593354_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagccttacataagcggactcttggactt
KY476325_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KY476328_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272894_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272891_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JN688699_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843181_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843193_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
DQ823091_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagmggactcttggactt
EF026750_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagmggactcttggactt
KJ843170_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM585194_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM627320_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JX079936_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KY382417_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
MG001258_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
MF593380_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
MF593376_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
MF593360_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactt
MF593356_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactt
KJ843205_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843202_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843169_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactt
KJ843168_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843194_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843204_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843164_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KJ843163_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JN792920_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JN792919_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JN792917_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KY476327_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JN792914_X_P-F      accaccgtgaacgcccctcgaagcttgccaacaatcttacataagcggactcttggactt
AB064316_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
AF223963_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
EU366133_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KY382416_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JN792916_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JN792922_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272905_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
FJ709458_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
FJ709459_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
FJ709465_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
FJ709494_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HE981182_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HE981183_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM585187_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM585188_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM585189_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM585191_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM585195_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM585196_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM585199_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM590473_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272901_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272904_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272908_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KJ843171_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM585190_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM622135_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KJ843195_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KJ586805_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272898_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
JQ272907_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843200_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
JN688691_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JN688703_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KC494400_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KJ586806_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KJ586807_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KJ586808_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KJ843167_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KJ843201_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
HM585200_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KJ843177_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
AB116552_X_P-F      accaccgtgaacgcccctagaagcttgccaacagtcttacataagcggactcttggactt
KP995116_X_P-F      accaccgtgaacgcccctagaagcttgccaacagtcttacataagcggactcttggactt
MK058437_X_P-F      accaccgtgaacgcccctagaagcttgccaacagtcttacataagcggactcttggactt
MF593371_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
MF593367_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KY458062_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KP995098_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KM998715_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KJ843196_X_P-F      accaccgtgaacacccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843199_X_P-F      accaccgtgaacacccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843178_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843176_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272895_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272892_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KY476323_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JF911677_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JF911675_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM585198_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
FJ709457_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
DQ823095_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
EF026754_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KJ843180_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
AF223964_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
DQ823093_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
DQ823094_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
EF026752_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
EF026753_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
EU366118_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
FJ657529_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
FJ709460_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
FJ709462_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
FJ709463_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
FJ709464_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM585192_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM585193_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HM585197_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
HQ378247_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JF911674_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272889_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272893_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272899_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272909_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272910_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272913_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
JQ272914_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KC494404_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KJ843174_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KX264496_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KY382415_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
KY458061_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
MK808039_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactt
AY179735_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagmggactcttggactt
DQ823092_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagmggactcttggactt
EF026751_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagmggactcttggactt
KJ843179_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843190_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843197_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843198_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843203_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KJ843206_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
DQ629996_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
FJ589065_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
KX757665_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactt
DQ629959_X_P-F      accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactc
DQ629985_X_P-F      accaccgcgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629988_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629983_X_P-F      accaccgtgaacgccccctgaagtttgccaacagtcttacataagaggactcttggactc
DQ629944_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629932_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629973_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
AY090459_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
KP718104_X_P-F      accaccgtgaacgcccctcgaagtttgccaacagtcttacataagcggactcttggactc
KP718113_X_P-F      accaccgtgaacgcccctcgaagtttgccaacagtcttacataagcggactcttggactc
AY090461_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629960_X_P-F      gccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactattggactc
DQ629938_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629943_X_P-F      accaccgtgaacgcccctcgcagcttgccaacagtcttacataagcggactcttggactc
DQ629978_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629993_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629989_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629935_X_P-F      accaccgtgaacgcccctcgcagcttgccaacagtcttacataagcggactcttggactc
DQ629951_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629955_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629994_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629972_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629987_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629975_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629969_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629968_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629966_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
AY090458_X_C-F      accaccgtgaacgcccctcgaagcctgccaacagtcttacataagcggactcttggactc
DQ629981_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629971_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629963_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629949_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629931_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629948_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629961_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629964_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629945_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataaggggactcttggactc
DQ629977_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
AY090456_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629962_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629974_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629979_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629990_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
DQ629992_X_P-F      accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactc
KJ676694_X_P-F      accaccgtgaacgcccacyggagtytgccaacagtcttacataagaggactcttggactt
JF911695_X_P-F      accaccgtgaacgcccactggagtctgccaacagtcttacataagaggactcttggactc
MG098584_X_P-F      accaccgtgaacgccccctggagtctgccaacagtcttatataagaggactcttggactt
JF911693_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactc
MG098569_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
AB166850_X_P-F      accaccgtgaacgccccctggagtttgccaatagtcttacataacaggactattggactt
KJ843225_X_P-F      accaccgtgaacgccccctggtgtttgccaacagtcttatataacaggactattggactt
DQ823088_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaraggactmttggactt
EF026747_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaraggactmttggactt
JF911694_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactt
MG098580_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactt
MG098566_X_P-F      accaccgtgaacgccccccggagcttgccaacagtcttacataaacggactattggactt
MG098582_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactt
X75658_X_C-F        accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactt
MG098578_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactmttggactt
JN688709_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactt
JF911692_X_P-F      accaccgtgaacgccccctggagtttgccaacagccttatataagaggactattggactt
DQ823087_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttgcataagaggactattggactt
EF026746_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttgcataagaggactattggactt
MG098570_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactmttggactt
KJ843223_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataacaggactattggactt
MG098565_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KJ843185_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KY476326_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactt
JF911696_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttatataaaaggactattggactt
MG098575_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactmttggactt
KJ843209_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
MG098577_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactmttggactt
KJ843175_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaacggactattggactt
KJ843189_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
DQ629986_X_P-F      accaccgtgaacgccccctggagtttgccaaaagtcttacataaaaggactgttggactt
JQ272900_X_P-F      accaccgtgaacgcccactggagtttgccaacagtcttacataaaaggactattggactt
MG098579_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KJ843226_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
KJ843220_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
HE981181_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
KC494398_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
DQ629958_X_P-F      accaccgtgaacgccccctggagtttgcccacagtcttacataaaaggactgttggactt
DQ776247_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
EU366116_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
FJ657519_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
FJ657522_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
JF911679_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
JF911680_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
KJ843213_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KJ843212_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KJ843207_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KJ843208_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KJ843210_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
JN688701_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactactggactt
FJ657528_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
KJ843219_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
KJ843221_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
KJ843222_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
KJ843224_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
KY382411_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
MG098564_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
MK808040_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
AF223962_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactt
DQ823090_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
EF026749_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KJ843211_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
MG098583_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactt
AB365446_X_P-F      accaccgtgaacgccccctggagtttgccaatagtcttacataaaaggactattggactt
MG098573_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactmttggactt
DQ823089_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactmttggactt
EF026748_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactmttggactt
EU366132_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
JF911678_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
MG001259_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
JN811656_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
EF576812_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
EF576808_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
DQ823086_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
EF026745_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
MG098574_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
JX079937_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
AB365450_X_P-F      accaccgtgaacgccccctggagtttgccaacagycttacataaaaggactattggactt
AB365449_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
AF223965_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
JN811655_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
JQ272906_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
KX264499_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactt
KJ638660_X_P-F      acaaccgtgaacgccccctggagtttgccaacagccttacataagcggactcttggactg
KJ638662_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagcggactcttggactg
DQ629946_X_P-F      accaccctgagcccccctcggggtttgccaacagtctttcataagaggactcttggactt
KP995104_X_P-F      accaccgtgaacgccccctggaatttgccaacagccttacataagaggactcttggactt
DQ629941_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggtctcttggactt
DQ899145_X_P-F      accaccgtgaacgcccccttgagtttgccaacagtcttacacaagaggactcttggactt
DQ899144_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacacaagaggactcttggactt
DQ899146_X_P-F      accaccgtgaacgccccttggagtttgccaacagtcttacacaagaggactcttggactt
DQ899147_X_P-F      accaccgtgaacgccccttggagtttgccaacagtcttacacaagaggactcttggactt
KJ843191_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggcttt
DQ629937_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
DQ629991_X_P-F      accaccgtgaacgcccctcggagtttgccaacagtcttacataagaggactcttggactt
KC494396_X_P-F      accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactt
KP995110_X_P-F      accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactt
KP995097_X_P-F      accaccgtgaacgccccctggagtttgccaacagccttatataagaggactcttggactt
KP995107_X_P-F      accaccgtgaacgccccctggagtttgccaacagccttatataagaggactcttggactt
KP995113_X_P-F      accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactt
KP995114_X_P-F      accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactt
KP995115_X_P-F      accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactt
KC494394_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KC494399_X_P-F      accaccgtgaacgcccmctggagtttgccaacagccttacataagaggactcttggactt
DQ899143_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KC494405_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KC494401_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KC494397_X_P-F      accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactt
DQ899142_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KT896494_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KC494402_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KC494403_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KX264497_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
KC494395_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagcggactcttggactt
X69798_X_P-F        accaccgtgaacgccccctggagtttgccaacagtcttacataagcggactcttggactt
DQ629934_X_P-F      accaccgtgaacgcccctgggagtttgccaacagtcttacataagaggactcttggactt
KP995120_X_P-F      accaccgtgaacgccccctggagtttgcccacagtcttacataagaggactcttggactt
AY311369_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
DQ629956_X_P-F      accaccgtgaacgcccctgggagtttgccaacagtcttacataagaggactcttggactt
DQ629967_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
DQ629965_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
DQ629954_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
DQ629995_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
DQ629953_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
DQ629940_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
DQ629933_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
DQ629950_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
AY090455_X_P-F      accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactt
DQ629997_X_P-F      accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactt
                     *  **   * * ***         *    *         *         *  *    * 

AB214516_X_P-F      tcagcaatgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgg
JQ272888_X_P-F      tctgtaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgg
JN688720_X_P-F      tcaggacggttcatgacctggatcgaagaatacatcaaagactgtgtgtttaaagactgg
KP995101_X_P-F      ttaggaaggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
KP995105_X_P-F      tcaggacggtcaatgacccggatcgaagaatacatcaaagactgtgtatttaaggactgg
FJ589066_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtgtttaaggactgg
KP995118_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttacggactgg
DQ899148_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
X75663_X_P-F        tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
KP718106_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP995106_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP718103_X_P-F      tccggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
FJ589067_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
MH051986_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
MH051987_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP995111_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP995117_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP995126_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggaatgg
DQ899150_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
EF397982_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP995123_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP995119_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP718111_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AY311370_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP995124_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB116550_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgg
AB116549_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ638659_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP995125_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036905_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036906_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036907_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036908_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036909_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036912_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036913_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KX264498_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036911_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036920_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036914_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036915_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036916_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036917_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036918_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB036919_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KM659861_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
KP718109_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
KP718112_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
KP995109_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
AB116551_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
AB036910_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ899149_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629930_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
JN792921_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KF199901_X_P-F      yyaskrwkgtmracymcmwggatcgaagaatacatcaaagactgtgtatttaaggactgg
DQ629947_X_P-F      tctggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
KJ638663_X_P-F      tccggacggtcaatgacctggatcgaaggatacatcaaagactgtgtatttaaggactgg
KJ638656_X_P-F      tccggacggtcaatgacctggatcgaagaatacttcaaagactgtgtatttaatgactgg
KJ638657_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ638664_X_P-F      tcgggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP718107_X_P-F      tccggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM590474_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585186_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM590471_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM590472_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KM233681_X_P-F      tcaggaaggtcaatgacctggatcaaagaatacatcaaagactgtgtatttaaggactgg
AB116654_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP718110_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KY476322_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KY476332_X_P-F      tcaggaaggtcaatgacctggatcgaaggatacatcaaagactgtgtatttaaggactgg
KY476330_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
FJ657525_X_P-F      gcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttgcggactgg
JF911673_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
EU670261_X_P-F      tcgggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB086397_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KY476329_X_P-F      tcaggaaggtcaatgacctggatcgaagattacatcaaagactgtgtatttaaggactgg
KY476331_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KY476324_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272890_X_P-F      tcaggaaggtcaatcgcctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JN792918_X_P-F      tcagggaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JF911676_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
EU670262_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
EU670260_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
MF593354_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KY476325_X_P-F      tcaggaagatcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KY476328_X_P-F      tcaggaagatcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272894_X_P-F      tccggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272891_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JN688699_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843181_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843193_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaggactgtgtatttaaggactgg
DQ823091_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
EF026750_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843170_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585194_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM627320_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JX079936_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KY382417_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
MG001258_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
MF593380_X_P-F      tcaggaaggtcaatcacctggatcgaaraatacatcaaagactgtgtatttaaggactgg
MF593376_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
MF593360_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
MF593356_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843205_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843202_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843169_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843168_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843194_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843204_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843164_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843163_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JN792920_X_P-F      tcaggaaggtcattgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JN792919_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JN792917_X_P-F      tcagggaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KY476327_X_P-F      tcagggaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JN792914_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB064316_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AF223963_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
EU366133_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KY382416_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JN792916_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JN792922_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272905_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
FJ709458_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
FJ709459_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
FJ709465_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
FJ709494_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HE981182_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HE981183_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585187_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585188_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585189_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585191_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585195_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585196_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585199_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM590473_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272901_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272904_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272908_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843171_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585190_X_P-F      tcgggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM622135_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843195_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ586805_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272898_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272907_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843200_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JN688691_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JN688703_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KC494400_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ586806_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ586807_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ586808_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843167_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843201_X_P-F      tcaggaagggtaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585200_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843177_X_P-F      tcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AB116552_X_P-F      tcgggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP995116_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
MK058437_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
MF593371_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
MF593367_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KY458062_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KP995098_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KM998715_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843196_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843199_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843178_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843176_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272895_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272892_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KY476323_X_P-F      tcaggaaggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JF911677_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JF911675_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585198_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
FJ709457_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
DQ823095_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
EF026754_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843180_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AF223964_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
DQ823093_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
DQ823094_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
EF026752_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
EF026753_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
EU366118_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
FJ657529_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
FJ709460_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
FJ709462_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
FJ709463_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
FJ709464_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585192_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585193_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HM585197_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
HQ378247_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JF911674_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272889_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272893_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272899_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272909_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272910_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272913_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
JQ272914_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KC494404_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843174_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KX264496_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KY382415_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KY458061_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
MK808039_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
AY179735_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
DQ823092_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
EF026751_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843179_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843190_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843197_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843198_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843203_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
KJ843206_X_P-F      tcaggaaggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgg
DQ629996_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
FJ589065_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
KX757665_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629959_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629985_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629988_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629983_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629944_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629932_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629973_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
AY090459_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
KP718104_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
KP718113_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
AY090461_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629960_X_P-F      tcaggccggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629938_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629943_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629978_X_P-F      tcaggccggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629993_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629989_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629935_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629951_X_P-F      tcaggacggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgg
DQ629955_X_P-F      tcaggacggtcaatga