HBVdb

Dataset for nucleotide sequence SP of genotype F

[Download (right click)] [Edit] [Sequences] [Repertoires]

279 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


JN792921_SP_P-F      atgcccctatcytatccacacttccggaaactactattattagacgacga
KJ638663_SP_P-F      atgcccctatcttatccacacttccggaaactgctgttgttagacgacga
AY090456_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
FJ589065_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KX757665_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KP718104_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KP718113_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
AY090458_SP_C-F      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
AY090459_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
AY090461_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
AB116654_SP_P-F      atgcccctatcttatccacacttccggagactactgttgttagaggacga
KJ638664_SP_P-F      atgcccctatcttatccacacttccggaaacaagggttattagacgacga
KY476324_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
FJ657525_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagaggacga
AB086397_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgccga
KY476330_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KY476329_SP_P-F      atgcccctatcttatccacacttccggaagctactgttgttagacgacga
KY382415_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KY382416_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KY382417_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KP718107_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ638657_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ638656_SP_P-F      atgcccctatcttatccacacttccggaaacgactgttgttagacgacga
KF199901_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
JX079936_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KC494400_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
EU670261_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
JN792914_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
JN792917_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KP718110_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
MK058437_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KY476328_SP_P-F      atgcccctatcttatccacacttccggaaactactgttrttagacgacga
KY476327_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
KY476325_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843204_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843203_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843169_SP_P-F      atgcccctatcttatccacacttccggaaactgctgttgttagacgacga
KJ843167_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KC494404_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
JN792916_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
JN688699_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM627320_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
JN792922_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM622135_SP_P-F      atgcccctatcttatccacacttccggaaattactgttgttagacgacga
HM585200_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
FJ709465_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
FJ709457_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
FJ709462_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KP995116_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
DQ823092_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
DQ823093_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
EU366133_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585197_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843164_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843180_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843181_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843194_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
DQ823091_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
AB064316_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
AB116552_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
AF223963_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
AF223964_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
AY179735_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
DQ823094_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
DQ823095_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
EU366118_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
EU670260_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
EU670262_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
FJ657529_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
FJ709458_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
FJ709459_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
FJ709460_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
FJ709463_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
FJ709464_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
FJ709494_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HE981182_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HE981183_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585186_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585187_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585188_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585189_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585190_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585191_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585192_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585193_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585194_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585195_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585196_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585198_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM585199_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM590471_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM590472_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM590473_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HM590474_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
HQ378247_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
JN688691_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
JN688703_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
JN792918_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
JN792919_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
JN792920_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ586805_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ586806_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ586807_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ586808_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843163_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843168_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843171_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843174_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843176_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843177_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843178_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843179_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843190_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843193_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843195_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843196_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843197_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843198_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843199_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843200_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843201_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843202_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843205_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843206_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KM233681_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KM998715_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KP995098_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KX264496_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KY458061_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KY458062_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KY476322_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KY476323_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KY476332_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
KJ843170_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
MG098584_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
MG098575_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacatcga
KP995097_SP_P-F      atgcccctatcctatcaatgcttccggaagttgctgttgttagacgacga
KT896494_SP_P-F      atgcccctatcctatccacacttccggaaactactattgttagacgacga
DQ899147_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
DQ899144_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
DQ899145_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
DQ899146_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP995110_SP_P-F      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KJ843191_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
AY090455_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KC494396_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KC494399_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP995115_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP995107_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KC494401_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacca
KP995113_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP995104_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
DQ899142_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
DQ899143_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP995114_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
X69798_SP_P-F        atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP995120_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KC494402_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KC494397_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KC494395_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
AY311369_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KX264497_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KC494394_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KC494403_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KC494405_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
MG098577_SP_P-F      atgcccctatcctatccacacttccggaaactactgttattagacgacga
KP995118_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
JQ272888_SP_P-F      atgcccctatcctatccacacttccggaaactgctgttattagacgacga
AB365453_SP_P-F      atgcccctatcctatccacacttcctgaaactactgttgttagaccacga
MG098583_SP_P-F      atgcccctatcctatccacacttccggaaacttctgttattagacgacga
KP995101_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagaggacga
KJ638660_SP_P-F      atgcccctatcctatccacacttccggaaactgctgttgttagacgacga
KJ638662_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
MG098564_SP_P-F      atgcccttatcctatccacacttccggaaactactgttgttagacgacga
KJ676694_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
MG098574_SP_P-F      atgcccctatcctatccacacttccggaaactactgttattagacgacga
KP995111_SP_P-F      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
MG098582_SP_P-F      atgcccttatcctatccacacttccggaaactactgttgttagacgacga
MG098573_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
MG098570_SP_P-F      atgcccctatcctatccacacttccggaaactactggtgttagacgacga
KY476326_SP_P-F      atgcccctatcctatccacacttccggaaactgctgttgttagaggacga
FJ589066_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagaccacga
EF576808_SP_P-F      atgcccctatcctatccacacttccggaaactactgttattagacgacga
KP995105_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
AB036905_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
AB036909_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
AB036911_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
AB036912_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
AB036913_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
AB036914_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
AB036915_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
AB036916_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
AB036917_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
AB036918_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
AB036920_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
KX264498_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
AB036919_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
KP718106_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
AB116549_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ638659_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
AB116550_SP_P-F      atgcccctatcctatccacacttccggaaactactgttattagacgacga
KP995106_SP_P-F      atgcccctatcctatccacacttccggaaactactgttattagacgacga
KP718111_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
FJ589067_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
DQ899150_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP995123_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP995125_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP995119_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP995117_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgaaga
AY311370_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP995124_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP995126_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
MH051987_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
DQ899148_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP718103_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
X75663_SP_P-F        atgcccctatcctatccacacttccggaaactactgttgttagacgacga
MH051986_SP_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
AB036910_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
AB116551_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
JF439884_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
JF439885_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP718109_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP718112_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KP995109_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
DQ899149_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
AB365450_SP_P-F      atgcccctatcctatccacacttccggaaactactgttrttagacgacga
KJ843225_SP_P-F      atgcccctatcctatccacacttccggaaattactgttgttagacaacga
MG098566_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
MG098579_SP_P-F      atgcccctatcctatccacacttccggaarttactgttgttagacgacga
MG098578_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagaggacga
MG098565_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
JX079937_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
AB166850_SP_P-F      atgcccctatcctatccatacttccggaaactactgttgttagacgacga
MG098569_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843226_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843223_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843220_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843185_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
JN811655_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
JN811656_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
JN688720_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
JN688709_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
FJ657519_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
DQ823089_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
DQ823088_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
EU366132_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
FJ657528_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
JN688701_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843211_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843212_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843219_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843221_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843222_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843224_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KY382411_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
DQ823087_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
DQ776247_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
EU366116_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
FJ657522_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843207_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843208_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843210_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843213_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
AF223962_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
AB365449_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
AB214516_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
AF223965_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
DQ823086_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
DQ823090_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
EF576812_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
HE981181_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KC494398_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843175_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843189_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KJ843209_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
KX264499_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
MG098580_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
X75658_SP_C-F        atgcccctatcctatccacacttccggaaactactgttgttagacgacga
AB365446_SP_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacgacga
                     ****** **** **** *  ***** **         * *****     *

JN792921_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ638663_SP_P-F      gtcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
AY090456_SP_P-F      ggcaggtctcctcgaagaagaactccctcgcctcgcagacgaaggtctca
FJ589065_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KX757665_SP_P-F      ggcaggtcccctmgaagaagaactccctcgcctcgcmgacgaaggtctca
KP718104_SP_P-F      ggcaggtctcctcgaagaagaactccctcgcctcgcagacgaaggtctca
KP718113_SP_P-F      ggcaggtctcctcgaagaagaactccctcgcctcgcagacgaaggtctca
AY090458_SP_C-F      ggcaggtctcctcgaagaagaactccctcgcctcgcagacgaaggtctca
AY090459_SP_P-F      ggcaggtctcctcgaagaagaactccctcgcctcgcagacgaaggtctca
AY090461_SP_P-F      ggcaggtctcctcgaagaagaactccctcgcctcgcagacgaaggtctca
AB116654_SP_P-F      cgcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ638664_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KY476324_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
FJ657525_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
AB086397_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctaa
KY476330_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KY476329_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KY382415_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KY382416_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KY382417_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KP718107_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ638657_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ638656_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KF199901_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
JX079936_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KC494400_SP_P-F      ggcaggtctcctcgaagaagaactccctcgcctcgcagacgaagttctca
EU670261_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
JN792914_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
JN792917_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KP718110_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
MK058437_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY476328_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KY476327_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KY476325_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843204_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843203_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843169_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843167_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KC494404_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
JN792916_SP_P-F      ggcaggtcccctcgaagaagaactcccacgcctcgcagacgaaggtctca
JN688699_SP_P-F      ggcaggtcccctngaagaagaactccctcgcctcgcagacgaaggtctca
HM627320_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
JN792922_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM622135_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585200_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
FJ709465_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ709457_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
FJ709462_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KP995116_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
DQ823092_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
DQ823093_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
EU366133_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585197_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843164_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843180_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843181_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843194_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
DQ823091_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB064316_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
AB116552_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
AF223963_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
AF223964_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
AY179735_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
DQ823094_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
DQ823095_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
EU366118_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
EU670260_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
EU670262_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
FJ657529_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
FJ709458_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
FJ709459_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
FJ709460_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
FJ709463_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
FJ709464_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
FJ709494_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HE981182_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HE981183_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585186_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585187_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585188_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585189_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585190_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585191_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585192_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585193_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585194_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585195_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585196_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585198_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM585199_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM590471_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM590472_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM590473_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HM590474_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
HQ378247_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
JN688691_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
JN688703_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
JN792918_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
JN792919_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
JN792920_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ586805_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ586806_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ586807_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ586808_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843163_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843168_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843171_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843174_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843176_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843177_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843178_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843179_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843190_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843193_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843195_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843196_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843197_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843198_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843199_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843200_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843201_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843202_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843205_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843206_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KM233681_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KM998715_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KP995098_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KX264496_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KY458061_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KY458062_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KY476322_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KY476323_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KY476332_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KJ843170_SP_P-F      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
MG098584_SP_P-F      ggcaggtcccctaaaacaagaactccctcgcctcgcaracgaaggtctca
MG098575_SP_P-F      ggcaggtccactagaagaagaactccctcgcctcgcaaacgaaggtctca
KP995097_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KT896494_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ899147_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ899144_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ899145_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ899146_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KP995110_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KJ843191_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcaracgaagatctca
AY090455_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KC494396_SP_P-F      ggcaggacccctagaagaagaactccctcgcctcgcagacgaagatctca
KC494399_SP_P-F      ggcaggacccctagaagaagaactccctcgcctcgcagacgaagatctca
KP995115_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KP995107_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KC494401_SP_P-F      ggcaggtcccctagaaaaagaactccctcgcctcgcagacgaagatctca
KP995113_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KP995104_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ899142_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ899143_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KP995114_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
X69798_SP_P-F        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KP995120_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KC494402_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KC494397_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KC494395_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY311369_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KX264497_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KC494394_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KC494403_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KC494405_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MG098577_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgaaaacgaaggtctca
KP995118_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
JQ272888_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB365453_SP_P-F      ggcaggacccctagaagaagaactccctcgcctcgcagacgaagatctca
MG098583_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcaaacgaaggtctca
KP995101_SP_P-F      ggcagggcccctagaagaagaactccctcgcctcgccgacgaagatctca
KJ638660_SP_P-F      ggcaggtcccctagaagtagaactccctcgcctcgcagacgaaggtctca
KJ638662_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG098564_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KJ676694_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG098574_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcaaacgaaggtctca
KP995111_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
MG098582_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcggaaacgaaggtctca
MG098573_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgaagacgaaggtctca
MG098570_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY476326_SP_P-F      ggcrggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ589066_SP_P-F      ggcaggacccctagaagaagaactccctcgcctcgccgacgaagatctca
EF576808_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KP995105_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB036905_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB036909_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB036911_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB036912_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB036913_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB036914_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB036915_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB036916_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB036917_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB036918_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB036920_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
KX264498_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB036919_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
KP718106_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB116549_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
KJ638659_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
AB116550_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
KP995106_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
KP718111_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
FJ589067_SP_P-F      ggcaggtcccctggaagaagaactccctcgcctcgccgacgaagatctca
DQ899150_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
KP995123_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
KP995125_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
KP995119_SP_P-F      ggcaggacccctagaagaagaactccctcgcctcgccgacgaaggtctca
KP995117_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
AY311370_SP_P-F      ggcaggtcccctagaagaagaactccctcgcgtcgccgacgaaggtctca
KP995124_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
KP995126_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
MH051987_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctggcggacgaaggtctca
DQ899148_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
KP718103_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
X75663_SP_P-F        ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
MH051986_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
AB036910_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
AB116551_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
JF439884_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
JF439885_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
KP718109_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
KP718112_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
KP995109_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
DQ899149_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
AB365450_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcmgacgaaggtctca
KJ843225_SP_P-F      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG098566_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcacacgaaggtctca
MG098579_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG098578_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG098565_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcaaacgaaggtctca
JX079937_SP_P-F      ggcaggtcccstagaagaagaactccctcgcctcgcagacgaaggtctca
AB166850_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG098569_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ843226_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ843223_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ843220_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ843185_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN811655_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN811656_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN688720_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN688709_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ657519_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ823089_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ823088_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU366132_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FJ657528_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN688701_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KJ843211_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KJ843212_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KJ843219_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KJ843221_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KJ843222_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KJ843224_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KY382411_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ823087_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ776247_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU366116_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ657522_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ843207_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ843208_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ843210_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ843213_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AF223962_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB365449_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB214516_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AF223965_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ823086_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ823090_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF576812_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HE981181_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC494398_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ843175_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ843189_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ843209_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX264499_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG098580_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
X75658_SP_C-F        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB365446_SP_P-F      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
                       * ** *   *  **  ********* *** * *   ****** *** *

JN792921_SP_P-F      atcgccgcgtcgcagaagatctcaatctccggcttcccgatgatccacga
KJ638663_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagattcccgatgatccacga
AY090456_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacca
FJ589065_SP_P-F      atcgccgcgtcgcaaaagatctcaatctccagcttcccaatgatccacga
KX757665_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP718104_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagctccccaatgatccacga
KP718113_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagctccccaatgatccacga
AY090458_SP_C-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
AY090459_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttccccatgatccacga
AY090461_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
AB116654_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatccacga
KJ638664_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KY476324_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatccacga
FJ657525_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatccacga
AB086397_SP_P-F      atcgccgcgtcgcagaagatctcaatctccatcttcccaatgatccacga
KY476330_SP_P-F      atcgccgcgtcgcagaagatctcaatctccaggttcccgatgatccacga
KY476329_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttccaaatgatccacga
KY382415_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KY382416_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KY382417_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP718107_SP_P-F      atcaccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ638657_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ638656_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KF199901_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgaaccacga
JX079936_SP_P-F      atcgccgcgtcgcagaagatctcaatctccaccttcccactgatccacga
KC494400_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
EU670261_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaataatccacga
JN792914_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
JN792917_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP718110_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
MK058437_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KY476328_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaacga
KY476327_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KY476325_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaacga
KJ843204_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843203_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843169_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843167_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccatga
KC494404_SP_P-F      atcgccgcgtcgcaaaagatctcaatctccagcttcccaatgatccacga
JN792916_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
JN688699_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM627320_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
JN792922_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM622135_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585200_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
FJ709465_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
FJ709457_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
FJ709462_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP995116_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
DQ823092_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
DQ823093_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
EU366133_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585197_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843164_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843180_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843181_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843194_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
DQ823091_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
AB064316_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
AB116552_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
AF223963_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
AF223964_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
AY179735_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
DQ823094_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
DQ823095_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
EU366118_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
EU670260_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
EU670262_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
FJ657529_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
FJ709458_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
FJ709459_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
FJ709460_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
FJ709463_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
FJ709464_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
FJ709494_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HE981182_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HE981183_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585186_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585187_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585188_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585189_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585190_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585191_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585192_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585193_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585194_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585195_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585196_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585198_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM585199_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM590471_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM590472_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM590473_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HM590474_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
HQ378247_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
JN688691_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
JN688703_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
JN792918_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
JN792919_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
JN792920_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ586805_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ586806_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ586807_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ586808_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843163_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843168_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843171_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843174_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843176_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843177_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843178_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843179_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843190_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843193_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843195_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843196_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843197_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843198_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843199_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843200_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843201_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843202_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843205_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843206_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KM233681_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KM998715_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP995098_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KX264496_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KY458061_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KY458062_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KY476322_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KY476323_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KY476332_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ843170_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
MG098584_SP_P-F      atcgccgcgccgcaaaagatctcaatctccagcttcccactgatccacga
MG098575_SP_P-F      atcgccgcgtctcaaaagatctcaatctccagcttcccaatgatctacga
KP995097_SP_P-F      atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KT896494_SP_P-F      atcgccgcgtcgccgaagatctaaatctccatcttcccaatgatccacga
DQ899147_SP_P-F      atcgccgcgtcgccgaagatctcaatctccagcttcccaatgatccacga
DQ899144_SP_P-F      atcgccgcgtcgccgaagatctcaatctccagcttcccaatgatccacga
DQ899145_SP_P-F      atcgccgcgtcgccgaagatctcaatctccagcttcccaatgatccacga
DQ899146_SP_P-F      atcgccgcgtcgccgaagatctcaatctccagcttcccaatgatccacga
KP995110_SP_P-F      atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KJ843191_SP_P-F      atcgccgcgtcgccgcaratctcaatctccagcttcccaatgatccacga
AY090455_SP_P-F      atcgccgcgtcgccgcagatctcaatctccaggttcccaatgatccacga
KC494396_SP_P-F      atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KC494399_SP_P-F      atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KP995115_SP_P-F      atcgccgcgtcgccgcagatctcaatctccatcttcccgatgatccacga
KP995107_SP_P-F      atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KC494401_SP_P-F      atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KP995113_SP_P-F      atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KP995104_SP_P-F      atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
DQ899142_SP_P-F      atcgccgcgtcgccgccgatctcaatctccagcttcccaatgatccacga
DQ899143_SP_P-F      atcgccgcgtcgccgccgatctcaatctccagcttcccaatgatccacga
KP995114_SP_P-F      atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
X69798_SP_P-F        atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KP995120_SP_P-F      atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KC494402_SP_P-F      atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KC494397_SP_P-F      atcaccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KC494395_SP_P-F      atcaccgcgtcgccgaagatctcaatctccagcttcccaatgatccacga
AY311369_SP_P-F      atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KX264497_SP_P-F      atcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KC494394_SP_P-F      atcaccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KC494403_SP_P-F      atcaccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
KC494405_SP_P-F      atcaccgcgtcgccgcagatctcaatctccagcttcccaatgatccacga
MG098577_SP_P-F      atcgccgcgtcgcaaaaaatctcaatctccagcttcccaatgatctacaa
KP995118_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
JQ272888_SP_P-F      atcgccgcgtcgcagaagatctcaatctccatcttcccgatgatccacca
AB365453_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
MG098583_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatctacga
KP995101_SP_P-F      atcgccgcgtggcagaagatctcaatctccgtcttcccgatgatccacga
KJ638660_SP_P-F      atcgccgcgtcgccgaagatctcaatctccagcttcccaatgatctacga
KJ638662_SP_P-F      atcgccgcgtcgccgaagatctcaatctccagcttcccaatgatctacga
MG098564_SP_P-F      atcgccgcgtcgcaaaagatctcaatctccagcttcccaatgatctacga
KJ676694_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatccacga
MG098574_SP_P-F      atcgccgcgtcgcaaaagatctcaatctccagcttcccaatgatctacaa
KP995111_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatccatga
MG098582_SP_P-F      atcgccgcgtcgcaaaagatctcaatctccagcttcccaatgatctacga
MG098573_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
MG098570_SP_P-F      atcgccgcgtcgcaaaagatctcaatctccagcttcccactgatctacaa
KY476326_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
FJ589066_SP_P-F      atcgccgggtcgcagaagatctcaatctccatcttcccaatgatccacga
EF576808_SP_P-F      atcgccgcgtcgcagaagatctcaatctccggcttcccaatgatctacga
KP995105_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
AB036905_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
AB036909_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
AB036911_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
AB036912_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
AB036913_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
AB036914_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
AB036915_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
AB036916_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
AB036917_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
AB036918_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
AB036920_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
KX264498_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
AB036919_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaa
KP718106_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccratgatccacga
AB116549_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KJ638659_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
AB116550_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP995106_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP718111_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
FJ589067_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatccacga
DQ899150_SP_P-F      attgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP995123_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP995125_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP995119_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP995117_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
AY311370_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP995124_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP995126_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
MH051987_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
DQ899148_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP718103_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
X75663_SP_P-F        atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
MH051986_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
AB036910_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
AB116551_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
JF439884_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
JF439885_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP718109_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP718112_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
KP995109_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
DQ899149_SP_P-F      atggccgcgtcgcagaagatctcaatctccagcttcccaatgatccacga
AB365450_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843225_SP_P-F      atcgccgcgtcgcagaagatctcaatctccatcttcccaatgatctacga
MG098566_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcaacga
MG098579_SP_P-F      atcgccgcgtcgcaaaagatctcaatctccagcttcccactgatctacga
MG098578_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
MG098565_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
JX079937_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
AB166850_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
MG098569_SP_P-F      atcgccgcgtcgcagaagatctcaatctccatcttcccgatgatctacga
KJ843226_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843223_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843220_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843185_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcttcga
JN811655_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
JN811656_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
JN688720_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaa
JN688709_SP_P-F      atcgccgcgtcgcagaagatctcaatctccatcttcccaatgatctacga
FJ657519_SP_P-F      atcgccgcgtcgcaaaagatctcaatctccagcttcccaatgatctacga
DQ823089_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
DQ823088_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
EU366132_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
FJ657528_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
JN688701_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843211_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843212_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843219_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843221_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843222_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843224_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KY382411_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
DQ823087_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatctacga
DQ776247_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
EU366116_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
FJ657522_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843207_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843208_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843210_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843213_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
AF223962_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
AB365449_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
AB214516_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
AF223965_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
DQ823086_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
DQ823090_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
EF576812_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
HE981181_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KC494398_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843175_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843189_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KJ843209_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
KX264499_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
MG098580_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
X75658_SP_C-F        atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacga
AB365446_SP_P-F      atcgccgcgtcgcagaagatctcaatctccagcttcccactgatctacga
                     **  *** *   *     **** *******   * **   * * *    *

JN792921_SP_P-F      ccaccagcacgggaccmtgcaaaacctgcacaactcttgcwcaaggaacc
KJ638663_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AY090456_SP_P-F      ccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggaacc
FJ589065_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KX757665_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP718104_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP718113_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AY090458_SP_C-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AY090459_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AY090461_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB116654_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ638664_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY476324_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ657525_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaact
AB086397_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY476330_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY476329_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY382415_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY382416_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY382417_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP718107_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ638657_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactsttgctcaaggaacc
KJ638656_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KF199901_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JX079936_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KC494400_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
EU670261_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JN792914_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JN792917_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP718110_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
MK058437_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY476328_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY476327_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY476325_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843204_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacc
KJ843203_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctctaggaacc
KJ843169_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843167_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KC494404_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JN792916_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JN688699_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM627320_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JN792922_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM622135_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585200_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ709465_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ709457_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ709462_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP995116_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ823092_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ823093_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
EU366133_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585197_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843164_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843180_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843181_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843194_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ823091_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB064316_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB116552_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AF223963_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AF223964_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AY179735_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ823094_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ823095_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
EU366118_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
EU670260_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
EU670262_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ657529_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ709458_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ709459_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ709460_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ709463_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ709464_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ709494_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HE981182_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HE981183_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585186_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585187_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585188_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585189_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585190_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585191_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585192_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585193_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585194_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585195_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585196_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585198_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM585199_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM590471_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM590472_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM590473_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HM590474_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HQ378247_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JN688691_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JN688703_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JN792918_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JN792919_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JN792920_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ586805_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ586806_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ586807_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ586808_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843163_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843168_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843171_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843174_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843176_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843177_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843178_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843179_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843190_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843193_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843195_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843196_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843197_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843198_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843199_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843200_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843201_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843202_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843205_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843206_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KM233681_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KM998715_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP995098_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KX264496_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY458061_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY458062_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY476322_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY476323_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY476332_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843170_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
MG098584_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
MG098575_SP_P-F      ccaccaccacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP995097_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacgactcttgcacaaggaacc
KT896494_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
DQ899147_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaacgaacc
DQ899144_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
DQ899145_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
DQ899146_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KP995110_SP_P-F      ccaccagcacgggaccctgcaagacctgcacagctcttgcacaaggaacc
KJ843191_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
AY090455_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KC494396_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KC494399_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KP995115_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacgactcttgcacaaggaacc
KP995107_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KC494401_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KP995113_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KP995104_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacgactcttgcacaaggaacc
DQ899142_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
DQ899143_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KP995114_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
X69798_SP_P-F        ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KP995120_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KC494402_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KC494397_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KC494395_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
AY311369_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KX264497_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KC494394_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KC494403_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
KC494405_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacc
MG098577_SP_P-F      ccaccagcacgggacaatgcaaaacctgcacaactcttgctcaaggaacc
KP995118_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgctcaaggaacc
JQ272888_SP_P-F      ccaccagcacgggaccatgcaaracctgcacaactcttgctcaaggaacc
AB365453_SP_P-F      ccaccagcacgggacaatgcaaaacctgcacaactcttgctcaaggaacc
MG098583_SP_P-F      ccaccatcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP995101_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ638660_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ638662_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
MG098564_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ676694_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacc
MG098574_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP995111_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacc
MG098582_SP_P-F      ccaccagcacgggacmatgcaaaacctgcacaactcttgctcaaggaacc
MG098573_SP_P-F      ccaccagcacgggaccatgcaaaacctgaacaactcttgctcaaggaacc
MG098570_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY476326_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaagaaacc
FJ589066_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
EF576808_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP995105_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggcacc
AB036905_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB036909_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB036911_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB036912_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB036913_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB036914_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB036915_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB036916_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB036917_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB036918_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB036920_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KX264498_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB036919_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP718106_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB116549_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ638659_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB116550_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP995106_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP718111_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ589067_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ899150_SP_P-F      ccaccagcacaggaccatgcaagacctgcacaactcttgctcaaggaacc
KP995123_SP_P-F      ccaccagcacgggaccatgcaagacctgcacaactcttgctcaaggaacc
KP995125_SP_P-F      ccaccagcacgggaccatgcaagacctgcacaactcttgctcaaggaacc
KP995119_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP995117_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacacctcttgctcaaggaacc
AY311370_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggcacc
KP995124_SP_P-F      ccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggcacc
KP995126_SP_P-F      ccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggcacc
MH051987_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ899148_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP718103_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
X75663_SP_P-F        ccaccagcacgggaccatgcaaaacctgcacagctcttgctcaaggaacc
MH051986_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB036910_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB116551_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JF439884_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JF439885_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP718109_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP718112_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KP995109_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ899149_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB365450_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843225_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacc
MG098566_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
MG098579_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
MG098578_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
MG098565_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JX079937_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB166850_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
MG098569_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843226_SP_P-F      ccaccagcacgggaccatgcaaarcctgcacaactcttgctcaaggaacc
KJ843223_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacc
KJ843220_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843185_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JN811655_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgctcaaggaacc
JN811656_SP_P-F      ccaccagcacgggaccctgcaaaacctgcacaactcttgctcaaggaacc
JN688720_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JN688709_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ657519_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ823089_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ823088_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
EU366132_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ657528_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
JN688701_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843211_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843212_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843219_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843221_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843222_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843224_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KY382411_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ823087_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ776247_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
EU366116_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
FJ657522_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843207_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843208_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843210_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843213_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AF223962_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB365449_SP_P-F      ccaccagcacgggaccatgcaacacctgcacaactcttgctcaaggaacc
AB214516_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AF223965_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ823086_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
DQ823090_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
EF576812_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
HE981181_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KC494398_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843175_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843189_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KJ843209_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
KX264499_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
MG098580_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
X75658_SP_C-F        ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
AB365446_SP_P-F      ccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacc
                     ****** *** ****  ****   **** **  ** **** * *   ** 

JN792921_SP_P-F      tctatgtttccctcytgytgctgttccaaaccttcggacggaaactgcac
KJ638663_SP_P-F      tctatgttaccctcttgctgctgttccaaaccctcggacggaaactgcac
AY090456_SP_P-F      tctatgttaccctcctgctgctgtaccaaaccttcggacggaaactgcac
FJ589065_SP_P-F      tctatgtttccctcctgctgctgttccaaaccttcggacggaaactgcac
KX757665_SP_P-F      tctatgtttccctcctgctgctgttccaaaccttcggacggaaactgcac
KP718104_SP_P-F      tctatgtttccctcctgctgttgttccaaaccttcggacggaaactgcac
KP718113_SP_P-F      tctatgtttccctcctgctgttgttccaaaccttcggacggaaactgcac
AY090458_SP_C-F      tctatgtttccctcctgctgctgttccaaaccttcggacggaaactgcac
AY090459_SP_P-F      tctatgtttccctcctgctgctgttccaaaccttcggacggaaactgcac
AY090461_SP_P-F      tctatgtttccctcctgctgctgttcaaaaccttcggacggaaactgcac
AB116654_SP_P-F      tctatgtttccctcttgctgctgttcaaaaccctcggacggaaactgcac
KJ638664_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KY476324_SP_P-F      tctatgtttccctcttgctgytgttcaaaaccctcggacggaaactgcac
FJ657525_SP_P-F      tctatgtttccctcttgctgctgttccaaaccttcggacggaaactgcac
AB086397_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KY476330_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KY476329_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KY382415_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KY382416_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KY382417_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KP718107_SP_P-F      tctatgtttccctcttgctgctgttcaaaaccytcggacggaaactgcac
KJ638657_SP_P-F      tctatgtttccctcttgctgctgttcmaaaccctcggacggaaactgcac
KJ638656_SP_P-F      tctatgtttccctcttgctgctgttccagaccctcggacggaaactgcac
KF199901_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
JX079936_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KC494400_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
EU670261_SP_P-F      tctatgtttccctcttgctgctgttcaaaaccctcggacggaaactgcac
JN792914_SP_P-F      tctatgtttccctcttgctgctgttcaaaaccctcggacggaaactgcac
JN792917_SP_P-F      tctatgtttccctcttgctgctgttcaaaaccctcggacggaaactgcac
KP718110_SP_P-F      tctatgtttccctcttgctgctgttcaaaaccctcggacggaaactgcac
MK058437_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggaaggaaactgcac
KY476328_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KY476327_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KY476325_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843204_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843203_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843169_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843167_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KC494404_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
JN792916_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
JN688699_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM627320_SP_P-F      tctatgtttccctcttgctgctgttccaaaccytcggacggaaactgcac
JN792922_SP_P-F      tctatgtttccctcttgctgctgttccaaaccytcggacggaaactgcac
HM622135_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585200_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
FJ709465_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
FJ709457_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
FJ709462_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KP995116_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
DQ823092_SP_P-F      tctatgtttccctcttgctgctgttccaaaccttcggacggaaactgcac
DQ823093_SP_P-F      tctatgtttccctcttgctgctgttccaaaccttcggacggaaactgcac
EU366133_SP_P-F      tctatgtttccctcttgctgctgttccaaaccttcggacggaaactgcac
HM585197_SP_P-F      tctatgtttccctcttgctgctgttccaaaccttcggacggaaactgcac
KJ843164_SP_P-F      tctatgtttccctcttgctgctgttccaaaccttcggacggaaactgcac
KJ843180_SP_P-F      tctatgtttccctcttgctgctgttccaaaccttcggacggaaactgcac
KJ843181_SP_P-F      tctatgtttccctcttgctgctgttccaaaccttcggacggaaactgcac
KJ843194_SP_P-F      tctatgtttccctcttgctgctgttccaaaccttcggacggaaactgcac
DQ823091_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
AB064316_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
AB116552_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
AF223963_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
AF223964_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
AY179735_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
DQ823094_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
DQ823095_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
EU366118_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
EU670260_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
EU670262_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
FJ657529_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
FJ709458_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
FJ709459_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
FJ709460_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
FJ709463_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
FJ709464_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
FJ709494_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HE981182_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HE981183_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585186_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585187_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585188_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585189_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585190_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585191_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585192_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585193_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585194_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585195_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585196_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585198_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM585199_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM590471_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM590472_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM590473_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HM590474_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
HQ378247_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
JN688691_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
JN688703_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
JN792918_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
JN792919_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
JN792920_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ586805_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ586806_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ586807_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ586808_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843163_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843168_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843171_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843174_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843176_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843177_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843178_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843179_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843190_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843193_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843195_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843196_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843197_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843198_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843199_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843200_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843201_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843202_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843205_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843206_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KM233681_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KM998715_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KP995098_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KX264496_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KY458061_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KY458062_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KY476322_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KY476323_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KY476332_SP_P-F      tctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcac
KJ843170_SP_P-F      tctatgtttccctcttgctgttgttccaaaccctcggacggaaactgcac
MG098584_SP_P-F      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaactgcac
MG098575_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KP995097_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
KT896494_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
DQ899147_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
DQ899144_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
DQ899145_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
DQ899146_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
KP995110_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ843191_SP_P-F      tctatgtttccctcctgttgctgttccaaaccttcggacggaaactgcac
AY090455_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccttcggacggaaactgcac
KC494396_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccttcggacggaaactgcac
KC494399_SP_P-F      tctatgtttccctcctgttgctgttccaaaccttcggacggaaactgcac
KP995115_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
KP995107_SP_P-F      tctatgtttccctcctgttgctgttccaaaccttcggacggaaactgcac
KC494401_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KP995113_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccttcggacggaaactgcac
KP995104_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
DQ899142_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
DQ899143_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
KP995114_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
X69798_SP_P-F        tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KP995120_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KC494402_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KC494397_SP_P-F      tctatggttccctcctgttgctgttccaaaccctcggacggaaactgcac
KC494395_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AY311369_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KX264497_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KC494394_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KC494403_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KC494405_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
MG098577_SP_P-F      tctatgtttccctcctgttgctgttccaaaccttcggacggaaactgcac
KP995118_SP_P-F      tctatgtttccctcttgttgctgttcaaaaccttcggacggaaattgcac
JQ272888_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccttcggacggaaactgcac
AB365453_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
MG098583_SP_P-F      tctatgtttccctcctgttgctgttccaaaccttcggacggaaactgcac
KP995101_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
KJ638660_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccttcggacggaaactgcac
KJ638662_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccttcggacggaaactgcac
MG098564_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ676694_SP_P-F      tctatgtttccctcatgttgctgtaccaaaccctcggacggaaactgcac
MG098574_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KP995111_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
MG098582_SP_P-F      tctatgtttccctcctgttgctgttcmaaaccctcggacggaaactgcac
MG098573_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggaaggaaactgcac
MG098570_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctaggacggaaactgcac
KY476326_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
FJ589066_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
EF576808_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
KP995105_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB036905_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB036909_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB036911_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB036912_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB036913_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB036914_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB036915_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB036916_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB036917_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB036918_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB036920_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KX264498_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB036919_SP_P-F      tctatgtttccctcctgttgctgttcmaaaccctcggacggaaactgcac
KP718106_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
AB116549_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
KJ638659_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
AB116550_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
KP995106_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
KP718111_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccttcggacggaaactgcac
FJ589067_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
DQ899150_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KP995123_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KP995125_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KP995119_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
KP995117_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AY311370_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KP995124_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KP995126_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
MH051987_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
DQ899148_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
KP718103_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
X75663_SP_P-F        tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
MH051986_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB036910_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB116551_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
JF439884_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
JF439885_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KP718109_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KP718112_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KP995109_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
DQ899149_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB365450_SP_P-F      tmtatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
KJ843225_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
MG098566_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
MG098579_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
MG098578_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
MG098565_SP_P-F      tctatgtttccctcttgttgctgttccaaaccctcggacggaaactgcac
JX079937_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccctcggacggaaactgcac
AB166850_SP_P-F      tctatgtttccctcctgttgctgttcaaaaccttcggacggaaactgcac
MG098569_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ843226_SP_P-F      tctatgtttccctcctgttgctgttccaaaccttcggacggaaactgcac
KJ843223_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ843220_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ843185_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
JN811655_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
JN811656_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
JN688720_SP_P-F      tctatgtttccctcctgttgctgttccaaaccttcggacggaaactgcac
JN688709_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
FJ657519_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
DQ823089_SP_P-F      tctatgtttccctcctgttgctgttccaaaccttcggacggaaactgcac
DQ823088_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
EU366132_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
FJ657528_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
JN688701_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ843211_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ843212_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ843219_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ843221_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ843222_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ843224_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KY382411_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
DQ823087_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
DQ776247_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
EU366116_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
FJ657522_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
KJ843207_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
KJ843208_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
KJ843210_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
KJ843213_SP_P-F      tctatgtttccctcctgttgctgtaccaaaccctcggacggaaactgcac
AF223962_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB365449_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB214516_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AF223965_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
DQ823086_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
DQ823090_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
EF576812_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
HE981181_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KC494398_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ843175_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ843189_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KJ843209_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
KX264499_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
MG098580_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
X75658_SP_C-F        tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
AB365446_SP_P-F      tctatgtttccctcctgttgctgttccaaaccctcggacggaaactgcac
                     * **** * ***** ** ** *** * * *** * *** ***** *****

JN792921_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ638663_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
AY090456_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
FJ589065_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KX757665_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KP718104_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KP718113_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
AY090458_SP_C-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
AY090459_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
AY090461_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
AB116654_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ638664_SP_P-F      ttgtattcccattccatcatcctgggctttaggaaaatacctatgggagt
KY476324_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
FJ657525_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
AB086397_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KY476330_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KY476329_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KY382415_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KY382416_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KY382417_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KP718107_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ638657_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ638656_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KF199901_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
JX079936_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KC494400_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
EU670261_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
JN792914_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
JN792917_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KP718110_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
MK058437_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KY476328_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KY476327_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KY476325_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843204_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843203_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843169_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843167_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KC494404_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
JN792916_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
JN688699_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM627320_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
JN792922_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM622135_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585200_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggatt
FJ709465_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
FJ709457_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
FJ709462_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KP995116_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
DQ823092_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
DQ823093_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
EU366133_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585197_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843164_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843180_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843181_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843194_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
DQ823091_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
AB064316_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
AB116552_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
AF223963_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
AF223964_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
AY179735_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
DQ823094_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
DQ823095_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
EU366118_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
EU670260_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
EU670262_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
FJ657529_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
FJ709458_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
FJ709459_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
FJ709460_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
FJ709463_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
FJ709464_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
FJ709494_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HE981182_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HE981183_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585186_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585187_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585188_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585189_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585190_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585191_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585192_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585193_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585194_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585195_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585196_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585198_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM585199_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM590471_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM590472_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM590473_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HM590474_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
HQ378247_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
JN688691_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
JN688703_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
JN792918_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
JN792919_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
JN792920_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ586805_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ586806_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ586807_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ586808_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843163_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843168_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843171_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843174_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843176_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843177_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843178_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843179_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843190_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843193_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843195_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843196_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843197_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843198_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843199_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843200_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843201_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843202_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843205_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843206_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KM233681_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KM998715_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KP995098_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KX264496_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KY458061_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KY458062_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KY476322_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KY476323_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KY476332_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KJ843170_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
MG098584_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MG098575_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995097_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KT896494_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
DQ899147_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
DQ899144_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
DQ899145_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
DQ899146_SP_P-F      ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KP995110_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843191_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AY090455_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KC494396_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KC494399_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995115_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995107_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KC494401_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995113_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995104_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
DQ899142_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
DQ899143_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995114_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
X69798_SP_P-F        ttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagt
KP995120_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KC494402_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaattcctatgggagt
KC494397_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KC494395_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AY311369_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KX264497_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KC494394_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KC494403_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KC494405_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MG098577_SP_P-F      ctgtattcccatcccatcatctttggctttaggaaaatacctatgggagt
KP995118_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaattcctatggggtt
JQ272888_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB365453_SP_P-F      ctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagt
MG098583_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaawtacctatgggagt
KP995101_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ638660_SP_P-F      atgtattcccatcccatcgtcttgggctttaggaaaatacctatgggagt
KJ638662_SP_P-F      atgtattcccatcccatcgtcttgggctttaggaaaatacctatgggagt
MG098564_SP_P-F      ctgtattcccatcccatcatctcgggctttaggaaaatacctatgggagt
KJ676694_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MG098574_SP_P-F      ctgtattcccatcccatcatcttgggntttaggaaaatacctatgggagt
KP995111_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MG098582_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MG098573_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MG098570_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KY476326_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
FJ589066_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
EF576808_SP_P-F      ctgtattcccatcccatcgtcttgggctttaggaaaatacctatgggagt
KP995105_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB036905_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB036909_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB036911_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB036912_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB036913_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB036914_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB036915_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB036916_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB036917_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB036918_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB036920_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KX264498_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB036919_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP718106_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB116549_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ638659_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB116550_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995106_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP718111_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
FJ589067_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
DQ899150_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995123_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995125_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995119_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995117_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AY311370_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995124_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995126_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MH051987_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
DQ899148_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP718103_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
X75663_SP_P-F        ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MH051986_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB036910_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB116551_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
JF439884_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
JF439885_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP718109_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP718112_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KP995109_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
DQ899149_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB365450_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843225_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MG098566_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MG098579_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MG098578_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MG098565_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
JX079937_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB166850_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MG098569_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843226_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843223_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843220_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843185_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
JN811655_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
JN811656_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
JN688720_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
JN688709_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
FJ657519_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
DQ823089_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
DQ823088_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
EU366132_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
FJ657528_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
JN688701_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843211_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843212_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843219_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843221_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843222_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843224_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KY382411_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
DQ823087_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
DQ776247_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
EU366116_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
FJ657522_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843207_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843208_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843210_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843213_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AF223962_SP_P-F      ttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB365449_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB214516_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AF223965_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
DQ823086_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
DQ823090_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
EF576812_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
HE981181_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KC494398_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843175_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843189_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KJ843209_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
KX264499_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
MG098580_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
X75658_SP_C-F        ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
AB365446_SP_P-F      ctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagt
                      *********** ***** **   ** *** ***** * ********  *

JN792921_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ638663_SP_P-F      gggcctcagcccgttcctcctggctcagtttactag
AY090456_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ589065_SP_P-F      gggcctcagcccgtttctcatggctcagtttactag
KX757665_SP_P-F      gggcctcagcccgtttctcatggctcagtttactag
KP718104_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP718113_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AY090458_SP_C-F      gggcctcagcccgtttctcctggctcagtttactag
AY090459_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AY090461_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB116654_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ638664_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY476324_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ657525_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB086397_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY476330_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY476329_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY382415_SP_P-F      gggcctcascccgtttctcctggctcaktttactag
KY382416_SP_P-F      gggcctcascccgtttctcctggctcaktttactag
KY382417_SP_P-F      gggcctcascccgtttctcctggctcaktttactag
KP718107_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ638657_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ638656_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KF199901_SP_P-F      gggcctcagtccgtttctcctggctcagtttactag
JX079936_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KC494400_SP_P-F      gggcctcagcccgtttctcatggctcagtttactag
EU670261_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN792914_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN792917_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP718110_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MK058437_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY476328_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY476327_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY476325_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843204_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843203_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843169_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843167_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KC494404_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN792916_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN688699_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM627320_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN792922_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM622135_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585200_SP_P-F      gggcctcagcccgtttctcatggctcagtttactag
FJ709465_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ709457_SP_P-F      gggcctcagcccgtttctcatggctcagtttactag
FJ709462_SP_P-F      gggcctcagcccgtttctcatggctcagtttactag
KP995116_SP_P-F      gggcctcagcccgtttctcatggctcagtttactag
DQ823092_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ823093_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
EU366133_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585197_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843164_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843180_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843181_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843194_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ823091_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB064316_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB116552_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AF223963_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AF223964_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AY179735_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ823094_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ823095_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
EU366118_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
EU670260_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
EU670262_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ657529_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ709458_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ709459_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ709460_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ709463_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ709464_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ709494_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HE981182_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HE981183_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585186_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585187_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585188_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585189_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585190_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585191_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585192_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585193_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585194_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585195_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585196_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585198_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM585199_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM590471_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM590472_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM590473_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HM590474_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HQ378247_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN688691_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN688703_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN792918_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN792919_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN792920_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ586805_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ586806_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ586807_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ586808_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843163_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843168_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843171_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843174_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843176_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843177_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843178_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843179_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843190_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843193_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843195_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843196_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843197_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843198_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843199_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843200_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843201_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843202_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843205_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843206_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KM233681_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KM998715_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995098_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KX264496_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY458061_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY458062_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY476322_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY476323_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY476332_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843170_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MG098584_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MG098575_SP_P-F      gggcctcancccgtttctcatggctcaatttactag
KP995097_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KT896494_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ899147_SP_P-F      gggcctcagcccgtttctcttggctcaatttactag
DQ899144_SP_P-F      gggcctcagcccgtttctcttggctcagtttactag
DQ899145_SP_P-F      gggcctcagcccgtttctcttggctcagtttactag
DQ899146_SP_P-F      gggcctcagcccgtttctcttggctcaatttactag
KP995110_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843191_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AY090455_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KC494396_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KC494399_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995115_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995107_SP_P-F      gggcctcagcccgtttctcttggctcagtttactag
KC494401_SP_P-F      gggcctcagcccgtttctcatggctcagtttactag
KP995113_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995104_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ899142_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ899143_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995114_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
X69798_SP_P-F        gggcctcagcccgtttctcctggctcagtttactag
KP995120_SP_P-F      gggcctcagcccgtttctcatggctcagtttactag
KC494402_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KC494397_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KC494395_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AY311369_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KX264497_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KC494394_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KC494403_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KC494405_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MG098577_SP_P-F      gggcctcagcccgtttctcctagctcattttactag
KP995118_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JQ272888_SP_P-F      gggcctcagcccgtttctcatggctcagtttactag
AB365453_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MG098583_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995101_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ638660_SP_P-F      gggcctcagcccgtttctcctggctcaatttactag
KJ638662_SP_P-F      gggcctcagcccgtttctcctggctcaatttactag
MG098564_SP_P-F      gtgcctcagcccgtttctcctggctcattttactag
KJ676694_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MG098574_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995111_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MG098582_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MG098573_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MG098570_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY476326_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ589066_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
EF576808_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995105_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB036905_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB036909_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB036911_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB036912_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB036913_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB036914_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB036915_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB036916_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB036917_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB036918_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB036920_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KX264498_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB036919_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP718106_SP_P-F      gggcctcagcccrtttctcctggctcagtttactag
AB116549_SP_P-F      gggcctcagcccgtttctcctggctcaatttactag
KJ638659_SP_P-F      gggcctcagcccgtttctcctggctcaatttactag
AB116550_SP_P-F      gggcctcagcccgtttctcctggctcaatttactag
KP995106_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP718111_SP_P-F      ggggctcagcccgtttctcctggctcagtttactag
FJ589067_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ899150_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995123_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995125_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995119_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995117_SP_P-F      gggcctcagcccgtttctcttggctcagtttactag
AY311370_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995124_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995126_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MH051987_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ899148_SP_P-F      gggcctcagcccgtttctcttggctcagtttactag
KP718103_SP_P-F      gggcctcagcccgtttctcttggctcagtttactag
X75663_SP_P-F        gggcctcagcccgtttctcctggctcagtttactag
MH051986_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB036910_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB116551_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JF439884_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JF439885_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP718109_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP718112_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KP995109_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ899149_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB365450_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843225_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MG098566_SP_P-F      gggcctcagcccgtttctcttggctcagtttactag
MG098579_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MG098578_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MG098565_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JX079937_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB166850_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MG098569_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843226_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843223_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843220_SP_P-F      gggcctcagcccgtttctcctggctcaatttactag
KJ843185_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN811655_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN811656_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN688720_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN688709_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ657519_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ823089_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ823088_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
EU366132_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ657528_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
JN688701_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843211_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843212_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843219_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843221_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843222_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843224_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KY382411_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ823087_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ776247_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
EU366116_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
FJ657522_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843207_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843208_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843210_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843213_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AF223962_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB365449_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AB214516_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
AF223965_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ823086_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
DQ823090_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
EF576812_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
HE981181_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KC494398_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843175_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843189_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KJ843209_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
KX264499_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
MG098580_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
X75658_SP_C-F        gggcctcagcccgtttctcctggctcagtttactag
AB365446_SP_P-F      gggcctcagcccgtttctcctggctcagtttactag
                     * * ****  ** ** *** * ***** ********

© 1998-2020Legal notice