Dataset for nucleotide sequence S of genotype F

[Download (right click)] [Edit] [Sequences] [Repertoires]

608 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

KJ638663_S_P-F      agggacaacaccacatccggacacctagaacccctgcccgtgttacagggggtgttttcc
AY311368_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtattacaggcggtgtgtttc
KU847540_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847600_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995114_S_P-F      atggacaacattacatcaggactcctaagacccctgctcgtgttacaggcggtgtctttc
KU847590_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggyggtgtgttyc
KU847686_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggtggygtttttc
AY264388_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KX264660_S_P-F      atggacaacattacatcaggactcctagnacccntgytcgtgttacnggcggtgtgtttn
KU847608_S_P-F      atggacaacactacatcaggactcctaggacccctgctcgtattacaggcggtgtgtttc
KU847616_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847569_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtktttc
KC494397_S_P-F      atggacaacacttactcaggactcctaagacccctgctcgtgtcacaggcggtgtgttcc
KY809941_S_P-F      atggacaacattacatcaggactcccaggacccctgctcgtgttacaggcggtgtttttc
KU847728_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
KU847586_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690510_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MN758704_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847613_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtstttc
KY809938_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847492_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995113_S_P-F      atggacaacattacatcaaaactcctaggacccctgctcgtgttacagggggtgtttttc
KY809940_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847507_S_P-F      atggacaacattacatcaggactcctaagacccctgctcgtgttacaggcggtgtgtttc
KU847498_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtktttc
KP995097_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690507_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF398037_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF398034_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgtcacaggcggtgtgtttc
DQ899147_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ899144_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ899145_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF398030_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF398031_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF398032_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF398038_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ899146_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF398041_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847524_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN983947_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847653_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847477_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KT630614_S_P-F      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995115_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC494396_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacatgcggtgtgtttc
EF690508_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847562_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY809943_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY809944_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847528_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC494399_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtatttc
HM101097_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KT630606_S_P-F      atgganaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KT630633_S_P-F      atgganaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91825_S_P-F        atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY809942_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847723_S_P-F      atggacaacattacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttc
KT630623_S_P-F      atgganaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995110_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM101096_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690509_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690506_S_P-F      atggagaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY090455_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC113368_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN983945_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtcttcc
JN983944_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN983943_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC494401_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995120_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995107_S_P-F      atggacaacaccacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91803_S_P-F        atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MN758708_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KX264661_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847576_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
KU847566_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847550_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847485_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
KT630622_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995104_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414672_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN983946_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM101125_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ131127_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY264387_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC113381_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847628_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847549_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY809946_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ131124_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ131128_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690470_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC113364_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843191_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KT630619_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KT630634_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690484_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
EF690505_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690502_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC494402_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690487_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690488_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690489_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690490_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690491_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ899142_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ899143_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM101130_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
X69798_S_P-F        atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847694_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414650_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414649_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JX849635_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN983942_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
GQ486570_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EU159674_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690504_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690503_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690486_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690485_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY311347_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847496_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
AY311369_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690492_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690493_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690494_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690495_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690496_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690497_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690498_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690499_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690500_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690501_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM101098_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC494394_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC494395_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC494403_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC494405_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414673_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KT896494_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847512_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847515_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847689_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KX264497_S_P-F      atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847606_S_P-F      ayggacaacatcacatcaggactcctaggacccctgckcgtgttacaggyggtstkttcc
KU847479_S_P-F      atggacaacatcacatcagaactcctaggacccccgctcgggttacaggcggtgtgttcc
KJ638656_S_P-F      atggacaacaccacatcaggacacctaggactcctgctcgtgttacaggcggtgtgtttc
JN792921_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB116654_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgttttcc
KU847536_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggtggtgtgtttc
KU847516_S_P-F      atggacaacatcacatcaagactcccaagacccctgctcgtgttacaggcggtgtgtttc
KU847525_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ638664_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtctttc
KJ586805_S_P-F      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttc
KJ586806_S_P-F      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttc
FJ709469_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709473_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgttcc
FJ709478_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgttcc
KF414656_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN604225_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN604201_S_P-F      atggacaacatcacatccggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EU670261_S_P-F      atggacaacatcacatcaggactcccaggacccctgctcgtgtcacaggcggtgtgttcc
AY090456_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC113383_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91823_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709466_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847612_S_P-F      atggacaacatcacatcaggactcctaggacccctgcccgtgttacaggcggtgtgttcc
JN604198_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ589065_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KX757665_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY264391_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN604233_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY264390_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC113389_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91822_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY090458_S_C-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC113386_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91808_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY090459_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC113395_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91806_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP718104_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP718113_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91807_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91813_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91814_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91811_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91812_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91815_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91817_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91818_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91826_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91828_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91831_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91821_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY090461_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC113393_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91829_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91830_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
U91805_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB086397_S_P-F      atggacaacatcacgtcaggactcctaggacccctgctcgtgttacaggcggcgtttttc
KF414659_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414671_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414655_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414658_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414661_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995087_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995116_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709485_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709457_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709462_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585200_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY476329_S_P-F      atggacaacatctcatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP718107_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ638657_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY476330_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY476324_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
KY476325_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP718110_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC494400_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN604271_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ657525_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EU670260_S_P-F      atggacaacatcacatcaggactcctaggacccctgcacgtgtcacaggcggtgtgttcc
KU847502_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM590474_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709488_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709482_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY382415_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY382416_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY382417_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
OK106257_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ586807_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN792917_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY476328_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847627_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843203_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414657_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttaccggcggtgtgtttc
KF199901_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM622135_S_P-F      atggacaacatcacatcaggacacctaggacccctgctcgtgttacaggcggtgtgttcc
FJ709480_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgttcc
AF043561_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847522_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AF223963_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843168_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843169_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843205_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847580_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MF150688_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843170_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN792916_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
KY476323_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AF288627_S_P-F      atggacaacatcacatcaggactcctaggacccctgcacgtgttacaggcggtgtgtttc
AF043578_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY179735_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709458_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MK058437_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MF150693_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MF150694_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY476327_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847480_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP997611_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KM998715_S_P-F      atggacaacatctcatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY458061_S_P-F      atggacaacatctcatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY458062_S_P-F      atggacaacatctcatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843204_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843202_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843167_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843163_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ586808_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN792920_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN792918_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM627320_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN792922_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG877700_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HE981182_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HE981183_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
GQ486468_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709476_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709487_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN792914_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709468_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709463_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EU670262_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF398033_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF398029_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF398035_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF398039_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414677_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ823092_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ823093_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EU366133_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585197_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843164_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843180_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843181_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843194_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ403173_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ403174_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ403175_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY264392_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB064316_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB116552_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AF223964_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ823091_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ823094_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ823095_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690513_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690514_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EU366118_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ657529_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709459_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709460_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709461_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709464_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709465_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709481_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709484_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709491_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709493_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709494_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709495_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ709496_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
GQ486537_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
GQ486582_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM467761_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585186_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585187_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585188_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585189_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585190_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585191_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585192_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585193_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585194_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585195_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585196_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585198_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM585199_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM590471_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM590472_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM590473_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HQ378247_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN688691_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN688699_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN688703_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN792919_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JX079936_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JX849637_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC113394_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC494404_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414666_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF779236_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843171_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843174_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843176_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843177_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843178_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843179_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843190_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843193_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843195_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843196_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843197_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843198_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843199_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843200_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843201_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843206_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KM233681_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995098_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP997612_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP997613_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KU847620_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KX264496_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY458063_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY476322_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MF150689_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MF150690_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY476332_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414662_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995118_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG877706_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtctttc
MG877707_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtctttc
MG877708_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtctttc
MG098584_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtattacaggcggtgtgtttc
JQ272888_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414664_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
AY311361_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY311362_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995111_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995117_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN604211_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
KF414670_S_P-F      atggagaacatcacatcaggactcctaggacccctactcgtgttacaggcggtgtgtttc
AY311358_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY264398_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414674_S_P-F      -------acatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
GQ486779_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF397984_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ589070_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF397987_S_P-F      atggagaacatcacatccggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ589066_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414669_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY739217_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY311355_S_P-F      acggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY264396_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM467784_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF398040_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY264395_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM467772_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414676_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995085_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995106_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB116550_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
X75663_S_P-F        atggagaacatcacatcaggactcctaggacccctgcgcgtgttacaggcggtgtgtttc
KP718106_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414675_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KF414654_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF397985_S_P-F      atggagaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF397981_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ899150_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ899148_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY264400_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036913_S_P-F      atggagaacatcacatcaggactccyaggacccctgctcgtgttacaggcggtgtgtttc
KP995086_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB116549_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM467785_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ638659_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM467762_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY311360_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
AY264401_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtatttc
KP995101_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036906_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036907_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036908_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY311370_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggggtttc
AY264399_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY264397_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC113399_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036919_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036905_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036909_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036911_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036912_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036915_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036916_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036917_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036918_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036920_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB037944_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB037946_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC113400_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KX264498_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036914_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB037945_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995123_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995125_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995119_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP718111_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP718103_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM467786_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM467771_S_P-F      atggagaacatcatatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM467760_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF397990_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF397986_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF397982_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY264394_S_P-F      atggagaacatcacatcaagactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY264393_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995124_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995126_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HM467783_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
MH051990_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MH051988_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP997649_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995090_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995089_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MH051989_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MH051992_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP718109_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JF439884_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JF439885_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
GQ486493_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ589067_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF397983_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995109_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ899149_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB036910_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB116551_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF397989_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN226078_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JX849588_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP718112_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG839213_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MH051986_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MH051987_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY264389_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ638660_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ638662_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG098579_S_P-F      acggacagcatcacatcagaacacctaccacccctgctcgtgtcatcggcggtgtcttcc
AB365437_S_P-F      atggacaacaccacatcaggactccgaggacccctgctcgtgttacgggcggtgtgtttc
MG098577_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MK183632_S_P-F      atggacaacatcacatcaggactcctaggacccctactcgtgttacaggcggtgtctttc
KJ676694_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtattacaggcggtgtctttc
MK183637_S_P-F      atggacagcaccacatcaggactcctaggacccctgcccgtgttacgggcggtgtgttcc
MG877717_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
MG877715_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgygttacaggcggtgtttttc
MG877716_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
KY809945_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB365444_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG098566_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG098578_S_P-F      atggacaacatcacatcaggactcctaggaccgctgctcgtgttacaggcggtgtgtatc
MG098575_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
GQ486140_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtktttc
MG098583_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY476326_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacrggcggtgtgtttc
AB365449_S_P-F      atggacaacatcacatcaggactccyaggacccctgctcgtgttacaggcggtgtgtttc
GQ486830_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690511_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtctttc
JN688720_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
MK183636_S_P-F      atagacaacatcacatcaggactcctaaaacccctactcatgttacaggcggtgtatttc
EU366132_S_P-F      atggacaacatcacatcaggactcctaagacccctgctcgtgttacaggcggtgtttttc
MG098565_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
MG877721_S_P-F      atggacaccatcacatcaggactcctcggacccctgctcgtgttacaggcggtgtgtttc
MG877722_S_P-F      atggacaccatcacatcaggactcctcggacccctgctcgtgttacaggcggtgtgtttc
MK183631_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843225_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtatttc
MG098574_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG098573_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB365443_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB365453_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG098569_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KP995105_S_P-F      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG098582_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG098570_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG098564_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG877712_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggcgtttttc
AB365450_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AF288624_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB166850_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN811655_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF576808_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AY739216_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG877714_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgtyacaggcggygtttttc
AF288625_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
GQ486515_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
GQ486626_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AF288623_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG877704_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG877705_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG877703_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843185_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JX079937_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN688701_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtktttc
JN688709_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacagggggtgtttttc
AB365446_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
KJ843223_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AF288628_S_P-F      atggacaacatcacatcaggactcctaggccccctgctcgtgttacaggcggtgtgtttc
AF043577_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AF288626_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843226_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AF043573_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ823089_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JN811656_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF690512_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AB214516_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843175_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843189_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
X75661_S_P-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
X75658_S_C-F        atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MK183645_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MK183644_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MK183640_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MK183638_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY809939_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KX264662_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843220_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843207_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ776247_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EU366116_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ657519_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ657522_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843208_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843210_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843213_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AF223965_S_P-F      atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
AF223962_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ823086_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ823087_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ823088_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
DQ823090_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
EF576812_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
FJ657528_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
HE981181_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KC494398_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843209_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843211_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843212_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843219_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843221_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843222_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KJ843224_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KX264499_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
KY382411_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MG098580_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MK183630_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MK183633_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MK183639_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MK183641_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MK183643_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
MK183647_S_P-F      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
                            **     **   *  **     *       *   * *   * **    *   

KJ638663_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY311368_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtgggggacttctctcaat
KU847540_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847600_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995114_S_P-F      ttgttgacaaaaatccgcacaataccacagagtctagactcgtggtggacttctctcaat
KU847590_S_P-F      ttgttgayaaaaatccycamaataccacagagtctagactcgtggtggacttctctcart
KU847686_S_P-F      tygttgacaaaaatcctcacaataccacagaggctagactcgtggtggacttctctcaat
AY264388_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KX264660_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtgganttctctcaat
KU847608_S_P-F      ttgttgacaaaaatccgcacaataccamagagtctagactcgtggtggacttctctcaat
KU847616_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcart
KU847569_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC494397_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY809941_S_P-F      tggttgataaaaatccccacaataccacagagtctagactcgtggtggacttctctcaat
KU847728_S_P-F      tcgttgataaaaatcctcacaataccacggagtctagactcgtggtggacttctctcaat
KU847586_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690510_S_P-F      ttgttgacaaaaatcctcacaacaccacagagtctagactcgtggtggacttctctcaat
MN758704_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagt
KU847613_S_P-F      ttgttgayaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY809938_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagacttgtggtggacttctctcaat
KU847492_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995113_S_P-F      tcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY809940_S_P-F      ttgttgataaaaatccgcaaaataccacagagtctagacttgtggtggacttctctcaat
KU847507_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtagacttctctcaat
KU847498_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995097_S_P-F      ttgttgacaaaaatcctcacaatgccacagagtctagacttgtggtggacttctctcagt
EF690507_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF398037_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF398034_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ899147_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ899144_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ899145_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF398030_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF398031_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF398032_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF398038_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ899146_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF398041_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847524_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctcacagt
JN983947_S_P-F      ttgtcgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847653_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847477_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KT630614_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995115_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC494396_S_P-F      ttgttgacaaaaatcctcacaatgccacagagtctagactcgtggtggacttctctcaat
EF690508_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctcgcaat
KU847562_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY809943_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY809944_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847528_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC494399_S_P-F      ttgttgataaaaatcctcataatgccacagagtctagactcgtggtggacttctctcaat
HM101097_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KT630606_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KT630633_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91825_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY809942_S_P-F      ttgttgacaaaaatccgcacaataccacagagtctagactcgtggtggacttctctcaat
KU847723_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KT630623_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995110_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM101096_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagacttgtggtggacttctctcaat
EF690509_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690506_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY090455_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC113368_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN983945_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN983944_S_P-F      ttgttgacaaaaatccgcaaaataccacagaatctagactcgtggtggacttctctcaat
JN983943_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC494401_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995120_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995107_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91803_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MN758708_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KX264661_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847576_S_P-F      tcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847566_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847550_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847485_S_P-F      ttgttgacaaaaatcckcacaayaccacagagtctagactcgtggtggacttctctcaat
KT630622_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995104_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414672_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN983946_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM101125_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ131127_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY264387_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC113381_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847628_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847549_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY809946_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ131124_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ131128_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690470_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC113364_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843191_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KT630619_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KT630634_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690484_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690505_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690502_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC494402_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690487_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690488_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690489_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690490_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690491_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ899142_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ899143_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM101130_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
X69798_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847694_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414650_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414649_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JX849635_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN983942_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486570_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EU159674_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690504_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690503_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690486_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690485_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY311347_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847496_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY311369_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690492_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690493_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690494_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690495_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690496_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690497_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690498_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690499_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690500_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690501_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM101098_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC494394_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC494395_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC494403_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC494405_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414673_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KT896494_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847512_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847515_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847689_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KX264497_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847606_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctcgactcgtggtggacttctctcaat
KU847479_S_P-F      tcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ638656_S_P-F      ttgttgacaaaaatcctcaaaataccacagaatctagactcgtggtggacttctctcaat
JN792921_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB116654_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847536_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847516_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847525_S_P-F      ttgttgayaaaaatcctcacaataccacrgagtctcgactcgtggtggacttctctcaat
KJ638664_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ586805_S_P-F      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ586806_S_P-F      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ709469_S_P-F      ttgttgacaaaaatcctcacaataccacagaatctagactcgtggtggacttctctcaat
FJ709473_S_P-F      ttgttgataaaaatcctcacaataccacagaatctagactcgtggtggacttctctcaat
FJ709478_S_P-F      ttgttgataaaaatcctcacaataccacagaatctagactcgtggtggacttctctcaat
KF414656_S_P-F      ttgttgacaaacatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN604225_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagt
JN604201_S_P-F      ttgttgataagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EU670261_S_P-F      tcgttgacaaaaatcctcacaataccaaagaggctagactcgtggtggacttctctcaat
AY090456_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC113383_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91823_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709466_S_P-F      ttgttgataaaaatcctcacaatgccacagagtctagactcgtggtggacttctctcaat
KU847612_S_P-F      ttgttgacaaaaatccgcacaataccmaagaatctagactcgtggtggacttctctcaat
JN604198_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ589065_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KX757665_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY264391_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN604233_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY264390_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC113389_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91822_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY090458_S_C-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC113386_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91808_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY090459_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC113395_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91806_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP718104_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP718113_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91807_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91813_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91814_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91811_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91812_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91815_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91817_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91818_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91826_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91828_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91831_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91821_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY090461_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC113393_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91829_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91830_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U91805_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB086397_S_P-F      ttgttgataaaaatcctcacaataccacggagtctagactcgtggtggacttctctcaat
KF414659_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414671_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagacttgtggtggacttctctcaat
KF414655_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414658_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414661_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995087_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995116_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709485_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709457_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709462_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585200_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY476329_S_P-F      ttgttaacaaaaatcctcacaataccacggagtctagactcgtggtggacttctctcaat
KP718107_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ638657_S_P-F      ttgttgacaaaaatcctcacaataccacrgagtctagactcgtggtggacttctctcaat
KY476330_S_P-F      tcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctcgcaat
KY476324_S_P-F      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
KY476325_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP718110_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC494400_S_P-F      ttgttgacaaaaatcctcacaataccacaaagtctagactcgtggtggacttctctcaat
JN604271_S_P-F      ttgttgataaaaatcctcacaataccacggagtctagactcgtggtggacttctctcaat
FJ657525_S_P-F      ttgttgacaaaaatcctcacaataccacggagtctagactcgtggtggacttctctcagt
EU670260_S_P-F      ttgttgacaaaaatcctcacaataccacagaggctagactcgtggtggacttctctcaat
KU847502_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM590474_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709488_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709482_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY382415_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY382416_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY382417_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
OK106257_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ586807_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctaaactcgtggtggacttctctcaat
JN792917_S_P-F      ttgttgacaagcttcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY476328_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847627_S_P-F      ttgttgacaaaaatcctcacaataccacggagtctagactcgtggtggacttctctcaat
KJ843203_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414657_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF199901_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM622135_S_P-F      ttgttgacaaaaatccgcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709480_S_P-F      ttgttgacaaaaatcctcacaataccacagagkctagactcgtggtggacttctctcaat
AF043561_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847522_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF223963_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843168_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843169_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843205_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847580_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MF150688_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843170_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN792916_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY476323_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF288627_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF043578_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY179735_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709458_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK058437_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MF150693_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MF150694_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY476327_S_P-F      ttgttgacaaaaatcctcacaataccacagaatctagactcgtggtggacttctctcaat
KU847480_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP997611_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KM998715_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY458061_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY458062_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843204_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843202_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843167_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843163_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ586808_S_P-F      ttgttgacaaaaatcctcacaataccacaaagtctagactcgtggtggacttctctcaat
JN792920_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN792918_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM627320_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN792922_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG877700_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HE981182_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HE981183_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486468_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709476_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709487_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN792914_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709468_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709463_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EU670262_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF398033_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF398029_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF398035_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF398039_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414677_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ823092_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ823093_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EU366133_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585197_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843164_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843180_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843181_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843194_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ403173_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ403174_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ403175_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY264392_S_P-F      ttgttgacaaaaatccgcacaataccacagagtctagactcgtggtggacttctctcaat
AB064316_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB116552_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF223964_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ823091_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ823094_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ823095_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690513_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690514_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EU366118_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ657529_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709459_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709460_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709461_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709464_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709465_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709481_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709484_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709491_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709493_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709494_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709495_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ709496_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486537_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486582_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM467761_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585186_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585187_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585188_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585189_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585190_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585191_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585192_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585193_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585194_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585195_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585196_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585198_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM585199_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM590471_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM590472_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM590473_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HQ378247_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN688691_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN688699_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN688703_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN792919_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JX079936_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JX849637_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC113394_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC494404_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414666_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF779236_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843171_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843174_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843176_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843177_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843178_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843179_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843190_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843193_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843195_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843196_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843197_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843198_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843199_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843200_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843201_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843206_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KM233681_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995098_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP997612_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP997613_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847620_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KX264496_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY458063_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY476322_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MF150689_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MF150690_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY476332_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414662_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995118_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG877706_S_P-F      tcgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG877707_S_P-F      tcgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG877708_S_P-F      tcgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG098584_S_P-F      ttgttgacaaaaatccgcacaataccacagagtctagactcgtggtggacttctctcagt
JQ272888_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414664_S_P-F      tcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY311361_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctcgactcgtggtggacttctctcaat
AY311362_S_P-F      ttgttgacaaaaatcctcacaataccacggagtctagactcgtggtggacttctctcaat
KP995111_S_P-F      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
KP995117_S_P-F      ttgttgacaaaaatcctcaaaataccacagagtctagactcgtggtggacttctctcaat
JN604211_S_P-F      ttgttgacaaaaatcctcacaataccamagartctagactcgtggtggacttctctcaat
KF414670_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY311358_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtgggggacttctctcaat
AY264398_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414674_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486779_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF397984_S_P-F      ttgttgataaaaatcctcacaataccgaagagtctagactcgtggtggacttctctcaat
FJ589070_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagt
EF397987_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ589066_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagt
KF414669_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY739217_S_P-F      ttgttgacaaaaatcctcaaaataccacagagtctagactcgtggtggacttctctcaat
AY311355_S_P-F      tggttgacaaaaatccgcaaaataccacagagtctagactcgtggtggacttctctcaat
AY264396_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM467784_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF398040_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY264395_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM467772_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414676_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995085_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995106_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB116550_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
X75663_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP718106_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414675_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF414654_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF397985_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF397981_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ899150_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ899148_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY264400_S_P-F      ttgttgacaaaaatcctaacaataccacagagtctagactcgtggtggacttctctcaat
AB036913_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995086_S_P-F      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB116549_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM467785_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ638659_S_P-F      ttgttgayaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM467762_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY311360_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY264401_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995101_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036906_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036907_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036908_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY311370_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY264399_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY264397_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC113399_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036919_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036905_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036909_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036911_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036912_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036915_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036916_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036917_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036918_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036920_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB037944_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB037946_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC113400_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KX264498_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036914_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB037945_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995123_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995125_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995119_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP718111_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP718103_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM467786_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM467771_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM467760_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctcgcaat
EF397990_S_P-F      ttgttgacaaaaatccgcacaataccacagagtctagactcgtggtggacttctctcaat
EF397986_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF397982_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY264394_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY264393_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995124_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995126_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM467783_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MH051990_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MH051988_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP997649_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995090_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995089_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MH051989_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MH051992_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP718109_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JF439884_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JF439885_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486493_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ589067_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF397983_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP995109_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ899149_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB036910_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB116551_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF397989_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN226078_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JX849588_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KP718112_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG839213_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MH051986_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MH051987_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY264389_S_P-F      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ638660_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ638662_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctcgcaat
MG098579_S_P-F      ttgttgacaagaatccgcacaataccacggagtctagactcgtggtggacttctctcaat
AB365437_S_P-F      ttgttgacaaaaatccgcacaatgccacagagtctagactcgtggtggacttctctcaat
MG098577_S_P-F      ttgttganaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK183632_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctcgcaat
KJ676694_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK183637_S_P-F      ttgttgacaaaaatccgcagaataccacagagtctagactcgtggtggatttctctcaat
MG877717_S_P-F      ttgttgacaaaaatcctcacaataccacagagkctagactcgtggtggacttctctcaat
MG877715_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG877716_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY809945_S_P-F      tggttgacaaaaatccgcacaataccacagaagctagactcgtggtggacttctctcagt
AB365444_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagt
MG098566_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactygtkgtggacttctctcart
MG098578_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG098575_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486140_S_P-F      ttgttgacaaaaatcctcacaatrccamagagtctagactcgtggtggacttctctcaat
MG098583_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY476326_S_P-F      tggttgacaaaaatccgcaaaataccacagagtctagactcgtggtggacttctctcaat
AB365449_S_P-F      ttgtggacaaaaatcctcaaaacaccacagagtctagactcgtggtggacttctctcaat
GQ486830_S_P-F      ttgttgacaaaaatcctcacaataccamagagtctagactcgtggtggacttctctcaat
EF690511_S_P-F      ttgttgataaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN688720_S_P-F      tcgttgataaaaatccgcacaataccacagagtctagactcgtggtggacttctctcaat
MK183636_S_P-F      ttattaacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EU366132_S_P-F      tcgttgacaaaaatcctcacaattccacagagtctagactcgtggtggacttctctcaat
MG098565_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG877721_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG877722_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK183631_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843225_S_P-F      ttgttgataaaaatcctcacaataccacagaatctagactcgtggtggacttctctcaat
MG098574_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG098573_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB365443_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB365453_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG098569_S_P-F      ttgttgacaaaaatcctcacaatrccacagagtctagactcgtggtggacttctctcagt
KP995105_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG098582_S_P-F      ttgttgacaaaaatcctcacaataccacggagtctagactcgtggtggacttctctcaat
MG098570_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG098564_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG877712_S_P-F      ttgttgacaaaaatcctcacaatgccacagagtctagactcgtggtggacttctctcaat
AB365450_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF288624_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB166850_S_P-F      ttgttgacaaaaatccgcacaataccacagagtctagacttgtggtggacttctctcaat
JN811655_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF576808_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY739216_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG877714_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF288625_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486515_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486626_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF288623_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggccttctctcaat
MG877704_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG877705_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG877703_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843185_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JX079937_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN688701_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN688709_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB365446_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843223_S_P-F      ttgttgacaaaaatcckcacaataccacagagtctagactcgtggtggacttctctcaat
AF288628_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF043577_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF288626_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843226_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF043573_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ823089_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN811656_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF690512_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB214516_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843175_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843189_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
X75661_S_P-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
X75658_S_C-F        ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK183645_S_P-F      ttgttgacaaaaatcctcacaataccacggagtctagactcgtggtggacttctctcaat
MK183644_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK183640_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK183638_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY809939_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KX264662_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843220_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843207_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ776247_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EU366116_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ657519_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ657522_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843208_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843210_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843213_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF223965_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF223962_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ823086_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ823087_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ823088_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ823090_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EF576812_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ657528_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HE981181_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KC494398_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843209_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843211_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843212_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843219_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843221_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843222_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KJ843224_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KX264499_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY382411_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MG098580_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK183630_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK183633_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK183639_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK183641_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK183643_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MK183647_S_P-F      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
                    *  *  * **   ***  * **  **    *  **  *** ** *  *  ***** ** *

KJ638663_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY311368_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847540_S_P-F      tttctaggggsactacccgggtgtcctggccaaaattcgcagtccccaayctccaatcac
KU847600_S_P-F      tttctaggggractacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995114_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847590_S_P-F      tttctaggggractaccmgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847686_S_P-F      tttctagagggaatacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264388_S_P-F      tttctagggggactaaccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KX264660_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcan
KU847608_S_P-F      tttctaggggaaatacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847616_S_P-F      tttctagggggactrcccgrgtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847569_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC494397_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY809941_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847728_S_P-F      tttctagggggtctacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847586_S_P-F      tttctaggggcactacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
EF690510_S_P-F      tttctaggggaactacccgcgtgtcctggccaaaattcgcagtccccaacctccaatcac
MN758704_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847613_S_P-F      tttctaggggsactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY809938_S_P-F      tttctagagggaccacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847492_S_P-F      tttctaggggsactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995113_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY809940_S_P-F      tttctaggggcactacccgagtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847507_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847498_S_P-F      tttctagggggactacccgrgtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995097_S_P-F      tttctagagggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690507_S_P-F      tttctaggggcactacccgagtgtcctggccaaaattcgcagtccccaacctccaatcac
EF398037_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF398034_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ899147_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ899144_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ899145_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF398030_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF398031_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF398032_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF398038_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ899146_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF398041_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847524_S_P-F      tttctaggggaactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN983947_S_P-F      tttctagggggactaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847653_S_P-F      tttctaggggsactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847477_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KT630614_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995115_S_P-F      tttctagggggactacccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
KC494396_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690508_S_P-F      tttctaggggaactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847562_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY809943_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY809944_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847528_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC494399_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM101097_S_P-F      tttctagggggactaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
KT630606_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KT630633_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91825_S_P-F        tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY809942_S_P-F      tttctaggggcactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847723_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KT630623_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995110_S_P-F      tttctagggggactacccgggtgtcttggccaaaattcgcagtccccaacctccaatcac
HM101096_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690509_S_P-F      tttctagggggtctacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690506_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY090455_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC113368_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN983945_S_P-F      tctctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN983944_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN983943_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC494401_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995120_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995107_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91803_S_P-F        tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MN758708_S_P-F      tttctaggggcactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KX264661_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847576_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847566_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847550_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847485_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KT630622_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995104_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414672_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN983946_S_P-F      tctctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM101125_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ131127_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264387_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC113381_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847628_S_P-F      tttctagagggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847549_S_P-F      tttctagagggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY809946_S_P-F      tttctagagggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ131124_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ131128_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690470_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC113364_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843191_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KT630619_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KT630634_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690484_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690505_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690502_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC494402_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690487_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690488_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690489_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690490_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690491_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ899142_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ899143_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM101130_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
X69798_S_P-F        tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847694_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414650_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414649_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JX849635_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN983942_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ486570_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EU159674_S_P-F      tttctagggggactacccgggtgttctggccaaaattcgcagtccccaacctccaatcac
EF690504_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690503_S_P-F      tttctagggggactaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690486_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690485_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY311347_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847496_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY311369_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690492_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690493_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690494_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690495_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690496_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690497_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690498_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690499_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690500_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690501_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM101098_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC494394_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC494395_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC494403_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC494405_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414673_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KT896494_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847512_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847515_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847689_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KX264497_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847606_S_P-F      tttctaggggraacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847479_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ638656_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN792921_S_P-F      tttctagggggamyacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB116654_S_P-F      tttctagggggaacaaccgggtgtcctggccaaaattcgctgtccccaacctccaatcac
KU847536_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847516_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847525_S_P-F      tttctagggggaacaccmgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ638664_S_P-F      tttctagggggaccacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ586805_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ586806_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709469_S_P-F      tttctagggggaacasccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709473_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709478_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414656_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN604225_S_P-F      tttctaggggaaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN604201_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EU670261_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY090456_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC113383_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91823_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709466_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847612_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN604198_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgctgtccccaacctccaatcac
FJ589065_S_P-F      tttctagggggaacaccmgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KX757665_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264391_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN604233_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264390_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC113389_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91822_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY090458_S_C-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC113386_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91808_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY090459_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC113395_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91806_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP718104_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP718113_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91807_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91813_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91814_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91811_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91812_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91815_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91817_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91818_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91826_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91828_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91831_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91821_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY090461_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC113393_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91829_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91830_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
U91805_S_P-F        tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB086397_S_P-F      tttctaggggaaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414659_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414671_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414655_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414658_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414661_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995087_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995116_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709485_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709457_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709462_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585200_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY476329_S_P-F      tttctagggggcacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP718107_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ638657_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY476330_S_P-F      tttctaggggaaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY476324_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY476325_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP718110_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC494400_S_P-F      tttctagggcgaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN604271_S_P-F      tttctaggggaaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ657525_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EU670260_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847502_S_P-F      tttctaggggaaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM590474_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709488_S_P-F      tttctaggggaaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709482_S_P-F      tttctaggggaaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY382415_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY382416_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY382417_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
OK106257_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ586807_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN792917_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY476328_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847627_S_P-F      tttctagggggaacacccgggtgtyctggccaaaattcgcagtccccaacctccaatcac
KJ843203_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414657_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF199901_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM622135_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709480_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF043561_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847522_S_P-F      tttctaggggaaaaacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF223963_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843168_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843169_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843205_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847580_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MF150688_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843170_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN792916_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY476323_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF288627_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF043578_S_P-F      tttctagagggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY179735_S_P-F      tttctagagggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709458_S_P-F      tttctagagggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK058437_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MF150693_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MF150694_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY476327_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847480_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP997611_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KM998715_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY458061_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY458062_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843204_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843202_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843167_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843163_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ586808_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN792920_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN792918_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM627320_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN792922_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG877700_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HE981182_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HE981183_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ486468_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709476_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709487_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN792914_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709468_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709463_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EU670262_S_P-F      tttctagggggaacaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF398033_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF398029_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF398035_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF398039_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414677_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ823092_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ823093_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EU366133_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585197_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843164_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843180_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843181_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843194_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ403173_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ403174_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ403175_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264392_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB064316_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB116552_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF223964_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ823091_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ823094_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ823095_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690513_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690514_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EU366118_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ657529_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709459_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709460_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709461_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709464_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709465_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709481_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709484_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709491_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709493_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709494_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709495_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ709496_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ486537_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ486582_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM467761_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585186_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585187_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585188_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585189_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585190_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585191_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585192_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585193_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585194_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585195_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585196_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585198_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM585199_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM590471_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM590472_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM590473_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HQ378247_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN688691_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN688699_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN688703_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN792919_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JX079936_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JX849637_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC113394_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC494404_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414666_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF779236_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843171_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843174_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843176_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843177_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843178_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843179_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843190_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843193_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843195_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843196_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843197_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843198_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843199_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843200_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843201_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843206_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KM233681_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995098_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP997612_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP997613_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KU847620_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KX264496_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY458063_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY476322_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MF150689_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MF150690_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY476332_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414662_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995118_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG877706_S_P-F      tttctaggggaactaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG877707_S_P-F      tttctaggggaactaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG877708_S_P-F      tttctaggggaactaccagggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG098584_S_P-F      tttctagggggactacccgagtgtcctggccaaaattcgcagtccccaacctccaatcac
JQ272888_S_P-F      tttctaggggaactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414664_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY311361_S_P-F      tttctagagggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY311362_S_P-F      tttctagggggactacccgagtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995111_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995117_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN604211_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414670_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY311358_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264398_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414674_S_P-F      tttctaggggaactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ486779_S_P-F      tttctagggggcctaccagagtgtcctggccaaaattcgcagtccccaacctccaatcac
EF397984_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ589070_S_P-F      tttctagagggactacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
EF397987_S_P-F      tttctaggggcactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ589066_S_P-F      tttctagagggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414669_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY739217_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY311355_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264396_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM467784_S_P-F      tttctagagggaccacacgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF398040_S_P-F      tttctagggggaacacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264395_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM467772_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414676_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995085_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995106_S_P-F      tttctagggggactacccgggtgtcttggccaaaattcgcagtccccaacctccaatcac
AB116550_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
X75663_S_P-F        tttctagggggactacccaggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP718106_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414675_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KF414654_S_P-F      tttctagggggaatacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF397985_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF397981_S_P-F      tttctaggggcactacccgggtgtcctggccaaaattcgcagtccccaatctccaatcac
DQ899150_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ899148_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264400_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036913_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995086_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB116549_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM467785_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ638659_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM467762_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY311360_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacatccaatcac
AY264401_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995101_S_P-F      tttctaggggaactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036906_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036907_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036908_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY311370_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264399_S_P-F      tttctagggggatcacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264397_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC113399_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036919_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036905_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036909_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036911_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036912_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036915_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036916_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036917_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036918_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036920_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB037944_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB037946_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC113400_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KX264498_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036914_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB037945_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995123_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995125_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995119_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP718111_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP718103_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM467786_S_P-F      tttctagggggactacccgagtgtcctggccaaaattcgcagtccccaacctccaatcac
HM467771_S_P-F      tttctaggggggctacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM467760_S_P-F      tttctaggggacctacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF397990_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF397986_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF397982_S_P-F      tttctagggggtctacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264394_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264393_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995124_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995126_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HM467783_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MH051990_S_P-F      tttctagggggactacccgggtgtcccggccaaaattcgcagtccccaacctccaatcac
MH051988_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP997649_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995090_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995089_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MH051989_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MH051992_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP718109_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JF439884_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JF439885_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ486493_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ589067_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF397983_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995109_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ899149_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB036910_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB116551_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF397989_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN226078_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JX849588_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP718112_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG839213_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MH051986_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MH051987_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY264389_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ638660_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ638662_S_P-F      tttctaggggaaatacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG098579_S_P-F      tttctagggggagtacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB365437_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG098577_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183632_S_P-F      tttctaggggaactacccrggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ676694_S_P-F      tttctcggggaactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183637_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG877717_S_P-F      tttctaggggraccacccgrgtgtcctggccaaaattcgcagtccccaacctccaatcac
MG877715_S_P-F      tttctagggggaccacccgrgtgtcctggccaaaattcgcagtccccaacctccaatcac
MG877716_S_P-F      tttctaggggraccacccgrgtgtcctggccaaaattcgcagtccccaacctccaatcac
KY809945_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB365444_S_P-F      tttctagggggactacccgggtgtcttggccaaaattcgcagtccccaacctccaatcac
MG098566_S_P-F      tttctaggggaactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG098578_S_P-F      tttctagggggtctacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG098575_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ486140_S_P-F      tttctaggggractacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG098583_S_P-F      tttctaggggcactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY476326_S_P-F      tttctagggggaccacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB365449_S_P-F      tttctaggggcactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ486830_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690511_S_P-F      tctctaggggcactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN688720_S_P-F      tttctaggggaactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183636_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EU366132_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG098565_S_P-F      tttctagggggactacccgggtgtcctgsccaaaattcgcagtccccaacctccaatcac
MG877721_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG877722_S_P-F      tttctaggggcactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183631_S_P-F      tttctagagggactacccgggtgtcctggccaaaaywcgcagtccccaacctccaatcac
KJ843225_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG098574_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcscagtccccaacctccaatcac
MG098573_S_P-F      tttctagggggactacccgggtgtcctgsccaaaattcgcagtccccaacctccaatcac
AB365443_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB365453_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG098569_S_P-F      tttctagagggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KP995105_S_P-F      tttctaggggcactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG098582_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG098570_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG098564_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG877712_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB365450_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF288624_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB166850_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN811655_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF576808_S_P-F      tttctagagggactacccaggtgtcctggccaaaattcgcagtccccaacctccaatcac
AY739216_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG877714_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF288625_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ486515_S_P-F      tttctagggggwctacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ486626_S_P-F      tttctagggggwctacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF288623_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG877704_S_P-F      tttctaggggractacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG877705_S_P-F      tttctaggggractacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG877703_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843185_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JX079937_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN688701_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN688709_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB365446_S_P-F      tttctaggggcactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843223_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF288628_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF043577_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF288626_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843226_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF043573_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ823089_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
JN811656_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF690512_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AB214516_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843175_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843189_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
X75661_S_P-F        tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
X75658_S_C-F        tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183645_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183644_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183640_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183638_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY809939_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KX264662_S_P-F      tttctagagggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843220_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843207_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ776247_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EU366116_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ657519_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ657522_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843208_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843210_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843213_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF223965_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
AF223962_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ823086_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ823087_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ823088_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ823090_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
EF576812_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ657528_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
HE981181_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KC494398_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843209_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843211_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843212_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843219_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843221_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843222_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KJ843224_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KX264499_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
KY382411_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MG098580_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183630_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183633_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183639_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183641_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183643_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
MK183647_S_P-F      tttctagggggactacccgggtgtcctggccaaaattcgcagtccccaacctccaatcac
                    * *** * *           ****   * ******  * * ********  ******** 

KJ638663_S_P-F      ttaccaacctcctgtcctccgacttgtcctggctatcgttggatgtgtctgcggcgtttt
AY311368_S_P-F      ttaccaacctcctgtcctcaaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847540_S_P-F      tyaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847600_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KP995114_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggacgtgtctgcggcgtttt
KU847590_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847686_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AY264388_S_P-F      ttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
KX264660_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847608_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847616_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847569_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KC494397_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtcggcggcgtttt
KY809941_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847728_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847586_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690510_S_P-F      ttaccaacctcctgtcctccaacttgtcctggatatcgttggatgtgtctgcggcgtttt
MN758704_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847613_S_P-F      ttaccaacctcytgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KY809938_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847492_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KP995113_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KY809940_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847507_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847498_S_P-F      ttaccaacctcytgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KP995097_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690507_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF398037_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF398034_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ899147_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ899144_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ899145_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF398030_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF398031_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF398032_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF398038_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ899146_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgccgcgtttt
EF398041_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847524_S_P-F      tcaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
JN983947_S_P-F      ttaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847653_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847477_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KT630614_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KP995115_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KC494396_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690508_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847562_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KY809943_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KY809944_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847528_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KC494399_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
HM101097_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KT630606_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KT630633_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
U91825_S_P-F        ttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
KY809942_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847723_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KT630623_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KP995110_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
HM101096_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690509_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690506_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AY090455_S_P-F      ttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
KC113368_S_P-F      ttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
JN983945_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
JN983944_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
JN983943_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KC494401_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KP995120_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KP995107_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
U91803_S_P-F        ttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
MN758708_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KX264661_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847576_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847566_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847550_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847485_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KT630622_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KP995104_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KF414672_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
JN983946_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
HM101125_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ131127_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AY264387_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KC113381_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847628_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847549_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KY809946_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ131124_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ131128_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690470_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KC113364_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KJ843191_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KT630619_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KT630634_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690484_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690505_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690502_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KC494402_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690487_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690488_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690489_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690490_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690491_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ899142_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
DQ899143_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
HM101130_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
X69798_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847694_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KF414650_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtttgcggcgtttt
KF414649_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
JX849635_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
JN983942_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
GQ486570_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EU159674_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690504_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690503_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690486_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690485_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AY311347_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847496_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
AY311369_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690492_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690493_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690494_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690495_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690496_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690497_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690498_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690499_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690500_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
EF690501_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
HM101098_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KC494394_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KC494395_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KC494403_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KC494405_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KF414673_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KT896494_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847512_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847515_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847689_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KX264497_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KU847606_S_P-F      ttaccaacctcctgtcctccaacwtgtcctggctatcgctggatgtgtctgcggcrtttt
KU847479_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KJ638656_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
JN792921_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgytggatgtgtctgcggcgtttt
AB116654_S_P-F      ttaccaacctcttgtcctccaacttgtcctggctatcgctcgatgtgtctgcggcgtttt
KU847536_S_P-F      ttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KU847516_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KU847525_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ638664_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KJ586805_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ586806_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709469_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709473_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709478_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF414656_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN604225_S_P-F      ttaccaacctcctgtcctccgacttgtcctggctatcgctggatgtctctgcggcgtttt
JN604201_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EU670261_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AY090456_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KC113383_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91823_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709466_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KU847612_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN604198_S_P-F      ttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
FJ589065_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KX757665_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AY264391_S_P-F      ttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
JN604233_S_P-F      ttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
AY264390_S_P-F      ttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
KC113389_S_P-F      ttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
U91822_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AY090458_S_C-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KC113386_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91808_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AY090459_S_P-F      ttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
KC113395_S_P-F      ttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
U91806_S_P-F        ttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
KP718104_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KP718113_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91807_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91813_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91814_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91811_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91812_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91815_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91817_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91818_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91826_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91828_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91831_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91821_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AY090461_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KC113393_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91829_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91830_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
U91805_S_P-F        ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB086397_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF414659_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF414671_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF414655_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF414658_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF414661_S_P-F      ttaccaacctcctgtcctccaacttgacctggctatcgctggatgtgtctgcggcgtttt
KP995087_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KP995116_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709485_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709457_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709462_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585200_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KY476329_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KP718107_S_P-F      ttacyaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
KJ638657_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KY476330_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KY476324_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KY476325_S_P-F      ttaccaaccttctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KP718110_S_P-F      ttactaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
KC494400_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN604271_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ657525_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EU670260_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KU847502_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM590474_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709488_S_P-F      ttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709482_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KY382415_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KY382416_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KY382417_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
OK106257_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgytggatgtgtctgcggcgtttt
KJ586807_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN792917_S_P-F      ttaccaaccttctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KY476328_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KU847627_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843203_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF414657_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF199901_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM622135_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709480_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AF043561_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KU847522_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AF223963_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843168_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843169_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843205_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KU847580_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
MF150688_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843170_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN792916_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KY476323_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AF288627_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AF043578_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AY179735_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709458_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
MK058437_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
MF150693_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
MF150694_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KY476327_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KU847480_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KP997611_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KM998715_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KY458061_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KY458062_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843204_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843202_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843167_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843163_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ586808_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN792920_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN792918_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM627320_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN792922_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
MG877700_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HE981182_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HE981183_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
GQ486468_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709476_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709487_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN792914_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709468_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709463_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EU670262_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EF398033_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EF398029_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EF398035_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EF398039_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF414677_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
DQ823092_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
DQ823093_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EU366133_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585197_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843164_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843180_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843181_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843194_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
DQ403173_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
DQ403174_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
DQ403175_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AY264392_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB064316_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB116552_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AF223964_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
DQ823091_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
DQ823094_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
DQ823095_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EF690513_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EF690514_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EU366118_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ657529_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709459_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709460_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709461_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709464_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709465_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709481_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709484_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709491_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709493_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709494_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709495_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ709496_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
GQ486537_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
GQ486582_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM467761_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585186_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585187_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585188_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585189_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585190_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585191_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585192_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585193_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585194_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585195_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585196_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585198_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM585199_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM590471_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM590472_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM590473_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HQ378247_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN688691_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN688699_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN688703_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN792919_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JX079936_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JX849637_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KC113394_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KC494404_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF414666_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF779236_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843171_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843174_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843176_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843177_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843178_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843179_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843190_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843193_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843195_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843196_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843197_S_P-F      ttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ843198_S_P-F      ttaccaacctcctgtcctccaac