HBVdb

Dataset for nucleotide sequence PreS2 of genotype F

[Download (right click)] [Edit] [Sequences] [Repertoires]

284 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


KJ638663_PreS2_P-F      atacagagcaactccactctgttccaccaggctctgttagatccgagggt
MG098579_PreS2_P-F      atgcaatggaactcaacccagttccaccatgccctgttggatccgagggt
JQ272888_PreS2_P-F      gtaaagtggaactcagccaagttccaccaggccttgttggatccgagggt
MG098584_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttagacccaagggt
KJ676694_PreS2_P-F      rtgcagaacaactcaacccagtttcaccaggccctgttagacccaagggt
MG098578_PreS2_P-F      atgcagtggaactcatccgagttccaccaggccctgttggatccgagggt
MG098577_PreS2_P-F      atgcwgtggaactcaatccagttccaccgggccttgttggatccgagggt
KJ638660_PreS2_P-F      atgcagtggaacaccacccagttccaccaggctcttcaagatcccagagt
KJ638662_PreS2_P-F      atgcagtggaacacaacccagttccaccaggctctgttggatccaarggt
EF576808_PreS2_P-F      atgcaatggaactccacccagttccaccaggccttgttggatccgagggt
KJ843225_PreS2_P-F      atgcaatggaactcaatccagttccaccaggccctgttggatcagagggt
KY476326_PreS2_P-F      atgcaatggaactcatcccagttccaccaggccctgttggatccgagggt
JN688709_PreS2_P-F      atgcaatggaactcaacccagttccactcaacccagttggatccgagggt
MG098570_PreS2_P-F      atgcaatggaactcaacccagttccaccaggccctgttgcatccgggggt
AB365453_PreS2_P-F      atgcaatggaactcatcccagttccatcaggccttgttggatccgagggt
MG098583_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccttgttggatccgagggt
MG098566_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
JN688720_PreS2_P-F      atgcaatggaactcaacccagttccaccaggccctgttggatccgagggt
EU366132_PreS2_P-F      atgcagtggacctcaacccagttccaccaggccctgttggatccgagggt
MG098575_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccttgttggatccgagggt
MG098582_PreS2_P-F      atgcagtggaactcatccgagttccaccaggccctgttggatccgagggt
AB365449_PreS2_P-F      atgcagtggaactcaacccagttccatcaggccttgttggatccgagggt
MG098569_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccttgttggatccgagggt
AB166850_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
X75658_PreS2_C-F        atgcagtggaactcaactcacttccaccaggctctgttggatccgagggt
MG098573_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccttgttggatccgagggt
MG098565_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccttgttggatccgagggt
MG098574_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
AB365450_PreS2_P-F      atgcagtggaactcaacccagttccatcaggccttgttggatccgagggt
AB365446_PreS2_P-F      atgcaatggaactcaacccagttccatcaggccttgttggatccgagggt
DQ823089_PreS2_P-F      atgcagtggaactcaacccagttccaccaggtcctgttggatccgagggt
KJ843226_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagagt
MG098564_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ843185_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccttgttggatccgagggt
KJ843223_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
JN811655_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatccgagggt
AB214516_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
AF223965_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccttgttggatccgagggt
DQ823086_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccttgttggatccgagggt
EF576812_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccttgttggatccgagggt
KJ843209_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccttgttggatccgagggt
MG098580_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
JX079937_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
JN811656_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
JN688701_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
DQ823087_PreS2_P-F      atgcagtggaactcagccaagttccaccaggccctgttggatccgagggt
KJ843220_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ843207_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ843175_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ843189_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
FJ657528_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
FJ657519_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
DQ776247_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
EU366116_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
FJ657522_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ843208_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ843210_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ843213_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
AF223962_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
DQ823088_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
DQ823090_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
HE981181_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KC494398_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ843211_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ843212_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ843219_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ843221_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ843222_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ843224_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KX264499_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KY382411_PreS2_P-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
JN792921_PreS2_P-F      atgcagtggaactcmactcagttccaccarrctctgttaratccsagggt
KJ586807_PreS2_P-F      atggcgtggaactcccctcaattccaccagggtctgttaattcccagggt
KJ638664_PreS2_P-F      ataaagtggaagtggaacactttccaccaggctctgttagatccgaaggt
KJ638656_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
AB116654_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
JN604225_PreS2_P-F      atgcagtggaactcaactcagttccaccaggctctgttagatccgagggt
AY090461_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AY090458_PreS2_C-F      atgcagtggaactcaactcagttccaccaggctctgttagatccgagggt
KP718104_PreS2_P-F      atgcagtggaactcaactcagttccaccaggctctgttagatccgagggt
KP718113_PreS2_P-F      atgcagtggaactcaactcagttccaccaggctctgttagatccgagggt
AY090459_PreS2_P-F      atgcagtggaactcaactcagttccaccaggctctgttagatccgagggt
JN604233_PreS2_P-F      atgcagtggaactcaactcagttccaccaggctctgttagatccgagggt
JN604201_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttacatccgacggt
KP718110_PreS2_P-F      atgcagtggaactccaatcagttccaccaggctctgttagatccgagggt
JN604271_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KY476329_PreS2_P-F      acacagtggaacacccctcagttccaccaggctctgttagatccgagggt
KJ586805_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ586806_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KY476324_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ638657_PreS2_P-F      atgcagaggaactccactcagttccaccaggctctgttagatccgagggt
KP718107_PreS2_P-F      atgcagtggaactccactcagttccatcaggctctgttagatccgagggt
AB086397_PreS2_P-F      atgcagtggaactccactcagttccaccaggmtctgttagatccgagggt
JN792917_PreS2_P-F      atgcagtggaactccactcagttccaccagactctgttagatccgagggt
KY476325_PreS2_P-F      atgcaatggaactccactcagtttcaccaggctctgttagatccgagggt
KY382415_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KY382416_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KY382417_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KY476330_PreS2_P-F      atgcagtggaattccactcagttccaccaggctctgttagatccgagggt
KY476327_PreS2_P-F      gtgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HM627320_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgtyagatccgagggt
HM585200_PreS2_P-F      atgcagtggaactccactctgttccaccaggctctgttagatccgagggt
FJ657525_PreS2_P-F      atgcagtggaactcaactcagttccaccaggctctgttagatccgagggt
KY476328_PreS2_P-F      atgcagtggaactccactcagtttcaccaggctctgttagatccaagggt
EU670262_PreS2_P-F      atgcagtggaactccactcagttccatcaggctctgttagatccgagggt
KF199901_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KY476323_PreS2_P-F      atgcagtggaactccactcagtttcaccaggctctgttagctccgagggt
KC494400_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HM622135_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KP995116_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HM590474_PreS2_P-F      atgcagtggaattccactcagtttcaccaggctctgttagatccgagggt
AF223964_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
JN792916_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KF779236_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
FJ709457_PreS2_P-F      atgcagtggaactccactcagttccaccagactctgttagatccgagagt
FJ709462_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
KJ843203_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
KJ843202_PreS2_P-F      atgcagtggaactccactcagttccaccagactctgttagatccgagggt
KJ843174_PreS2_P-F      atgcagtggaactccactcagttccaccacgctctgttagatcccagggt
KJ586808_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
JN792918_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
AB064316_PreS2_P-F      atgcagtggaattccactcagttccaccagactctgttagatccgagggt
HM585186_PreS2_P-F      atgcagtggaattccactcagtttcaccaggctctgttagatccgagggt
HM590471_PreS2_P-F      atgcagtggaattccactcagtttcaccaggctctgttagatccgagggt
HM590472_PreS2_P-F      atgcagtggaattccactcagtttcaccaggctctgttagatccgagggt
KM233681_PreS2_P-F      atgcagtggaattccactcagtttcaccaggctctgttagatccgagggt
JN792914_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KY476332_PreS2_P-F      atgcagtggaactccactcagttccatcaggctctgttagatccgagggt
KJ843204_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
KJ843179_PreS2_P-F      atgcagtggaattccactcagttccaccaggctctgttagatccgagagt
KJ843169_PreS2_P-F      atgcagtggaactccactcagttccaccagactctgttagatccgagagt
KJ843163_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
FJ709463_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
FJ709460_PreS2_P-F      atgcagtggaactccactcagttccaccagactctgttagatccgagagt
AY179735_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
DQ823094_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
DQ823095_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
EU366118_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
FJ657529_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
HM585192_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
HM585193_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
JX079936_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
KJ843176_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
KJ843177_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
KJ843178_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
KJ843193_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
KJ843198_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
KJ843201_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
KJ843206_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
HM585195_PreS2_P-F      atgcagtggaacgccactcagttccaccaggctctgttagatccgagggt
FJ709458_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
FJ709459_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HM585191_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HM585198_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
JN792922_PreS2_P-F      gtgcagtggaactccactcagttccaccagactctgttagatccgagggt
AF223963_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ843170_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ843205_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
MK058437_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KM998715_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KY458061_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KY458062_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ843194_PreS2_P-F      atgcagtggaactccactcagttccaccagactctgttagatccgagggt
KJ843167_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
JN792920_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
JN792919_PreS2_P-F      atgcaatggaactccactcagttccaccaggctctgttagatccgagggt
HM585197_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagagt
HM585194_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HE981182_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HE981183_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
FJ709465_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
EU366133_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
AB116552_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
DQ823091_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
FJ709464_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
FJ709494_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HM585187_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HM585188_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HM585189_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HM585190_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HM585196_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HM585199_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HM590473_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
HQ378247_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
JN688691_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
JN688699_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
JN688703_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KC494404_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ843171_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ843190_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ843195_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ843196_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ843197_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ843199_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ843200_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KP995098_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KX264496_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KY476322_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
DQ823092_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
DQ823093_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ843164_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ843180_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KJ843181_PreS2_P-F      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
KP995114_PreS2_P-F      atgcaatggaactcaagcaagttccaccagcatctgttggaacccggggt
DQ899147_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
DQ899146_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
DQ899144_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
DQ899145_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KC494396_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KP995097_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KP995113_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KC494397_PreS2_P-F      atgcagtggaactcaacccagttccaccaagctctgttggatcccagggt
KP995115_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KP995104_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KP995110_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KC494399_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
DQ899142_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccatggt
AY090455_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KT896494_PreS2_P-F      atgcagtggaactcaacccagttccaccaacttctgttggatcccagggt
DQ899143_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KC494401_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KP995120_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KP995107_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
X69798_PreS2_P-F        atgcagtggaactcaacccagttccaccaagctctgttggatcccagggt
KC494402_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KC494394_PreS2_P-F      atgcagtggaactcaacccagttccaccaagctctgttggatcccagggt
KC494395_PreS2_P-F      atgcagtggaactcaacccagttccaccaagctctgttggatcccagggt
KC494403_PreS2_P-F      atgcagtggaactcaacccagttccaccaagctctgttggatcccagggt
KC494405_PreS2_P-F      atgcagtggaactcaacccagttccaccaagctctgttggatcccagggt
EU159674_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
AY311369_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KX264497_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
DQ131124_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KJ843191_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatcccagggt
KP995118_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
KP995111_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgaaggt
X75663_PreS2_P-F        atgcagtggaactcaactcacttccaccaagctctgttggatcccagggt
KP995117_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttaaatccgagggt
JN604211_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB116550_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttggatccgaaggg
KP995101_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
KP995106_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgcgggt
KP995105_PreS2_P-F      atacagtggaactcaacccagttccaccaggctctgttagatccgagggt
FJ589066_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
DQ899148_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgtcagatccgagggt
AY311370_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
KP995124_PreS2_P-F      atgcagtggaactcaacccagttccatcaggctctgttagatccgagggt
KP995126_PreS2_P-F      atgcagtggaactcaacccagttccatcaggctctgttagatccgagggt
AB036913_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036906_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036907_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036908_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036919_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036905_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036909_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036911_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036912_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036915_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036916_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036917_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036918_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036920_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
KX264498_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB036914_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
DQ899150_PreS2_P-F      gtgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
KP995123_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
KP995125_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
KP718106_PreS2_P-F      rtgcagtggaactcaacccagttccaccaggctctgctagatccgagggt
KP718111_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
KP718103_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
KP995109_PreS2_P-F      atgcaatggaattcaactcagttccaccaggctctgttggatccgagggt
KP718109_PreS2_P-F      atgcagtggaactcaactcagttccaccaggctctgttggatccgagggt
JF439884_PreS2_P-F      atgcagtggaactcaactcagttccaccaggctctgttggatccgagggt
JF439885_PreS2_P-F      atgcagtggaactcaactcagttccaccaggctctgttggatccgagggt
DQ899149_PreS2_P-F      atgcagtggaactcaactcagttccaccaggctctgttggatccgagggt
FJ589067_PreS2_P-F      atgcagtggaactcaactcagttccaccaggctctgttggatccgagggt
AB116551_PreS2_P-F      atgcagtggaattcaactcagttccaccaggctctgttggatccgagggt
AB036910_PreS2_P-F      atgcagtggaactcaactcagttccaccaggctctgttggatccgagggt
KP718112_PreS2_P-F      atgcagtggaactcaactcagttccaccaggctctgttggatccgagggt
MH051986_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
MH051987_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
KP995119_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
AB116549_PreS2_P-F      atgcagtggaactcaacccagttccaccaggctctgttagatccgagggt
KJ638659_PreS2_P-F      atrcagtggaactcaacccagttccaccaggctctgttagatccgagggt
                                 *           ** **                *     * 

KJ638663_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
MG098579_PreS2_P-F      agcggctc---------ctgctggtgcatacagttcagagacaccaaacc
JQ272888_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcagagacgcagaacc
MG098584_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcagaacc
KJ676694_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcagaacc
MG098578_PreS2_P-F      aagggctctgtatcttcctgctggtggctccacttcaaagacacagaacc
MG098577_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcagaacc
KJ638660_PreS2_P-F      cagggccctgttgagtcctgctggtggctccagttcagagacacagaacc
KJ638662_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
EF576808_PreS2_P-F      aaggggtctgtatcttcctgctggtggctccagttcagagacgcagaacc
KJ843225_PreS2_P-F      aaggactctgtgtcttcctgctggtggctccagttcagagacacagaacc
KY476326_PreS2_P-F      aagggctctgtatyttcctgctggtggctccagttcagagacacagaacc
JN688709_PreS2_P-F      aagggctctgtatyttcctgctggtggctccagttcagagacacagaacc
MG098570_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcagagacgcaaaacc
AB365453_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcagagacgcagaacc
MG098583_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcaaagcc
MG098566_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN688720_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagacacacagaacc
EU366132_PreS2_P-F      aagggctctgtatcttyctgctggtggctccagttcagagacacagaacc
MG098575_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcagaacc
MG098582_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcagaacc
AB365449_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcagagacgcagaacc
MG098569_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcagaacc
AB166850_PreS2_P-F      aagggctctgtctcctcctgctggtggctccagttcagagacacagaacc
X75658_PreS2_C-F        aagggcactgtattttcctgctggtggctccagttcaggcacgcagaacc
MG098573_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
MG098565_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcagaacc
MG098574_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
AB365450_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcagaacc
AB365446_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcagagacgcagaacc
DQ823089_PreS2_P-F      aaaggctctgtattatcctgctggtggctccagttcagagacacagaacc
KJ843226_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcagaacc
MG098564_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843185_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcagagacgcagaacc
KJ843223_PreS2_P-F      aaaggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN811655_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
AB214516_PreS2_P-F      aagggctctgtctcctcctgctggtggctccagttcagagacacagaacc
AF223965_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcagaacc
DQ823086_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcagaacc
EF576812_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcagaacc
KJ843209_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacgcagaacc
MG098580_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JX079937_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN811656_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN688701_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
DQ823087_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843220_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843207_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843175_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843189_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
FJ657528_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
FJ657519_PreS2_P-F      awgggctctgtattttcctgctggtggctccagttcagagacacagaacc
DQ776247_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
EU366116_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
FJ657522_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843208_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843210_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843213_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
AF223962_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
DQ823088_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
DQ823090_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HE981181_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KC494398_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843211_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843212_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843219_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843221_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843222_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843224_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KX264499_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KY382411_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN792921_PreS2_P-F      aagggctctgtayttycctgctggtggctccagttcagrgacacagaacc
KJ586807_PreS2_P-F      aaagggtctcctgctggttgctggtgggtccagttccaagacacagaacc
KJ638664_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ638656_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
AB116654_PreS2_P-F      aagggctctgtattttcctgctgggggctccagttcagagacacagaacc
JN604225_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
AY090461_PreS2_P-F      aagggctctgtactttcctgctggtggctccagttcagagacacagaacc
AY090458_PreS2_C-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KP718104_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KP718113_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
AY090459_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN604233_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN604201_PreS2_P-F      aagggctcagt------ctgctggtggctccagttcagagacacagaacc
KP718110_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcagagacacagaacc
JN604271_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KY476329_PreS2_P-F      aagggctctgtgttttcctgctggtggctccagttcagagacacagaacc
KJ586805_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ586806_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KY476324_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ638657_PreS2_P-F      aagggctctgtgtgttcctgctggtggctccagttcagagacacagaacc
KP718107_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
AB086397_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN792917_PreS2_P-F      aagggatctgtatcttcctgctggtggctccagttcagagacacagaacc
KY476325_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KY382415_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KY382416_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KY382417_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KY476330_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KY476327_PreS2_P-F      aagagctctgtattttcctgctggtggctccagttcagagacacagcacc
HM627320_PreS2_P-F      aagggmyctgtatttkcctgctggtggctccagttcagagacacagaacc
HM585200_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
FJ657525_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KY476328_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
EU670262_PreS2_P-F      aagggctctgtattttcctgctagtggctccagttcagagacacagaacc
KF199901_PreS2_P-F      aagggctctgtattttcctgctgggtgctccagttcagagacacagaacc
KY476323_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KC494400_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM622135_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KP995116_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM590474_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
AF223964_PreS2_P-F      aagggctctgtattttcatgctggtggctccagttcaggcacgcagaacc
JN792916_PreS2_P-F      aagggctc---------ctgctggtggctccagttcagagacacagaacc
KF779236_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ709457_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
FJ709462_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843203_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843202_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843174_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ586808_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN792918_PreS2_P-F      aagggatctgtattttcctgctggtggctccagttcagagacacagaacc
AB064316_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585186_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM590471_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM590472_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KM233681_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN792914_PreS2_P-F      aagggctctgt------ctgctggtggctccagttcagagacacagaacc
KY476332_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843204_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843179_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843169_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843163_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
FJ709463_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
FJ709460_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
AY179735_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
DQ823094_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
DQ823095_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
EU366118_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
FJ657529_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585192_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585193_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JX079936_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843176_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843177_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843178_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843193_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843198_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843201_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843206_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585195_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
FJ709458_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
FJ709459_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585191_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585198_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN792922_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
AF223963_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843170_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843205_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
MK058437_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KM998715_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KY458061_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KY458062_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843194_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843167_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN792920_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN792919_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585197_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585194_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HE981182_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HE981183_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
FJ709465_PreS2_P-F      aaggactctgtattttcctgctggtggctccagttcagagacacagaacc
EU366133_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
AB116552_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
DQ823091_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
FJ709464_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
FJ709494_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585187_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585188_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585189_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585190_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585196_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM585199_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HM590473_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
HQ378247_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN688691_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN688699_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
JN688703_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KC494404_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843171_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843190_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843195_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843196_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843197_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843199_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843200_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KP995098_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KX264496_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KY476322_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
DQ823092_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
DQ823093_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843164_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843180_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KJ843181_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagagacacagaacc
KP995114_PreS2_P-F      aagggctctgtgtctccctgctggtggctccagttcagggacacagaacc
DQ899147_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcaaggacacaaaacc
DQ899146_PreS2_P-F      aaaggctctgtattttcctgctggtggctccagttcaggaacacaaaacc
DQ899144_PreS2_P-F      aaaggctctgtattttcctgctggtggctccagttcaggaacacaaaacc
DQ899145_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcaggaacacaaaacc
KC494396_PreS2_P-F      atgggctctgtactttcctgctggtggctccagttcagggacacagaacc
KP995097_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KP995113_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KC494397_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KP995115_PreS2_P-F      aagggctctgtatttccctgctggtggctccagttcagggacacagaacc
KP995104_PreS2_P-F      aagggctctgtacctccctgctggtggctccagttcagggacacaaaacc
KP995110_PreS2_P-F      gagggctctgtacttccctgctggtggctccagttcagggacacaaaacc
KC494399_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcaggaacacagaacc
DQ899142_PreS2_P-F      aagggctctgtatttccctgctggtggctccagttcagggacacagaacc
AY090455_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KT896494_PreS2_P-F      aagggctctgtgcttccctgctggtggctccagttcagggacacagaacc
DQ899143_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagagacacagaacc
KC494401_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KP995120_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KP995107_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
X69798_PreS2_P-F        aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KC494402_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KC494394_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KC494395_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KC494403_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KC494405_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
EU159674_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
AY311369_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KX264497_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
DQ131124_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KJ843191_PreS2_P-F      aagggctctgtacttccctgctggtggctccagttcagggacacagaacc
KP995118_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
KP995111_PreS2_P-F      aacggctctgtattttcctgctggtggctccagttcagggacacagaacc
X75663_PreS2_P-F        aagggcactgtattttcctgctggtggctccagttcaggaacacagaacc
KP995117_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
JN604211_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB116550_PreS2_P-F      taaggctttgtattttcctgctggtggctccagttcagggacacagaacc
KP995101_PreS2_P-F      aagggctctgtattttcctgctggtggctccagtccaggaacacaaaacc
KP995106_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcagggacacagaacc
KP995105_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcagggacacagaacc
FJ589066_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
DQ899148_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcagggacacagaacc
AY311370_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcagggacacagaacc
KP995124_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcagggacacagaacc
KP995126_PreS2_P-F      aagggctctgtatcttcctgctggtggctccagttcagggacacagaacc
AB036913_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036906_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036907_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036908_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036919_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036905_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036909_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036911_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036912_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036915_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036916_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036917_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036918_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036920_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
KX264498_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036914_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
DQ899150_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
KP995123_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
KP995125_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
KP718106_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
KP718111_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
KP718103_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
KP995109_PreS2_P-F      aagggctctgtcttttcctgctggtggctccagttcagggacacagaacc
KP718109_PreS2_P-F      aagggctctgtattctcctgctggtggctccagttcagggacacagaacc
JF439884_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
JF439885_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
DQ899149_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
FJ589067_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB116551_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB036910_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
KP718112_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
MH051986_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacgcagaacc
MH051987_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacgcagaacc
KP995119_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
AB116549_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
KJ638659_PreS2_P-F      aagggctctgtattttcctgctggtggctccagttcagggacacagaacc
                                          **** *    * ** * *    **      **

KJ638663_PreS2_P-F      ctgctccgactattgcctctcgcacatcatcaatctccgtgaagactggg
MG098579_PreS2_P-F      ctgctccgactattgcgtctctcacatcatcaatctcctcgacgactggg
JQ272888_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgacgactggg
MG098584_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ676694_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MG098578_PreS2_P-F      ctgctccgactattgcctctcycacatcatcaatcttctcgaacactggt
MG098577_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaanactggg
KJ638660_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcwcgaagactggg
KJ638662_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
EF576808_PreS2_P-F      ctgctccgactattgcctctctcatatcatcaatatccttgacgactggg
KJ843225_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KY476326_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatctcctcgaagactggg
JN688709_PreS2_P-F      ttgctcagactattgcctctctcanatcatcaatcttctcgaagactggg
MG098570_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB365453_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgacgactggg
MG098583_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MG098566_PreS2_P-F      ctgctccgactattgcctcgctcacatcatcaatcttctcgaagactggg
JN688720_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
EU366132_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MG098575_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MG098582_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB365449_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MG098569_PreS2_P-F      ctgctccgactattgcctctctcayatcatcaatcttctsgaagactggg
AB166850_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaaaactggg
X75658_PreS2_C-F        ctgctccgactattgcctctctcacatcatcaatctcctcgaagactggg
MG098573_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MG098565_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MG098574_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB365450_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB365446_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
DQ823089_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843226_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MG098564_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843185_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843223_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
JN811655_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB214516_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AF223965_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
DQ823086_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
EF576812_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843209_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MG098580_PreS2_P-F      ctgctccgactattgtctctctcacatcatcaatcttctcgaagactggg
JX079937_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
JN811656_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
JN688701_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
DQ823087_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843220_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843207_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843175_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843189_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
FJ657528_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
FJ657519_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
DQ776247_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
EU366116_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
FJ657522_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843208_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843210_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843213_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AF223962_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
DQ823088_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
DQ823090_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
HE981181_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KC494398_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843211_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843212_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843219_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843221_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843222_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843224_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KX264499_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KY382411_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
JN792921_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ586807_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ638664_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ638656_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
AB116654_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JN604225_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
AY090461_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
AY090458_PreS2_C-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KP718104_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KP718113_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
AY090459_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JN604233_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JN604201_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KP718110_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaaccttcttgamgactggg
JN604271_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaagcttctcgacgactggg
KY476329_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ586805_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ586806_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KY476324_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgacgactggg
KJ638657_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KP718107_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
AB086397_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JN792917_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KY476325_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KY382415_PreS2_P-F      ctgctccgactattgccyctctcacatcatcaatcttctygaagactggg
KY382416_PreS2_P-F      ctgctccgactattgccyctctcacatcatcaatcttctygaagactggg
KY382417_PreS2_P-F      ctgctccgactattgccyctctcacatcatcaatcttctygaagactggg
KY476330_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KY476327_PreS2_P-F      ctgctccgattattgcctctctcacatcatcaatcttcttgaagactggg
HM627320_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585200_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
FJ657525_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KY476328_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
EU670262_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KF199901_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KY476323_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KC494400_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM622135_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KP995116_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM590474_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
AF223964_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JN792916_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KF779236_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
FJ709457_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
FJ709462_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843203_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843202_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843174_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ586808_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JN792918_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
AB064316_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585186_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM590471_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM590472_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KM233681_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JN792914_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KY476332_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843204_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843179_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843169_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843163_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
FJ709463_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
FJ709460_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
AY179735_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
DQ823094_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
DQ823095_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
EU366118_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
FJ657529_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585192_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585193_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JX079936_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843176_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843177_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843178_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843193_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843198_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843201_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843206_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585195_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
FJ709458_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
FJ709459_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585191_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585198_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JN792922_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
AF223963_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843170_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843205_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
MK058437_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KM998715_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KY458061_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KY458062_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843194_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843167_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JN792920_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JN792919_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585197_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585194_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HE981182_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HE981183_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
FJ709465_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
EU366133_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctggaagactggg
AB116552_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
DQ823091_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
FJ709464_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
FJ709494_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585187_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585188_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585189_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585190_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585196_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM585199_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HM590473_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
HQ378247_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JN688691_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JN688699_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
JN688703_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KC494404_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843171_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843190_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843195_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843196_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843197_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843199_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843200_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KP995098_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KX264496_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KY476322_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
DQ823092_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
DQ823093_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843164_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843180_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KJ843181_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KP995114_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
DQ899147_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatctactcgaagactggg
DQ899146_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatctactcgaagactggg
DQ899144_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatctactcgaagactggg
DQ899145_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatctactcgaagactggg
KC494396_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatctttccgaagactggg
KP995097_PreS2_P-F      ctgctccgactattgcctctcttacatcatcaatcttctcgaagactggg
KP995113_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KC494397_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP995115_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP995104_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP995110_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KC494399_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
DQ899142_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatctcctcgaagactggg
AY090455_PreS2_P-F      ctgctccgactattgcctctcttacatcatcaatcttctcgaagactggg
KT896494_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgacgactggg
DQ899143_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KC494401_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP995120_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP995107_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
X69798_PreS2_P-F        ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KC494402_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KC494394_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KC494395_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KC494403_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KC494405_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
EU159674_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AY311369_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KX264497_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
DQ131124_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ843191_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP995118_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP995111_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgacgactggg
X75663_PreS2_P-F        ctgctccgactattgcctctctcacatcatcaatctcctcgaagactggg
KP995117_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaaccttctcgaagactggg
JN604211_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB116550_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaaccttctcgaagactggg
KP995101_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP995106_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP995105_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
FJ589066_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
DQ899148_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AY311370_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP995124_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP995126_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036913_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036906_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036907_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036908_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036919_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036905_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036909_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036911_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036912_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036915_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036916_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036917_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036918_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036920_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
KX264498_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036914_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
DQ899150_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP995123_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP995125_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP718106_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP718111_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttcttgaagactggg
KP718103_PreS2_P-F      ctgctccgactattgcctctctcacatcgtcaatcttctcgaagactggg
KP995109_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KP718109_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
JF439884_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatctcctcgaagactggg
JF439885_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatctcctcgaagactggg
DQ899149_PreS2_P-F      ctgttccgactattgcctctctcacatcatcaatcttctcgaagactggg
FJ589067_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB116551_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB036910_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaaccttctcgaagactggg
KP718112_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MH051986_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
MH051987_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaggactggg
KP995119_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
AB116549_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ638659_PreS2_P-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
                         ** ** ** *****   * *  * *** ****  *    **  ***** 

KJ638663_PreS2_P-F      gaccctgctgtgaacagggacaacaccacatccggacacctagaacccct
MG098579_PreS2_P-F      gaccctgctatgaacacggacagcatcacatcagaacacctaccacccct
JQ272888_PreS2_P-F      gaccttgctatgaacatggacaacatcacatcaggactcctaggacccct
MG098584_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ676694_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
MG098578_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggaccgct
MG098577_PreS2_P-F      ggccctgctatgaacatggacagcatcacatcaggactcctaggacccct
KJ638660_PreS2_P-F      ggccctgttatgaacatggacaacatcacatcaggactcctaggacccct
KJ638662_PreS2_P-F      ggccctgttatgaacatggacaacatcacatcaggactcctaggacccct
EF576808_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843225_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KY476326_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
JN688709_PreS2_P-F      ggccntgctatgaacatggacaacatcacatcaggactcctaggacccct
MG098570_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
AB365453_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
MG098583_PreS2_P-F      ggccctgctatgaacatggacagcatcacatcaggactcctaggacccct
MG098566_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
JN688720_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
EU366132_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaagacccct
MG098575_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
MG098582_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
AB365449_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactccyaggacccct
MG098569_PreS2_P-F      ggccctgctatgaacatggacagcatcacatcaggactcctaggacccct
AB166850_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
X75658_PreS2_C-F        ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
MG098573_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
MG098565_PreS2_P-F      ggccctgctatgaacatggacagcatcacatcaggactcctaggacccct
MG098574_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
AB365450_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
AB365446_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
DQ823089_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843226_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
MG098564_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843185_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843223_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
JN811655_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
AB214516_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
AF223965_PreS2_P-F      ggccctgctatgaacatggacagcatcacatcaggactcctaggacccct
DQ823086_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
EF576812_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843209_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
MG098580_PreS2_P-F      ggccctgttatgaacatggacaacatcacatcaggactcctaggacccct
JX079937_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
JN811656_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
JN688701_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
DQ823087_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843220_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843207_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843175_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843189_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
FJ657528_PreS2_P-F      ggccctgctatgaccatggacaacatcacatcaggactcctaggacccct
FJ657519_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
DQ776247_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
EU366116_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
FJ657522_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843208_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843210_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843213_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
AF223962_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
DQ823088_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
DQ823090_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
HE981181_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KC494398_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843211_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843212_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843219_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843221_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843222_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ843224_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KX264499_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KY382411_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
JN792921_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ586807_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ638664_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ638656_PreS2_P-F      ggccctgctatgaacatggacaacaccacatcaggacacctaggactcct
AB116654_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
JN604225_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
AY090461_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
AY090458_PreS2_C-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KP718104_PreS2_P-F      gcccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KP718113_PreS2_P-F      gcccctgctatgaacatggacaacatcacatcaggactcctaggacccct
AY090459_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
JN604233_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
JN604201_PreS2_P-F      ggccctgctacgaacatggacaacatcacatccggactcctaggacccct
KP718110_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
JN604271_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KY476329_PreS2_P-F      gcccctgctacgaacatggacaacatctcatcaggactcctaggacccct
KJ586805_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggattcctaggacccct
KJ586806_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggattcctaggacccct
KY476324_PreS2_P-F      gcccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ638657_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KP718107_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
AB086397_PreS2_P-F      ggccctgctacgaacatggacaacatcacgtcaggactcctaggacccct
JN792917_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KY476325_PreS2_P-F      ggccctgctacgaacatggacagcatcacatcaggactcctaggacccct
KY382415_PreS2_P-F      ggccctgctaygaacatggacaacatcacatcaggactcctaggacccct
KY382416_PreS2_P-F      ggccctgctaygaacatggacaacatcacatcaggactcctaggacccct
KY382417_PreS2_P-F      ggccctgctaygaacatggacaacatcacatcaggactcctaggacccct
KY476330_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KY476327_PreS2_P-F      gcccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM627320_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
HM585200_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
FJ657525_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KY476328_PreS2_P-F      ggccctgctacgaacatggacagcatcacatcaggactcctaggacccct
EU670262_PreS2_P-F      gcccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KF199901_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KY476323_PreS2_P-F      ggccctgctacgaacatggacagcatcacatcaggactcctaggacccct
KC494400_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM622135_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggacacctaggacccct
KP995116_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM590474_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
AF223964_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
JN792916_PreS2_P-F      ggccctgctacgaacatggacagcatcacatcaggactcctaggacccct
KF779236_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
FJ709457_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
FJ709462_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843203_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843202_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843174_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ586808_PreS2_P-F      ggccctgctacaaacatggacaacatcacatcaggactcctaggacccct
JN792918_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
AB064316_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585186_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
HM590471_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
HM590472_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KM233681_PreS2_P-F      ggccctgctgtgaacatggacaacatcacatcaggactcctaggacccct
JN792914_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KY476332_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843204_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843179_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843169_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843163_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
FJ709463_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
FJ709460_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
AY179735_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
DQ823094_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
DQ823095_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
EU366118_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
FJ657529_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585192_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585193_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
JX079936_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843176_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843177_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843178_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843193_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843198_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843201_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843206_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585195_PreS2_P-F      ggccttgctacgaacatggacaacatcacatcaggactcctaggacccct
FJ709458_PreS2_P-F      ggccttgctacgaacatggacaacatcacatcaggactcctaggacccct
FJ709459_PreS2_P-F      ggccttgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585191_PreS2_P-F      ggccttgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585198_PreS2_P-F      ggccttgctacgaacatggacaacatcacatcaggactcctaggacccct
JN792922_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
AF223963_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843170_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843205_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
MK058437_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KM998715_PreS2_P-F      ggccctgctacgaacatggacaacatctcatcaggactcctaggacccct
KY458061_PreS2_P-F      ggccctgctacgaacatggacaacatctcatcaggactcctaggacccct
KY458062_PreS2_P-F      ggccctgctacgaacatggacaacatctcatcaggactcctaggacccct
KJ843194_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843167_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
JN792920_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
JN792919_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585197_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585194_PreS2_P-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
HE981182_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HE981183_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
FJ709465_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
EU366133_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
AB116552_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
DQ823091_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
FJ709464_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
FJ709494_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585187_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585188_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585189_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585190_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585196_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM585199_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HM590473_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
HQ378247_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
JN688691_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
JN688699_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
JN688703_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KC494404_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843171_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843190_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843195_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843196_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843197_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843199_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843200_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KP995098_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KX264496_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KY476322_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
DQ823092_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
DQ823093_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843164_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843180_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KJ843181_PreS2_P-F      ggccctgctacgaacatggacaacatcacatcaggactcctaggacccct
KP995114_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaagacccct
DQ899147_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
DQ899146_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
DQ899144_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
DQ899145_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KC494396_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KP995097_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KP995113_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaaaactcctaggacccct
KC494397_PreS2_P-F      ggccctgctatgaacatggacaacacttactcaggactcctaagacccct
KP995115_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KP995104_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KP995110_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KC494399_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
DQ899142_PreS2_P-F      ggccctgctatgagcatggacaacattacatcaggactcctaggacccct
AY090455_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KT896494_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
DQ899143_PreS2_P-F      ggccctgctatgagcatggacaacattacatcaggactcctaggacccct
KC494401_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KP995120_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KP995107_PreS2_P-F      ggccctgctatgaacatggacaacaccacatcaggactcctaggacccct
X69798_PreS2_P-F        ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KC494402_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KC494394_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KC494395_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KC494403_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KC494405_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
EU159674_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
AY311369_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KX264497_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
DQ131124_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KJ843191_PreS2_P-F      ggccctgctatgaacatggacaacattacatcaggactcctaggacccct
KP995118_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
KP995111_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
X75663_PreS2_P-F        ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
KP995117_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
JN604211_PreS2_P-F      ggccctgccttgaacatggagaacatcacatcaggactcctaggacccct
AB116550_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
KP995101_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
KP995106_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
KP995105_PreS2_P-F      ggccctgcaatgaacatggagaacatcacatcaggactcctaggacccct
FJ589066_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
DQ899148_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
AY311370_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
KP995124_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
KP995126_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
AB036913_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactccyaggacccct
AB036906_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB036907_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB036908_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB036919_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB036905_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB036909_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB036911_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB036912_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB036915_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB036916_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB036917_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB036918_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB036920_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
KX264498_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
AB036914_PreS2_P-F      ggccctgctatgaacatggagaacatcacatcaggactcctaggacccct
DQ899150_PreS2_P-F      ggccctgcaatgaacatggagaacatcacatcaggactcctaggacccct
KP995123_PreS2_P-F      ggccctgcaatgaacatggagaacatcacatcaggactcctaggacccct
KP995125_PreS2_P-F      ggccctgcaatgaacatggagaacatcacatcaggactcctaggacccct
KP718106_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
KP718111_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
KP718103_PreS2_P-F      ggccctgccatgaacatggacaacatcacatcaggactcctaggacccct
KP995109_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
KP718109_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
JF439884_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
JF439885_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
DQ899149_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
FJ589067_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
AB116551_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
AB036910_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
KP718112_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
MH051986_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
MH051987_PreS2_P-F      gaccctgccatgaacatggagaacatcacatcaggactcctaggacccct
KP995119_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
AB116549_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
KJ638659_PreS2_P-F      ggccctgccatgaacatggagaacatcacatcaggactcctaggacccct
                        * ** **     * ** *** * **     **   *  ** *  **  **

KJ638663_PreS2_P-F      gcccgtgttacagggggtgttttccttgttgacaaaaatcctcacaatac
MG098579_PreS2_P-F      gctcgtgtcatcggcggtgtcttccttgttgacaagaatccgcacaatac
JQ272888_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcacaatac
MG098584_PreS2_P-F      gctcgtattacaggcggtgtgtttcttgttgacaaaaatccgcacaatac
KJ676694_PreS2_P-F      gctcgtattacaggcggtgtctttcttgttgataaaaatcctcacaatac
MG098578_PreS2_P-F      gctcgtgttacaggcggtgtgtatcttgttgataaaaatcctcacaatac
MG098577_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttganaaaaatcctcacaatac
KJ638660_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ638662_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcacaatac
EF576808_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843225_PreS2_P-F      gctcgtgttacaggcggtgtatttcttgttgataaaaatcctcacaatac
KY476326_PreS2_P-F      gctcgtgttacrggcggtgtgtttctggttgacaaaaatccgcaaaatac
JN688709_PreS2_P-F      gctcgtgttacagggggtgtttttcttgttgacaaaaatcctcacaatac
MG098570_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB365453_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MG098583_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MG098566_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN688720_PreS2_P-F      gctcgtgttacaggcggtgtttttctcgttgataaaaatccgcacaatac
EU366132_PreS2_P-F      gctcgtgttacaggcggtgtttttctcgttgacaaaaatcctcacaattc
MG098575_PreS2_P-F      gctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcacaatac
MG098582_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB365449_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgtggacaaaaatcctcaaaacac
MG098569_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatrc
AB166850_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgcacaatac
X75658_PreS2_C-F        gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MG098573_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MG098565_PreS2_P-F      gctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcacaatac
MG098574_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB365450_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB365446_PreS2_P-F      gctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcacaatac
DQ823089_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843226_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MG098564_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843185_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843223_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcckcacaatac
JN811655_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB214516_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AF223965_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ823086_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
EF576812_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843209_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MG098580_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JX079937_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN811656_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN688701_PreS2_P-F      gctcgtgttacaggcggtgtktttcttgttgacaaaaatcctcacaatac
DQ823087_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843220_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843207_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843175_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843189_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ657528_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ657519_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ776247_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
EU366116_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ657522_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843208_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843210_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843213_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AF223962_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ823088_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ823090_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HE981181_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KC494398_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843211_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843212_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843219_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843221_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843222_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843224_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KX264499_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KY382411_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN792921_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ586807_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ638664_PreS2_P-F      gctcgtgttacaggcggtgtctttcttgttgacaaaaatcctcacaatac
KJ638656_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcaaaatac
AB116654_PreS2_P-F      gctcgtgttacaggcggtgttttccttgttgacaaaaatcctcacaatac
JN604225_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AY090461_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AY090458_PreS2_C-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP718104_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP718113_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AY090459_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN604233_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN604201_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgataagaatcctcacaatac
KP718110_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcacaatac
JN604271_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcacaatac
KY476329_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttaacaaaaatcctcacaatac
KJ586805_PreS2_P-F      tctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KJ586806_PreS2_P-F      tctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatac
KY476324_PreS2_P-F      gctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcacaatac
KJ638657_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP718107_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB086397_PreS2_P-F      gctcgtgttacaggcggcgtttttcttgttgataaaaatcctcacaatac
JN792917_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaagcttcctcacaatac
KY476325_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KY382415_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KY382416_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KY382417_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KY476330_PreS2_P-F      gctcgtgttacaggcggtgtgtttctcgttgacaaaaatcctcacaatac
KY476327_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM627320_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585200_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ657525_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KY476328_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
EU670262_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KF199901_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KY476323_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KC494400_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM622135_PreS2_P-F      gctcgtgttacaggcggtgtgttccttgttgacaaaaatccgcacaatac
KP995116_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM590474_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AF223964_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN792916_PreS2_P-F      gctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcacaatac
KF779236_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ709457_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ709462_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843203_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843202_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843174_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ586808_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN792918_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcacaatac
AB064316_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585186_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM590471_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM590472_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KM233681_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN792914_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KY476332_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843204_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843179_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843169_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843163_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ709463_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ709460_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AY179735_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ823094_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ823095_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
EU366118_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ657529_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585192_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585193_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JX079936_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843176_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843177_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843178_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843193_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843198_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843201_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843206_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585195_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ709458_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ709459_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585191_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585198_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN792922_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AF223963_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843170_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843205_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MK058437_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KM998715_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KY458061_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KY458062_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843194_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843167_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN792920_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN792919_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585197_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585194_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HE981182_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HE981183_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ709465_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
EU366133_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB116552_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ823091_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ709464_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ709494_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585187_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585188_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585189_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585190_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585196_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM585199_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HM590473_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
HQ378247_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN688691_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN688699_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JN688703_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KC494404_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843171_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843190_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843195_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843196_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843197_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843199_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843200_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995098_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KX264496_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KY476322_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ823092_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ823093_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843164_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843180_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843181_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995114_PreS2_P-F      gctcgtgttacaggcggtgtctttcttgttgacaaaaatccgcacaatac
DQ899147_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ899146_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ899144_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ899145_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KC494396_PreS2_P-F      gctcgtgttacatgcggtgtgtttcttgttgacaaaaatcctcacaatgc
KP995097_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatgc
KP995113_PreS2_P-F      gctcgtgttacagggggtgtttttctcgttgacaaaaatcctcacaatac
KC494397_PreS2_P-F      gctcgtgtcacaggcggtgtgttccttgttgacaaaaatcctcacaatac
KP995115_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcacaatac
KP995104_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995110_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KC494399_PreS2_P-F      gctcgtgttacaggcggtgtatttcttgttgataaaaatcctcataatgc
DQ899142_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AY090455_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KT896494_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ899143_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KC494401_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995120_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995107_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
X69798_PreS2_P-F        gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KC494402_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KC494394_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KC494395_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KC494403_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KC494405_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
EU159674_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AY311369_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KX264497_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ131124_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ843191_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995118_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995111_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
X75663_PreS2_P-F        gcgcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995117_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcaaaatac
JN604211_PreS2_P-F      gctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcacaatac
AB116550_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995101_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995106_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995105_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ589066_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ899148_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AY311370_PreS2_P-F      gctcgtgttacaggcggggggtttcttgttgacaaaaatcctcacaatac
KP995124_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995126_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036913_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036906_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036907_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036908_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036919_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036905_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036909_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036911_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036912_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036915_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036916_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036917_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036918_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036920_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KX264498_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036914_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ899150_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995123_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995125_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP718106_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP718111_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP718103_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995109_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcacaatac
KP718109_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JF439884_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
JF439885_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
DQ899149_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
FJ589067_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB116551_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB036910_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP718112_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MH051986_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
MH051987_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KP995119_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
AB116549_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatac
KJ638659_PreS2_P-F      gctcgtgttacaggcggtgtgtttcttgttgayaaaaatcctcacaatac
                         * *** * *   * ** *  *  ** **  * **   *** ** **  *

KJ638663_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
MG098579_PreS2_P-F      cacggagtctagactcgtggtggacttctctcaattttctagggggagta
JQ272888_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctaggggaacta
MG098584_PreS2_P-F      cacagagtctagactcgtggtggacttctctcagttttctagggggacta
KJ676694_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctcggggaacta
MG098578_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggtcta
MG098577_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ638660_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ638662_PreS2_P-F      cacagagtctagactcgtggtggacttctcgcaattttctaggggaaata
EF576808_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagagggacta
KJ843225_PreS2_P-F      cacagaatctagactcgtggtggacttctctcaattttctagggggacta
KY476326_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacca
JN688709_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
MG098570_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB365453_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
MG098583_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctaggggcacta
MG098566_PreS2_P-F      cacagagtctagactygtkgtggacttctctcarttttctaggggaacta
JN688720_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctaggggaacta
EU366132_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
MG098575_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
MG098582_PreS2_P-F      cacggagtctagactcgtggtggacttctctcaattttctagggggacta
AB365449_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctaggggcacta
MG098569_PreS2_P-F      cacagagtctagactcgtggtggacttctctcagttttctagagggacta
AB166850_PreS2_P-F      cacagagtctagacttgtggtggacttctctcaattttctagggggacta
X75658_PreS2_C-F        cacagagtctagactcgtggtggacttctctcaattttctagggggacta
MG098573_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
MG098565_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
MG098574_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB365450_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB365446_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctaggggcacta
DQ823089_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843226_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
MG098564_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843185_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843223_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
JN811655_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB214516_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AF223965_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ823086_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
EF576812_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843209_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
MG098580_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
JX079937_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
JN811656_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
JN688701_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ823087_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843220_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843207_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843175_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843189_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
FJ657528_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
FJ657519_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ776247_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
EU366116_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
FJ657522_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843208_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843210_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843213_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AF223962_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ823088_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ823090_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
HE981181_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KC494398_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843211_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843212_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843219_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843221_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843222_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843224_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KX264499_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KY382411_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
JN792921_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggamya
KJ586807_PreS2_P-F      cacagagtctaaactcgtggtggacttctctcaattttctagggggaaca
KJ638664_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacca
KJ638656_PreS2_P-F      cacagaatctagactcgtggtggacttctctcaattttctagggggaaca
AB116654_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
JN604225_PreS2_P-F      cacagagtctagactcgtggtggacttctctcagttttctaggggaaaca
AY090461_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
AY090458_PreS2_C-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KP718104_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KP718113_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
AY090459_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
JN604233_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
JN604201_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KP718110_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
JN604271_PreS2_P-F      cacggagtctagactcgtggtggacttctctcaattttctaggggaaaca
KY476329_PreS2_P-F      cacggagtctagactcgtggtggacttctctcaattttctagggggcaca
KJ586805_PreS2_P-F      cgcagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ586806_PreS2_P-F      cgcagagtctagactcgtggtggacttctctcaattttctagggggaaca
KY476324_PreS2_P-F      caaagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ638657_PreS2_P-F      cacrgagtctagactcgtggtggacttctctcaattttctagggggaaca
KP718107_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
AB086397_PreS2_P-F      cacggagtctagactcgtggtggacttctctcaattttctaggggaaaca
JN792917_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KY476325_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KY382415_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KY382416_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KY382417_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KY476330_PreS2_P-F      cacagagtctagactcgtggtggacttctcgcaattttctaggggaaaca
KY476327_PreS2_P-F      cacagaatctagactcgtggtggacttctctcaattttctagggggaaca
HM627320_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585200_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
FJ657525_PreS2_P-F      cacggagtctagactcgtggtggacttctctcagttttctagggggaaca
KY476328_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
EU670262_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KF199901_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KY476323_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KC494400_PreS2_P-F      cacaaagtctagactcgtggtggacttctctcaattttctagggcgaaca
HM622135_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KP995116_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM590474_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
AF223964_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
JN792916_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KF779236_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
FJ709457_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
FJ709462_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843203_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843202_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843174_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ586808_PreS2_P-F      cacaaagtctagactcgtggtggacttctctcaattttctagggggaaca
JN792918_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
AB064316_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585186_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM590471_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM590472_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KM233681_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
JN792914_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KY476332_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843204_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843179_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843169_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843163_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
FJ709463_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
FJ709460_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
AY179735_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagagggaaca
DQ823094_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
DQ823095_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
EU366118_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
FJ657529_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585192_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585193_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
JX079936_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843176_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843177_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843178_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843193_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843198_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843201_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843206_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585195_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
FJ709458_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagagggaaca
FJ709459_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585191_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585198_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
JN792922_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
AF223963_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843170_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843205_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
MK058437_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KM998715_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KY458061_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KY458062_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843194_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843167_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
JN792920_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
JN792919_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585197_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585194_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HE981182_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HE981183_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
FJ709465_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
EU366133_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
AB116552_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
DQ823091_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
FJ709464_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
FJ709494_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585187_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585188_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585189_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585190_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585196_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM585199_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HM590473_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
HQ378247_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
JN688691_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
JN688699_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
JN688703_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KC494404_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843171_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843190_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843195_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843196_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843197_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843199_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843200_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KP995098_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KX264496_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KY476322_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
DQ823092_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
DQ823093_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843164_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843180_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KJ843181_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggaaca
KP995114_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ899147_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ899146_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ899144_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ899145_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KC494396_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995097_PreS2_P-F      cacagagtctagacttgtggtggacttctctcagttttctagagggacta
KP995113_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KC494397_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995115_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995104_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995110_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KC494399_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ899142_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AY090455_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KT896494_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ899143_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KC494401_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995120_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995107_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
X69798_PreS2_P-F        cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KC494402_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KC494394_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KC494395_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KC494403_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KC494405_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
EU159674_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AY311369_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KX264497_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ131124_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ843191_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995118_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995111_PreS2_P-F      caaagagtctagactcgtggtggacttctctcaattttctagggggacta
X75663_PreS2_P-F        cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995117_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
JN604211_PreS2_P-F      camagartctagactcgtggtggacttctctcaattttctagggggacta
AB116550_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995101_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctaggggaacta
KP995106_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995105_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctaggggcacta
FJ589066_PreS2_P-F      cacagagtctagactcgtggtggacttctctcagttttctagagggacta
DQ899148_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AY311370_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995124_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995126_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036913_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036906_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036907_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036908_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036919_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036905_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036909_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036911_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036912_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036915_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036916_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036917_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036918_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036920_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KX264498_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036914_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ899150_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995123_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995125_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP718106_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP718111_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP718103_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995109_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP718109_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
JF439884_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
JF439885_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
DQ899149_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
FJ589067_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB116551_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB036910_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP718112_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
MH051986_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
MH051987_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KP995119_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
AB116549_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
KJ638659_PreS2_P-F      cacagagtctagactcgtggtggacttctctcaattttctagggggacta
                        *    * **** *** ** *********** ** ****** * *     *

KJ638663_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MG098579_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JQ272888_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MG098584_PreS2_P-F      cccgagtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ676694_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MG098578_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MG098577_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ638660_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ638662_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
EF576808_PreS2_P-F      cccaggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843225_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY476326_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN688709_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MG098570_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB365453_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MG098583_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MG098566_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN688720_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
EU366132_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MG098575_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MG098582_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB365449_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MG098569_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB166850_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
X75658_PreS2_C-F        cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MG098573_PreS2_P-F      cccgggtgtcctgsccaaaattcgcagtccccaacctccaatcacttacc
MG098565_PreS2_P-F      cccgggtgtcctgsccaaaattcgcagtccccaacctccaatcacttacc
MG098574_PreS2_P-F      cccgggtgtcctggccaaaattcscagtccccaacctccaatcacttacc
AB365450_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB365446_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ823089_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843226_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MG098564_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843185_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843223_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN811655_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB214516_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AF223965_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ823086_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
EF576812_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843209_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MG098580_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JX079937_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN811656_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN688701_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ823087_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843220_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843207_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843175_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843189_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ657528_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ657519_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ776247_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
EU366116_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ657522_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843208_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843210_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843213_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AF223962_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ823088_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ823090_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HE981181_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KC494398_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843211_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843212_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843219_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843221_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843222_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843224_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KX264499_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY382411_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN792921_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ586807_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ638664_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ638656_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB116654_PreS2_P-F      accgggtgtcctggccaaaattcgctgtccccaacctccaatcacttacc
JN604225_PreS2_P-F      ccagggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AY090461_PreS2_P-F      ccagggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AY090458_PreS2_C-F      ccagggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP718104_PreS2_P-F      ccagggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP718113_PreS2_P-F      ccagggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AY090459_PreS2_P-F      ccagggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN604233_PreS2_P-F      ccagggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN604201_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP718110_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttact
JN604271_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY476329_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ586805_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ586806_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY476324_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ638657_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP718107_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacy
AB086397_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN792917_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY476325_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY382415_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY382416_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY382417_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY476330_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY476327_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM627320_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585200_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ657525_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY476328_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
EU670262_PreS2_P-F      ccagggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KF199901_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY476323_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KC494400_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM622135_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995116_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM590474_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AF223964_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN792916_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KF779236_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ709457_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ709462_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843203_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843202_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843174_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ586808_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN792918_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB064316_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585186_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM590471_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM590472_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KM233681_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN792914_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY476332_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843204_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843179_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843169_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843163_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ709463_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ709460_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AY179735_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ823094_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ823095_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
EU366118_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ657529_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585192_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585193_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JX079936_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843176_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843177_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843178_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843193_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843198_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843201_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843206_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585195_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ709458_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ709459_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585191_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585198_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN792922_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AF223963_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843170_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843205_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MK058437_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KM998715_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY458061_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY458062_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843194_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843167_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN792920_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN792919_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585197_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585194_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HE981182_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HE981183_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ709465_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
EU366133_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB116552_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ823091_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ709464_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ709494_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585187_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585188_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585189_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585190_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585196_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM585199_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HM590473_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
HQ378247_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN688691_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN688699_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN688703_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KC494404_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843171_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843190_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843195_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843196_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843197_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843199_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843200_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995098_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KX264496_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KY476322_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ823092_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ823093_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843164_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843180_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843181_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995114_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ899147_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ899146_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ899144_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ899145_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KC494396_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995097_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995113_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KC494397_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995115_PreS2_P-F      cccgtgtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995104_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995110_PreS2_P-F      cccgggtgtcttggccaaaattcgcagtccccaacctccaatcacttacc
KC494399_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ899142_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AY090455_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KT896494_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ899143_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KC494401_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995120_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995107_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
X69798_PreS2_P-F        cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KC494402_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KC494394_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KC494395_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KC494403_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KC494405_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
EU159674_PreS2_P-F      cccgggtgttctggccaaaattcgcagtccccaacctccaatcacttacc
AY311369_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KX264497_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ131124_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ843191_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995118_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995111_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
X75663_PreS2_P-F        cccaggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995117_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JN604211_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB116550_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995101_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995106_PreS2_P-F      cccgggtgtcttggccaaaattcgcagtccccaacctccaatcacttacc
KP995105_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ589066_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ899148_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AY311370_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995124_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995126_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036913_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036906_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036907_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036908_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036919_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036905_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036909_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036911_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036912_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036915_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036916_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036917_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036918_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036920_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KX264498_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036914_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ899150_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995123_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995125_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP718106_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP718111_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP718103_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995109_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP718109_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JF439884_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
JF439885_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
DQ899149_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
FJ589067_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB116551_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB036910_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP718112_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MH051986_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
MH051987_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KP995119_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
AB116549_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
KJ638659_PreS2_P-F      cccgggtgtcctggccaaaattcgcagtccccaacctccaatcacttacc
                         *   ****  ** ********* * *********************** 

KJ638663_PreS2_P-F      aacctcctgtcctccgacttgtcctggctatcgttggatgtgtctgcggc
MG098579_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JQ272888_PreS2_P-F      aacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MG098584_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtatctgcggc
KJ676694_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MG098578_PreS2_P-F      aacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggc
MG098577_PreS2_P-F      aacctcctgtcctccaamttgtcctgkttatcgttggatgtgtctgcggc
KJ638660_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ638662_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
EF576808_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843225_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KY476326_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JN688709_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MG098570_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB365453_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MG098583_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggrtgtgtctgcggc
MG098566_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JN688720_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
EU366132_PreS2_P-F      aacctcctgtcctctaacttgtcctggctatcgttggatgtgtctgcggc
MG098575_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MG098582_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB365449_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MG098569_PreS2_P-F      aacctcctgtcctccaacttgtcctgsctatcgttggatgtgtctgcggc
AB166850_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
X75658_PreS2_C-F        aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MG098573_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MG098565_PreS2_P-F      aacctcctgtcctcmaacttgtcctgtctatcgttggatgtgtctgcggc
MG098574_PreS2_P-F      aacctcctgtcctccaacttgtcatggctatcgttggatgtgtctgcggc
AB365450_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB365446_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ823089_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843226_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MG098564_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843185_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843223_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JN811655_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB214516_PreS2_P-F      aacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggc
AF223965_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ823086_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
EF576812_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843209_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MG098580_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JX079937_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JN811656_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JN688701_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ823087_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843220_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843207_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843175_PreS2_P-F      aacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggc
KJ843189_PreS2_P-F      aacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggc
FJ657528_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
FJ657519_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ776247_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
EU366116_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
FJ657522_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843208_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843210_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843213_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AF223962_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ823088_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ823090_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
HE981181_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KC494398_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843211_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843212_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843219_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843221_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843222_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843224_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KX264499_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KY382411_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JN792921_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgytggatgtgtctgcggc
KJ586807_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ638664_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ638656_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB116654_PreS2_P-F      aacctcttgtcctccaacttgtcctggctatcgctcgatgtgtctgcggc
JN604225_PreS2_P-F      aacctcctgtcctccgacttgtcctggctatcgctggatgtctctgcggc
AY090461_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AY090458_PreS2_C-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KP718104_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KP718113_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AY090459_PreS2_P-F      aacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
JN604233_PreS2_P-F      aacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
JN604201_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KP718110_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JN604271_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY476329_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ586805_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ586806_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY476324_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ638657_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP718107_PreS2_P-F      aacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggc
AB086397_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JN792917_PreS2_P-F      aaccttctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY476325_PreS2_P-F      aaccttctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY382415_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY382416_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY382417_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY476330_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY476327_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM627320_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585200_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
FJ657525_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY476328_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
EU670262_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KF199901_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY476323_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KC494400_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM622135_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KP995116_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM590474_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AF223964_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JN792916_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KF779236_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
FJ709457_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
FJ709462_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843203_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843202_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843174_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ586808_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JN792918_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB064316_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585186_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM590471_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM590472_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KM233681_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JN792914_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY476332_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843204_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843179_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843169_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843163_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
FJ709463_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
FJ709460_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AY179735_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
DQ823094_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
DQ823095_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
EU366118_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
FJ657529_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585192_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585193_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JX079936_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843176_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843177_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843178_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843193_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843198_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843201_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843206_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585195_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
FJ709458_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
FJ709459_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585191_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585198_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JN792922_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AF223963_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843170_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843205_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
MK058437_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KM998715_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY458061_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY458062_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843194_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843167_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JN792920_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JN792919_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585197_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585194_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HE981182_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HE981183_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
FJ709465_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
EU366133_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
AB116552_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
DQ823091_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
FJ709464_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
FJ709494_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585187_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585188_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585189_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585190_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585196_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM585199_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HM590473_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
HQ378247_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JN688691_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JN688699_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
JN688703_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KC494404_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843171_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843190_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843195_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843196_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843197_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843199_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843200_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KP995098_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KX264496_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KY476322_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
DQ823092_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
DQ823093_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843164_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843180_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KJ843181_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KP995114_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggacgtgtctgcggc
DQ899147_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ899146_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgccgc
DQ899144_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ899145_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KC494396_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995097_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995113_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KC494397_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtcggcggc
KP995115_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995104_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995110_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KC494399_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ899142_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AY090455_PreS2_P-F      aacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggc
KT896494_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ899143_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KC494401_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995120_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995107_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
X69798_PreS2_P-F        aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KC494402_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KC494394_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KC494395_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KC494403_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KC494405_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
EU159674_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AY311369_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KX264497_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ131124_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ843191_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995118_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995111_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
X75663_PreS2_P-F        aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995117_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JN604211_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB116550_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995101_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995106_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995105_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
FJ589066_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ899148_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AY311370_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995124_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995126_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036913_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036906_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036907_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036908_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036919_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036905_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036909_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036911_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036912_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036915_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036916_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036917_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036918_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036920_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KX264498_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036914_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ899150_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995123_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995125_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP718106_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP718111_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP718103_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995109_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP718109_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JF439884_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
JF439885_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
DQ899149_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
FJ589067_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB116551_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB036910_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP718112_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MH051986_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
MH051987_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KP995119_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
AB116549_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
KJ638659_PreS2_P-F      aacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
                        *****  *******  * ***** **  ***** * *  ** ** ** **

KJ638663_PreS2_P-F      gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttg
MG098579_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JQ272888_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098584_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ676694_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098578_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098577_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ638660_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ638662_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
EF576808_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843225_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY476326_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN688709_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098570_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB365453_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098583_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098566_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN688720_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
EU366132_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098575_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098582_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB365449_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098569_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB166850_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
X75658_PreS2_C-F        gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098573_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098565_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098574_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB365450_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB365446_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ823089_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843226_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098564_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843185_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843223_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN811655_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB214516_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AF223965_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ823086_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
EF576812_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843209_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MG098580_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JX079937_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN811656_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN688701_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ823087_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843220_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843207_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843175_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843189_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ657528_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ657519_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ776247_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
EU366116_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ657522_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843208_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843210_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843213_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AF223962_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ823088_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ823090_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HE981181_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KC494398_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843211_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843212_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843219_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843221_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843222_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843224_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KX264499_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY382411_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN792921_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ586807_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ638664_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ638656_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB116654_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN604225_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AY090461_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AY090458_PreS2_C-F      gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttg
KP718104_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP718113_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AY090459_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN604233_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN604201_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctattcctcatcttcttgttg
KP718110_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN604271_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY476329_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ586805_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ586806_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY476324_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ638657_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP718107_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB086397_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN792917_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY476325_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY382415_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY382416_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY382417_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY476330_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY476327_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM627320_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585200_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ657525_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY476328_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
EU670262_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KF199901_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY476323_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KC494400_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM622135_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995116_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM590474_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AF223964_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN792916_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KF779236_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ709457_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ709462_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843203_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843202_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843174_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ586808_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN792918_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB064316_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585186_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM590471_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM590472_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KM233681_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN792914_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY476332_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843204_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843179_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843169_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843163_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ709463_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ709460_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AY179735_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ823094_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ823095_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
EU366118_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ657529_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585192_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585193_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JX079936_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843176_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843177_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843178_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843193_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843198_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843201_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843206_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585195_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ709458_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ709459_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585191_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585198_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN792922_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AF223963_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843170_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843205_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MK058437_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KM998715_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY458061_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY458062_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843194_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843167_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN792920_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN792919_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585197_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585194_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HE981182_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HE981183_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ709465_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
EU366133_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB116552_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ823091_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ709464_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ709494_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585187_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585188_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585189_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585190_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585196_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM585199_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HM590473_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
HQ378247_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN688691_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN688699_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN688703_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KC494404_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843171_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843190_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843195_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843196_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843197_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843199_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843200_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995098_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KX264496_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KY476322_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ823092_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ823093_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843164_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843180_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843181_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995114_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ899147_PreS2_P-F      gttttatcatcttcctcttcatcctgctgcaatgcctcatcttcttgttg
DQ899146_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ899144_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ899145_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KC494396_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995097_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995113_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KC494397_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995115_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995104_PreS2_P-F      gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttg
KP995110_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KC494399_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ899142_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AY090455_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KT896494_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ899143_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KC494401_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995120_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995107_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
X69798_PreS2_P-F        gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KC494402_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KC494394_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KC494395_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KC494403_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KC494405_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
EU159674_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AY311369_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KX264497_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ131124_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ843191_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995118_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcaccttcttgttg
KP995111_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
X75663_PreS2_P-F        gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995117_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JN604211_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB116550_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995101_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995106_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995105_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ589066_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ899148_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AY311370_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995124_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995126_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036913_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036906_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036907_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036908_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036919_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036905_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036909_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036911_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036912_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036915_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036916_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036917_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036918_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036920_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KX264498_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036914_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ899150_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995123_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995125_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP718106_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP718111_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP718103_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995109_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP718109_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JF439884_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
JF439885_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
DQ899149_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
FJ589067_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB116551_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB036910_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP718112_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MH051986_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
MH051987_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KP995119_PreS2_P-F      gttctatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
AB116549_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
KJ638659_PreS2_P-F      gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttg
                        *** ****** ******* *********** ** ***** **********

KJ638663_PreS2_P-F      gttcttctggattatcaaggtatgttgcccgtttgtcctctacttccagg
MG098579_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
JQ272888_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
MG098584_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ676694_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcccctacttccagg
MG098578_PreS2_P-F      gttcttctggactatcagggtatgttgcccgtttgtcctctaattccagg
MG098577_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ638660_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ638662_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
EF576808_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843225_PreS2_P-F      gttcttctggactatcagggtatgttgcccgtttgtcctctaattccagg
KY476326_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
JN688709_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
MG098570_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctaattccagg
AB365453_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
MG098583_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
MG098566_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
JN688720_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
EU366132_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
MG098575_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
MG098582_PreS2_P-F      gttcttgtggactatcaaggtatgttgcccgtttgtcctctaattccagg
AB365449_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
MG098569_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
AB166850_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
X75658_PreS2_C-F        gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
MG098573_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
MG098565_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
MG098574_PreS2_P-F      gttcttgtggactatcaaggtatgttgcccgtttgtcctctaattccagg
AB365450_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
AB365446_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
DQ823089_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843226_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
MG098564_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843185_PreS2_P-F      gttcttgtggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843223_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
JN811655_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
AB214516_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
AF223965_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
DQ823086_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
EF576812_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843209_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
MG098580_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
JX079937_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
JN811656_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
JN688701_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
DQ823087_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843220_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843207_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843175_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843189_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
FJ657528_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
FJ657519_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
DQ776247_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
EU366116_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
FJ657522_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843208_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843210_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843213_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
AF223962_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
DQ823088_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
DQ823090_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
HE981181_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KC494398_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843211_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843212_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843219_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843221_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843222_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KJ843224_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KX264499_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
KY382411_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagg
JN792921_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctamttccagg
KJ586807_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ638664_PreS2_P-F      gttcttgtggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ638656_PreS2_P-F      gttcttgtggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB116654_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JN604225_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AY090461_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AY090458_PreS2_C-F      gttcttctggactatcaaggtatgttgcccgtctgtcctctacttccagg
KP718104_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP718113_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AY090459_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JN604233_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JN604201_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP718110_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JN604271_PreS2_P-F      gttcttctggactatcagggtatgttgcccgtttgtcctctacttccagg
KY476329_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ586805_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ586806_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KY476324_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ638657_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP718107_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB086397_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JN792917_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KY476325_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KY382415_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KY382416_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KY382417_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KY476330_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcccctacttccagg
KY476327_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM627320_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585200_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
FJ657525_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KY476328_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
EU670262_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KF199901_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KY476323_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KC494400_PreS2_P-F      gttcttgtggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM622135_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP995116_PreS2_P-F      gttcttgtggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM590474_PreS2_P-F      gttcttctggactattaaggtatgttgcccgtttgtcctctacttccagg
AF223964_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JN792916_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KF779236_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
FJ709457_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
FJ709462_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843203_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843202_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843174_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ586808_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JN792918_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB064316_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585186_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM590471_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM590472_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KM233681_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JN792914_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KY476332_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843204_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843179_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843169_PreS2_P-F      gttcttgtggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843163_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
FJ709463_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
FJ709460_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AY179735_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
DQ823094_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
DQ823095_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
EU366118_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
FJ657529_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585192_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585193_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JX079936_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843176_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843177_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843178_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843193_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843198_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843201_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843206_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585195_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
FJ709458_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
FJ709459_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585191_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585198_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JN792922_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AF223963_PreS2_P-F      gttcttgtggactatcaaggtatgttgcccgtttgtcctccacttccagg
KJ843170_PreS2_P-F      gttcttgtggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843205_PreS2_P-F      gttcttgtggactatcaaggtatgttgcccgtttgtcctctacttccagg
MK058437_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KM998715_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KY458061_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KY458062_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843194_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843167_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JN792920_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtgtgtcctctacttccagg
JN792919_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585197_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585194_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HE981182_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HE981183_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
FJ709465_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
EU366133_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB116552_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
DQ823091_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
FJ709464_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
FJ709494_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585187_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585188_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585189_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585190_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585196_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM585199_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HM590473_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
HQ378247_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JN688691_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JN688699_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
JN688703_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KC494404_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843171_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843190_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843195_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843196_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843197_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843199_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843200_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP995098_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KX264496_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KY476322_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
DQ823092_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
DQ823093_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843164_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843180_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843181_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP995114_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctgcttccagg
DQ899147_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
DQ899146_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
DQ899144_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
DQ899145_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KC494396_PreS2_P-F      gttcttctggactatcagggtatgttgcccgtttgtcctctacttccagg
KP995097_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP995113_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KC494397_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP995115_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP995104_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP995110_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KC494399_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
DQ899142_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AY090455_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KT896494_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
DQ899143_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KC494401_PreS2_P-F      gttcttctggactatcagggtatgttgcccgtttgtcctctacttccagg
KP995120_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP995107_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
X69798_PreS2_P-F        gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KC494402_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KC494394_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KC494395_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KC494403_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KC494405_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
EU159674_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AY311369_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KX264497_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
DQ131124_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ843191_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP995118_PreS2_P-F      gttcttctggactatcacggtatattgcccgtttgtcctctaattccagg
KP995111_PreS2_P-F      gttcttgtggactcccaaggtatgttgcccgtttgtcctctacttccagg
X75663_PreS2_P-F        gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
KP995117_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
JN604211_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
AB116550_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP995101_PreS2_P-F      gttcttctggactatcagggtatgttgcccgtttgtcctctacttccagg
KP995106_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP995105_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
FJ589066_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
DQ899148_PreS2_P-F      gttcttgtggactaccaaggtatgttgcccgtttgtcctctacttccagg
AY311370_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
KP995124_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
KP995126_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
AB036913_PreS2_P-F      gttcttgtggactatcgaggtatgttgcccgtttgtcctctacttccagg
AB036906_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctcta--------
AB036907_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctcta--------
AB036908_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctcta--------
AB036919_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB036905_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB036909_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB036911_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB036912_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB036915_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB036916_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB036917_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB036918_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB036920_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KX264498_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
AB036914_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
DQ899150_PreS2_P-F      gttcttgtggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP995123_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP995125_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP718106_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KP718111_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
KP718103_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
KP995109_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
KP718109_PreS2_P-F      gttcttctggactaccarggtatgttgcccgtttgtcctctacttccagg
JF439884_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
JF439885_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
DQ899149_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
FJ589067_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
AB116551_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
AB036910_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
KP718112_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
MH051986_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
MH051987_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
KP995119_PreS2_P-F      gttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
AB116549_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
KJ638659_PreS2_P-F      gttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
                        ****** **** *     ***** ******** ***** *          

KJ638663_PreS2_P-F      atccacgacc---accagcacgggaccatgcaaaacctgcacaactcttg
MG098579_PreS2_P-F      atctacgacc---accagcacgggaccatgcaaaacctgcacaactcttg
JQ272888_PreS2_P-F      atccaccacc---accagcacgggaccatgcaaracctgcacaactcttg
MG098584_PreS2_P-F      atccacgacc---accagcacgggaccatgcaaaacctgcacaactcttg
KJ676694_PreS2_P-F      atccacgacc---accagcacgggaccatgcaaaacctgcacgactcttg
MG098578_PreS2_P-F      atctacgacc---accagcacgggaccatgcaaaacctgcacaactcttg
MG098577_PreS2_P-F      atctacaacc---accagcacgggacaatgcaaaacctgcacaactcttg
KJ638660_PreS2_P-F      atctacgacc---accagcacgggaccatgcaaaacctgcacaactcttg
KJ638662_PreS2_P-F      atctacgacc---accagcacgggaccatgcaaaacctgcacaactcttg
EF576808_PreS2_P-F      atctacgacc---accagcacgggaccatgcaaaacctgc