HBVdb

Dataset for nucleotide sequence PreS1 of genotype F

[Download (right click)] [Edit] [Sequences] [Repertoires]

284 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


KJ638660_PreS1_P-F      atgggagcacctctctcaacgacaagaagaggcatgggacagaatctttc
KJ638662_PreS1_P-F      atgggagcacctctctcaacgacaagaagaggcatgggacagaatctttc
KJ638663_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN792921_PreS1_P-F      atgggagcacctctmtcaacgacwcgaagrggcatgggacagaatctctc
KJ638664_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN604198_PreS1_P-F      atgggagcacctctatcaacgacacgaaggggcatgggacagaatctctc
AY090456_PreS1_P-F      atgggagcacctctatcaacgacacgaaggggcatgggacagaatctctc
JN604225_PreS1_P-F      atgggagcacctctatcaacgacragaaggggcatgggacagaatctctc
AY090458_PreS1_C-F      atgggagcacctctatcaacgacacgaaggggcatgggacagaatctctc
KP718104_PreS1_P-F      atgggagcacctctatcaacgacacgaaggggcatggggcagaatctctc
KP718113_PreS1_P-F      atgggagcacctctatcaacgacacgaaggggcatgggacagaatctctc
AY090461_PreS1_P-F      atgggagcacctctatcaacgacacgaaggggcatgggacagaatctctc
AY090459_PreS1_P-F      atgggagcacctctatcaacgacacgaaggggcatgggacagaatctctc
JN604233_PreS1_P-F      atgggagcacctctatcaacgacacgaaggggcatgggacagaatctctc
KJ586807_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN604201_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ638657_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ638656_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KP995116_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KP718107_PreS1_P-F      atgggagcacctctatccacgactcgaaggggcatgggacagaatctctc
AB116654_PreS1_P-F      atgggagcacctctatcaacgactcgaagaggcatgggacagaatctctc
KP718110_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY476325_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY476328_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY476329_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY476327_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY476324_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY382415_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY382416_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY382417_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN604271_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
AB086397_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
FJ657525_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY476330_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY476331_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
EU670262_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN792922_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN792916_PreS1_P-F      atgggagcacctttatcaacgactcgaaggggcatgggacagaatctctc
HM627320_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN792917_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY476323_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585200_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KF779236_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KC494400_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM590474_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgtgacagaatctctc
KF199901_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585186_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM590471_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM590472_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KM233681_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ586808_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JX079936_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843177_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843178_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN792918_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM622135_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585194_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
AB064316_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN792914_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
AF223964_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
FJ709457_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
FJ709462_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843168_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843169_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY458062_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KM998715_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY458061_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843194_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843181_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
DQ823092_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
DQ823093_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843164_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843180_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
FJ709464_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HQ378247_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843203_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843202_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843174_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843163_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KC494404_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843197_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN792920_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN792919_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
FJ709460_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
EU366133_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
AY179735_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY476332_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585195_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
FJ709459_PreS1_P-F      atgggagcacctctatctacgactcgaaggggcatgggacagaatctctc
FJ709458_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585191_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585198_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
AF223963_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843170_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843205_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
MK058437_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KY476322_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843204_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843193_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843179_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843167_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585197_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585193_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HE981183_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HE981182_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
FJ709465_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
FJ709463_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
AB116552_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
DQ823091_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
FJ709494_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585187_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585188_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585189_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585190_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585196_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585199_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM590473_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN688691_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN688699_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
JN688703_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843171_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843190_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843195_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843196_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843199_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843200_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KP995098_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KX264496_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
DQ823094_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
DQ823095_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
EU366118_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
FJ657529_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
HM585192_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843176_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843198_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843201_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KJ843206_PreS1_P-F      atgggagcacctctatcaacgactcgaaggggcatgggacagaatctctc
KP995118_PreS1_P-F      atgggagcacctctctcaacgactcgaaggggcatgggactgaatctttc
X75663_PreS1_P-F        atgggagcacctctctcaacgacaagaaggggcatgggacagaatctttc
KP995105_PreS1_P-F      atgggagcacctctctcaacgacgagaaggggcatgggactgaatctttc
KP995111_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB116550_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggattaaatctttc
JN604211_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP718106_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
DQ899150_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036913_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036920_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036919_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036916_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036917_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036918_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036915_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036914_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036905_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036909_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036911_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036912_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KX264498_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036906_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036907_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036908_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP995117_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP995101_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
DQ899149_PreS1_P-F      atgggagcacctctctcaaccacaagaaggggcatgggactgaatctttc
KP718111_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP995123_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP995125_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP995106_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP718103_PreS1_P-F      atgggagcacctctctccacgacaagaaggggcatgggactgaatctttc
FJ589066_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AY311370_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP995124_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP995126_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
DQ899148_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
MH051986_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
MH051987_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP995119_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB116549_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KJ638659_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP995109_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
JF439884_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
JF439885_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP718109_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
FJ589067_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB116551_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
AB036910_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP718112_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggactgaatctttc
KP995114_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcaggggacaaaatctctc
DQ899147_PreS1_P-F      atgggagcacctctctcaacgacaagaagaggcatgggacagaatctctc
DQ899144_PreS1_P-F      atgggagcacctctctcaacgacaagaagaggcatgggacagaatctctc
DQ899145_PreS1_P-F      atgggagcacctctctcaacgacaagaagaggcatgggacagaatctctc
DQ899146_PreS1_P-F      atgggagcacctctctcaacgacaagaagaggcatgggacagaatctctc
KC494399_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KP995115_PreS1_P-F      atgggagcacctcactcaacgagacgaagaggcatgggacagaatctctc
KP995097_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KP995113_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KC494396_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KC494397_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
AY090455_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KP995110_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
DQ899142_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
DQ899143_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KT896494_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctytc
KP995104_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KP995107_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KC494401_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KP995120_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KJ843191_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KC494402_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
X69798_PreS1_P-F        atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KC494403_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
AY311369_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KX264497_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KC494394_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KC494395_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KC494405_PreS1_P-F      atgggagcacctctctcaacgacacgaagaggcatgggacagaatctctc
KJ676694_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
MG098584_PreS1_P-F      atgggagcacctctatcaacgacgagaaggggcatgggacagaatctctc
MG098579_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacaraatctctc
JQ272888_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
MG098578_PreS1_P-F      atgggagcaccactctcaacggcaagaaggggcatgggacagaatctctc
MG098577_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
EF576808_PreS1_P-F      atgggagcacctctctcaacgacgagaaggggcatgggacagaatctctc
KY476326_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843225_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
JN688709_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
AB365453_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
MG098582_PreS1_P-F      atgggagcacctctctcaacggcaagaaggggcatgggacagaatctctc
MG098583_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
MG098570_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
MG098566_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacaraatctctc
X75658_PreS1_C-F        atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
EU366132_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
AB365449_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggtatgggacagaatctctc
MG098573_PreS1_P-F      atgggagcacctctatcaacgacaagaaggggcatgggacagaatctctc
MG098575_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
JN688720_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
MG098569_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
MG098565_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
MG098574_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843185_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctcac
AB166850_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
AB365446_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
AB214516_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
AB365450_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843223_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
DQ823089_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843226_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
JN811655_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
DQ823086_PreS1_P-F      atgggagcacctctctcaacgacgagaaggggcatgggacagaatctctc
KJ843209_PreS1_P-F      atgggagcacctctctcaacgacgagaaggggcatgggacagaatctctc
MG098564_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
AF223965_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
EF576812_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
MG098580_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
AF223962_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843175_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctcac
KJ843189_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
DQ823087_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
JN688701_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
DQ823088_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843211_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843212_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843219_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843221_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843222_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843224_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KY382411_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
FJ657528_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843220_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
JX079937_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
JN811656_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843207_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KC494398_PreS1_P-F      atgggagcacctctctcaacgacacgaaggggcatgggacagaatctctc
FJ657519_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
DQ776247_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
EU366116_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
FJ657522_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843208_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843210_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KJ843213_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
DQ823090_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
HE981181_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
KX264499_PreS1_P-F      atgggagcacctctctcaacgacaagaaggggcatgggacagaatctctc
                        ***********    ** **     **** ** * * *    *****  *

KJ638660_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatcctctat
KJ638662_PreS1_P-F      tgtgcccaatcctctgggattctttccagaycatcagctggatcctctat
KJ638663_PreS1_P-F      tgtacccaatccgctgggattctttcccgaccatcagctggatcctctat
JN792921_PreS1_P-F      tgtrcccaatcctctgggattctttccagaccatcagctggatcckctrt
KJ638664_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
JN604198_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
AY090456_PreS1_P-F      tgtacccaatcctctgggattcttgccagaccatcagctggatcctctat
JN604225_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
AY090458_PreS1_C-F      tgtacccaatcctctgggattcttgccagaccatcagctggatcctctat
KP718104_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KP718113_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
AY090461_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
AY090459_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
JN604233_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ586807_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
JN604201_PreS1_P-F      tgtacccaatcctctgggattctttccagaccaycagctggatcctctat
KJ638657_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ638656_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KP995116_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KP718107_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
AB116654_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KP718110_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KY476325_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KY476328_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KY476329_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KY476327_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KY476324_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcaactggatcctctat
KY382415_PreS1_P-F      tgtacccaatcctctgggattctttccaraccatcagctggatcctctat
KY382416_PreS1_P-F      tgtacccaatcctctgggattctttccaraccatcagctggatcctctat
KY382417_PreS1_P-F      tgtacccaatcctctgggattctttccaraccatcagctggatcctctat
JN604271_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
AB086397_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
FJ657525_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatcctctat
KY476330_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KY476331_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
EU670262_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagttggatcctctat
JN792922_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctrt
JN792916_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM627320_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
JN792917_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KY476323_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585200_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KF779236_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KC494400_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM590474_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KF199901_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585186_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM590471_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM590472_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KM233681_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ586808_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
JX079936_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843177_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843178_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
JN792918_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM622135_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585194_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
AB064316_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
JN792914_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
AF223964_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
FJ709457_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
FJ709462_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843168_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843169_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KY458062_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KM998715_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KY458061_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843194_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843181_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
DQ823092_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
DQ823093_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843164_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843180_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
FJ709464_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HQ378247_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843203_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843202_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843174_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843163_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KC494404_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843197_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
JN792920_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
JN792919_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
FJ709460_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
EU366133_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
AY179735_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctcttt
KY476332_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585195_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
FJ709459_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
FJ709458_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585191_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585198_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
AF223963_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843170_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843205_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
MK058437_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KY476322_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843204_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843193_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843179_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843167_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585197_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585193_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HE981183_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagttggatcctctat
HE981182_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
FJ709465_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
FJ709463_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
AB116552_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
DQ823091_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
FJ709494_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585187_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585188_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585189_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585190_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585196_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585199_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM590473_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
JN688691_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
JN688699_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
JN688703_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843171_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843190_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843195_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843196_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843199_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843200_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KP995098_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KX264496_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
DQ823094_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
DQ823095_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
EU366118_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
FJ657529_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
HM585192_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843176_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843198_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843201_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KJ843206_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
KP995118_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgttat
X75663_PreS1_P-F        tgtgcccaatccactgggcttcttgccagaccatcagctggatccgctat
KP995105_PreS1_P-F      tgtgcccaatcctctgggcttcttaccagaccatcagctggatccgctat
KP995111_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
AB116550_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
JN604211_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
KP718106_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
DQ899150_PreS1_P-F      tgtgcccaatcctctgggcttctttccagaccatcaggtggatccgatat
AB036913_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036920_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036919_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036916_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036917_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036918_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036915_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036914_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036905_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036909_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036911_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036912_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
KX264498_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036906_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036907_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
AB036908_PreS1_P-F      tgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctat
KP995117_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagttggatccgctat
KP995101_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
DQ899149_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccggtat
KP718111_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatcctttat
KP995123_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccactat
KP995125_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccactat
KP995106_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
KP718103_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctgt
FJ589066_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
AY311370_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
KP995124_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
KP995126_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
DQ899148_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
MH051986_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
MH051987_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
KP995119_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
AB116549_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
KJ638659_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
KP995109_PreS1_P-F      cgtgcccaatcccctgggcttcttgccagaccatcagctggatccgctat
JF439884_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagttggatccgctat
JF439885_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagttggatccgctat
KP718109_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
FJ589067_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
AB116551_PreS1_P-F      tgtgcccaatcccctgggcttcttgccagaccatcagctggatccgctat
AB036910_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
KP718112_PreS1_P-F      tgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctat
KP995114_PreS1_P-F      tgtgcccaatcctctgggattctttccggaccatcagctggatccgctat
DQ899147_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
DQ899144_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
DQ899145_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
DQ899146_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KC494399_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KP995115_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KP995097_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KP995113_PreS1_P-F      tgtgcccaaccctctgggattctttccagaccatcagctggatccgctat
KC494396_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KC494397_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
AY090455_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KP995110_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
DQ899142_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
DQ899143_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KT896494_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KP995104_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KP995107_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KC494401_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KP995120_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KJ843191_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KC494402_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
X69798_PreS1_P-F        tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KC494403_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
AY311369_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KX264497_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KC494394_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KC494395_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KC494405_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatccgctat
KJ676694_PreS1_P-F      tgtacccaatcctctgggattctttccagaccatcagctggatcctctat
MG098584_PreS1_P-F      tgtacccaatcccctgggattctttccagaccatcagctggatcctctat
MG098579_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
JQ272888_PreS1_P-F      tgtgcccaatccgctgggattctttccagaacatcagctggatcctcttt
MG098578_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatcctcttt
MG098577_PreS1_P-F      tgtgcccaatccactgggattctttccaraacatcagctggatcctcttt
EF576808_PreS1_P-F      tgtgcccaatccactgggattctttccagaacatcagctggatcctcttt
KY476326_PreS1_P-F      tgtgcccaatcctctgggattccttccagaccatcagctggatcctcttt
KJ843225_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
JN688709_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
AB365453_PreS1_P-F      tgtgcccaatccactgggattctttccagaacatcagctggatcctcttt
MG098582_PreS1_P-F      tgtgcccaatcctctgggattctttccagaccatcagctggatcctcttt
MG098583_PreS1_P-F      tgtgcccaatccactgggattctttccagaacatcagctggatcctcttt
MG098570_PreS1_P-F      ggtgcccaatccactgggattctttccagaccatcagctggatcctcttt
MG098566_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
X75658_PreS1_C-F        tgtgcccaatccactgggattctttccagaccatcaactggatcctcttt
EU366132_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
AB365449_PreS1_P-F      tgtgcccaatccactgggattctttccagaacatcagctggatcctcttt
MG098573_PreS1_P-F      tgtgcccaatccactgggattctttccagaacatcagctggatcctcttt
MG098575_PreS1_P-F      tgtgcccaatccactgggattctttccagaacatcagctggatcctcttt
JN688720_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
MG098569_PreS1_P-F      tgtgcccaatccactgggattctttccagaacatcagctggatcctcttt
MG098565_PreS1_P-F      tgtgcccaatccactgggattctttccaraacatcagctggatcctcttt
MG098574_PreS1_P-F      tgtgcccaatccactgggattctttccagaacatcagctggatcctcttt
KJ843185_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
AB166850_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
AB365446_PreS1_P-F      tgtgcccaatccgctgggattctttccagaacatcagctggatcctcttt
AB214516_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
AB365450_PreS1_P-F      tgtgcccaatccactgggattctttccagaacatcagctggatcctcttt
KJ843223_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatccgcttt
DQ823089_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
KJ843226_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
JN811655_PreS1_P-F      tgtgcccaatccgctgggattctttccagaccatcagctggatcctcttt
DQ823086_PreS1_P-F      tgtgcccaatccactgggattctttccagamcatcagctggatcctcttt
KJ843209_PreS1_P-F      tgtgcccaatccactgggattcttgccagaacatcagctggatcctcttt
MG098564_PreS1_P-F      tgtgcccaatccgctgggattctttccagaccatcagctggatcctcttt
AF223965_PreS1_P-F      tgtgcccaatccactgggattctttccagaacatcagctggatcctcttt
EF576812_PreS1_P-F      tgtgcccaatccactgggattctttccagaacatcagctggatcctcttt
MG098580_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
AF223962_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
KJ843175_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
KJ843189_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
DQ823087_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
JN688701_PreS1_P-F      tgtgcccaatccgctgggattctttccagaccatcagctggatcctcttt
DQ823088_PreS1_P-F      tgtgcccaatccgctgggattctttccagaccatcagctggatcctcttt
KJ843211_PreS1_P-F      tgtgcccaatccgctgggattctttccagaccatcagctggatcctcttt
KJ843212_PreS1_P-F      tgtgcccaatccgctgggattctttccagaccatcagctggatcctcttt
KJ843219_PreS1_P-F      tgtgcccaatccgctgggattctttccagaccatcagctggatcctcttt
KJ843221_PreS1_P-F      tgtgcccaatccgctgggattctttccagaccatcagctggatcctcttt
KJ843222_PreS1_P-F      tgtgcccaatccgctgggattctttccagaccatcagctggatcctcttt
KJ843224_PreS1_P-F      tgtgcccaatccgctgggattctttccagaccatcagctggatcctcttt
KY382411_PreS1_P-F      tgtgcccaatccgctgggattctttccagaccatcagctggatcctcttt
FJ657528_PreS1_P-F      tgtgcccaatccgctgggattctttccagaccatcagctggatcctcttt
KJ843220_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
JX079937_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
JN811656_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
KJ843207_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
KC494398_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
FJ657519_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
DQ776247_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
EU366116_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
FJ657522_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
KJ843208_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
KJ843210_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
KJ843213_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
DQ823090_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
HE981181_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
KX264499_PreS1_P-F      tgtgcccaatccactgggattctttccagaccatcagctggatcctcttt
                         ** ***** ** ***** *** * **  * ** **  *******  * *

KJ638660_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ638662_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ638663_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN792921_PreS1_P-F      tcagrgcaaattccagcagtcccgactgggacttcaacamaaacaaggac
KJ638664_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN604198_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
AY090456_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN604225_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
AY090458_PreS1_C-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaagcaaggac
KP718104_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaagcaaggac
KP718113_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaagcaaggac
AY090461_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
AY090459_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN604233_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ586807_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN604201_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ638657_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ638656_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KP995116_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KP718107_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
AB116654_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KP718110_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KY476325_PreS1_P-F      tcagggcaaattccaacagtcccgactgggacttcaacaaaaacaaggac
KY476328_PreS1_P-F      tcagggcaaattccaacagtcccgactgggacttcaacaaaaacaaggac
KY476329_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KY476327_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KY476324_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KY382415_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaamcaaggac
KY382416_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaamcaaggac
KY382417_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaamcaaggac
JN604271_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
AB086397_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
FJ657525_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KY476330_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KY476331_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
EU670262_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN792922_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN792916_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM627320_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN792917_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KY476323_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585200_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KF779236_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
KC494400_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM590474_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KF199901_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585186_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM590471_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM590472_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KM233681_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ586808_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JX079936_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843177_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843178_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN792918_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM622135_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
HM585194_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
AB064316_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN792914_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
AF223964_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
FJ709457_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
FJ709462_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843168_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843169_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KY458062_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
KM998715_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
KY458061_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
KJ843194_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
KJ843181_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
DQ823092_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
DQ823093_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
KJ843164_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
KJ843180_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
FJ709464_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
HQ378247_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
KJ843203_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843202_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843174_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843163_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KC494404_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843197_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN792920_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN792919_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
FJ709460_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaagacaaggac
EU366133_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
AY179735_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KY476332_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585195_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
FJ709459_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
FJ709458_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585191_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585198_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
AF223963_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843170_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843205_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
MK058437_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KY476322_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843204_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843193_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843179_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843167_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585197_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585193_PreS1_P-F      tcagggcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
HE981183_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HE981182_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
FJ709465_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
FJ709463_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
AB116552_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
DQ823091_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
FJ709494_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585187_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585188_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585189_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585190_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585196_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585199_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM590473_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN688691_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN688699_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
JN688703_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843171_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843190_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843195_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843196_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843199_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843200_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KP995098_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KX264496_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
DQ823094_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
DQ823095_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
EU366118_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
FJ657529_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
HM585192_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843176_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843198_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843201_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843206_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KP995118_PreS1_P-F      tcaaagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
X75663_PreS1_P-F        tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995105_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995111_PreS1_P-F      tcaaagcaaattccagcaatcccgactgggacttcaacacaaacaaggac
AB116550_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacaccaacaaggac
JN604211_PreS1_P-F      tcaaagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP718106_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggas
DQ899150_PreS1_P-F      tcagagcaaattccagcagttccgagtgggacttcaacacaaacaaggac
AB036913_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036920_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036919_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036916_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036917_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036918_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036915_PreS1_P-F      tcagggcaaattccaacagtcccgactgggacttcaacacaaacaaggac
AB036914_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036905_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036909_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036911_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036912_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KX264498_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036906_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036907_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036908_PreS1_P-F      tcagggcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995117_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995101_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
DQ899149_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
KP718111_PreS1_P-F      tcagagcaaataccagcagtcccgactgggacttcaacacaaacaaggac
KP995123_PreS1_P-F      tcagagcaaattccagcagtccagactgggacttcaacacaaacaaggac
KP995125_PreS1_P-F      tcagagcaaattccagcagtccagactgggacttcaacacaaacaaggac
KP995106_PreS1_P-F      tcaaagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP718103_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
FJ589066_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AY311370_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995124_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995126_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
DQ899148_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
MH051986_PreS1_P-F      tcaaagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
MH051987_PreS1_P-F      tcaaagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995119_PreS1_P-F      tcaaagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB116549_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KJ638659_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995109_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
JF439884_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
JF439885_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP718109_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
FJ589067_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB116551_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB036910_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP718112_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995114_PreS1_P-F      tcaaagcaaattccagcagtcccgactgggacttcaacacgaacaaggac
DQ899147_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
DQ899144_PreS1_P-F      tcaaagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
DQ899145_PreS1_P-F      tcaaagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
DQ899146_PreS1_P-F      tcaaagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KC494399_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacaccaacaaggac
KP995115_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995097_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995113_PreS1_P-F      tcagaacaaattccagcagtcccgactgggacttcaacacaaacaaggac
KC494396_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KC494397_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AY090455_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995110_PreS1_P-F      tcaaagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
DQ899142_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
DQ899143_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KT896494_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995104_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995107_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KC494401_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KP995120_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KJ843191_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KC494402_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
X69798_PreS1_P-F        tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KC494403_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AY311369_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KX264497_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KC494394_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KC494395_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KC494405_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
KJ676694_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
MG098584_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
MG098579_PreS1_P-F      tcakagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
JQ272888_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
MG098578_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
MG098577_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
EF576808_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
KY476326_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaacaacaaggac
KJ843225_PreS1_P-F      tcagagcaaattccagcagccccgattgggacttcaacaaaaacaaggac
JN688709_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
AB365453_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
MG098582_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
MG098583_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
MG098570_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
MG098566_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
X75658_PreS1_C-F        tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
EU366132_PreS1_P-F      tcagagcaaattccagcagtccagattgggacttcaacaaaaacaaggac
AB365449_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
MG098573_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
MG098575_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
JN688720_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
MG098569_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
MG098565_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
MG098574_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
KJ843185_PreS1_P-F      tcaaagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
AB166850_PreS1_P-F      tcaaagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
AB365446_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
AB214516_PreS1_P-F      tcaaagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
AB365450_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
KJ843223_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
DQ823089_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacaaaaacaaggac
KJ843226_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
JN811655_PreS1_P-F      tcagagcaaattccagcagtcccgactgggacttcaacaaaaccaaggac
DQ823086_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacctcaacaaaaacaaggac
KJ843209_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
MG098564_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaccaaggac
AF223965_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
EF576812_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
MG098580_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
AF223962_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
KJ843175_PreS1_P-F      tcaaagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
KJ843189_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
DQ823087_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
JN688701_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaccaaggac
DQ823088_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaccaaggac
KJ843211_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaccaaggac
KJ843212_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaccaaggac
KJ843219_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaccaaggac
KJ843221_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaccaaggac
KJ843222_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaccaaggac
KJ843224_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaccaaggac
KY382411_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaccaaggac
FJ657528_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaccaaggac
KJ843220_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
JX079937_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
JN811656_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
KJ843207_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
KC494398_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
FJ657519_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
DQ776247_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
EU366116_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
FJ657522_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
KJ843208_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
KJ843210_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
KJ843213_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
DQ823090_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
HE981181_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
KX264499_PreS1_P-F      tcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggac
                        ***   ***** *** **   * ** ****** ******    ****** 

KJ638660_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KJ638662_PreS1_P-F      agttggccaatggcaaacaaggtatggaccggggaaggctacggtccagg
KJ638663_PreS1_P-F      aattggccaatggccaacaaggtagga---gtgggaggatacggtcctgg
JN792921_PreS1_P-F      arttggccaatggcaaacaaggtagga---gtgggagsmtacggtccwgg
KJ638664_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggacctgg
JN604198_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
AY090456_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JN604225_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
AY090458_PreS1_C-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KP718104_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KP718113_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
AY090461_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
AY090459_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JN604233_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ586807_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JN604201_PreS1_P-F      aattggccaatggcaaacaaggtrgga---gtgggagcatacggtcctgg
KJ638657_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ638656_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KP995116_PreS1_P-F      aattggccaatggcaaacaaggtaaga---gtgggaggctacggtcctgg
KP718107_PreS1_P-F      aattggccaatggcgaacaaggtagga---gtgggaggatacggtcctgg
AB116654_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KP718110_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KY476325_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatatggtcccgg
KY476328_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatatggtcccgg
KY476329_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KY476327_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KY476324_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KY382415_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KY382416_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KY382417_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JN604271_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
AB086397_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcccgg
FJ657525_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KY476330_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KY476331_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
EU670262_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JN792922_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggagcatacggtcctgg
JN792916_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM627320_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JN792917_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KY476323_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585200_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KF779236_PreS1_P-F      cattggccaatagcaaacaaggtagga---gtgggaggatacggtcctgg
KC494400_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM590474_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KF199901_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585186_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM590471_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM590472_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KM233681_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ586808_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JX079936_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843177_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843178_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JN792918_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM622135_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585194_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
AB064316_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JN792914_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
AF223964_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
FJ709457_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
FJ709462_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843168_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843169_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KY458062_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KM998715_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KY458061_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843194_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843181_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
DQ823092_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
DQ823093_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843164_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843180_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
FJ709464_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HQ378247_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843203_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843202_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843174_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843163_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KC494404_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843197_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JN792920_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JN792919_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
FJ709460_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
EU366133_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
AY179735_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KY476332_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585195_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
FJ709459_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
FJ709458_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585191_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585198_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
AF223963_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843170_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843205_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
MK058437_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KY476322_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843204_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843193_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843179_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843167_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585197_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585193_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HE981183_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HE981182_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
FJ709465_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
FJ709463_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
AB116552_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
DQ823091_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
FJ709494_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585187_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585188_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585189_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585190_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585196_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585199_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM590473_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JN688691_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JN688699_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
JN688703_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843171_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843190_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843195_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843196_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843199_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843200_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KP995098_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KX264496_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
DQ823094_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
DQ823095_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
EU366118_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
FJ657529_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
HM585192_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843176_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843198_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843201_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KJ843206_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggatacggtcctgg
KP995118_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
X75663_PreS1_P-F        agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995105_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
KP995111_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
AB116550_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
JN604211_PreS1_P-F      aagtggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP718106_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
DQ899150_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
AB036913_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036920_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036919_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036916_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036917_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036918_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036915_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036914_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036905_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036909_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036911_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036912_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
KX264498_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036906_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036907_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
AB036908_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggcccagg
KP995117_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995101_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
DQ899149_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP718111_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995123_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995125_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995106_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacgggccagg
KP718103_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
FJ589066_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggcttcggcccagg
AY311370_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995124_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaagctacggtccagg
KP995126_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
DQ899148_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
MH051986_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
MH051987_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995119_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
AB116549_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KJ638659_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995109_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
JF439884_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
JF439885_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP718109_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
FJ589067_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
AB116551_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
AB036910_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP718112_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995114_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
DQ899147_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggatacggtccagg
DQ899144_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggatacggtccagg
DQ899145_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggatacggtccagg
DQ899146_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggatacggtccagg
KC494399_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995115_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995097_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995113_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KC494396_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KC494397_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
AY090455_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtcccgg
KP995110_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
DQ899142_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
DQ899143_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KT896494_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995104_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995107_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggagcctacggtccagg
KC494401_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KP995120_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KJ843191_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KC494402_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
X69798_PreS1_P-F        agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KC494403_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
AY311369_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KX264497_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KC494394_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KC494395_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KC494405_PreS1_P-F      agttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KJ676694_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtggggggctacggtccagg
MG098584_PreS1_P-F      aattggccaatggcaaacaaggtagga---gtggggggctacggtccagg
MG098579_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaagttacggtccagg
JQ272888_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
MG098578_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
MG098577_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
EF576808_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttatggtccagg
KY476326_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843225_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
JN688709_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
AB365453_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
MG098582_PreS1_P-F      acttggccaatggcaaacaaggtagga---gcgggaggttacggtccagg
MG098583_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
MG098570_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
MG098566_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
X75658_PreS1_C-F        acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
EU366132_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
AB365449_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
MG098573_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
MG098575_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
JN688720_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
MG098569_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggytacggtccagg
MG098565_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
MG098574_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843185_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
AB166850_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggagcatacggtccagg
AB365446_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
AB214516_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggagcatacggtccagg
AB365450_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843223_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
DQ823089_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843226_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaagttacggtccagg
JN811655_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
DQ823086_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggctacggtccagg
KJ843209_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
MG098564_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
AF223965_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
EF576812_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
MG098580_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
AF223962_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843175_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843189_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
DQ823087_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
JN688701_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
DQ823088_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843211_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843212_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843219_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843221_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843222_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843224_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KY382411_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
FJ657528_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843220_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
JX079937_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
JN811656_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843207_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KC494398_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
FJ657519_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
DQ776247_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
EU366116_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
FJ657522_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843208_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843210_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KJ843213_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
DQ823090_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
HE981181_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
KX264499_PreS1_P-F      acttggccaatggcaaacaaggtagga---gtgggaggttacggtccagg
                           ******** ** ********  *    * **     *  ** ** **

KJ638660_PreS1_P-F      gttcacgcccccgcacggtggcctgctggggtggagccctcaagcacaag
KJ638662_PreS1_P-F      gttcacgccc---cacggtggcctgctggggtggagccctcaagcacaag
KJ638663_PreS1_P-F      gttcacaccccctcacggtggcctgttggggtggagcccacaggcacagg
JN792921_PreS1_P-F      gttcacacccccacacggtggcctgytggggtggagtccacaggcacagg
KJ638664_PreS1_P-F      gttcacaccccctcacggtggcctgttggggtggagcccacaggcacagg
JN604198_PreS1_P-F      gttcacgcycccacacggtggcctgctggggtggagcccacaggcacagg
AY090456_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagcccacaggcacagg
JN604225_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagcccacaggcacagg
AY090458_PreS1_C-F      tttcacacccccacacggtggcctgctggggtggagcccacaggcacagg
KP718104_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
KP718113_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
AY090461_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagcccacaggcacagg
AY090459_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagcccacaggcacagg
JN604233_PreS1_P-F      gttcacacccccacacggtggcctgctgggatggagcccacaggcacagg
KJ586807_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
JN604201_PreS1_P-F      cttcacacccccacacggtggcctgctgggctggagcccacaggcacagg
KJ638657_PreS1_P-F      gtacacaccccctcacggtggcctgttggggtggagcccacaggcacagg
KJ638656_PreS1_P-F      gttcacaccccctcacggtggcctgttggggtggagcccacaggcacagg
KP995116_PreS1_P-F      gttcacaccaccgcacggtggccttttggggtggagtccacaggctcagg
KP718107_PreS1_P-F      gttcacaccccctcacggtggcctgttggggtggagcccacaggcacagg
AB116654_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
KP718110_PreS1_P-F      gttcacaccccctcacggtggcctgttggggtggagcccacaggcacagg
KY476325_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
KY476328_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
KY476329_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
KY476327_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
KY476324_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
KY382415_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KY382416_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KY382417_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
JN604271_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
AB086397_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
FJ657525_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KY476330_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
KY476331_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
EU670262_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
JN792922_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
JN792916_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM627320_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
JN792917_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KY476323_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
HM585200_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
KF779236_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KC494400_PreS1_P-F      gttcacaccccctcacggtggcctgttggggtggagtccacaggcacagg
HM590474_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KF199901_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM585186_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM590471_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM590472_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KM233681_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ586808_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
JX079936_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacaag
KJ843177_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacaag
KJ843178_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacaag
JN792918_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM622135_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM585194_PreS1_P-F      gttcacacccccacacggtggcctgttgggatggagcccacaggcacagg
AB064316_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
JN792914_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
AF223964_PreS1_P-F      gttcacaccccctcacggtggcctgttggggtggagtccacaggcacagg
FJ709457_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
FJ709462_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843168_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843169_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KY458062_PreS1_P-F      gttcacacccccacacggtggcctgttgggrtggagtccacaggcacagg
KM998715_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KY458061_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843194_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843181_PreS1_P-F      gttcacacccccacacggtggcctgttgggttggagtccacaggcacagg
DQ823092_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
DQ823093_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843164_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843180_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
FJ709464_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HQ378247_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843203_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843202_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843174_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843163_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KC494404_PreS1_P-F      gttcacaccccctcacggtggcctgttggggtggagtccacaggcacagg
KJ843197_PreS1_P-F      gttcacaccccctcacggtggcctgttggggtggagtccacaggcacagg
JN792920_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
JN792919_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
FJ709460_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
EU366133_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
AY179735_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KY476332_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
HM585195_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
FJ709459_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
FJ709458_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM585191_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM585198_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
AF223963_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843170_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843205_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
MK058437_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KY476322_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacagg
KJ843204_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843193_PreS1_P-F      gttcacacccccacacggcggcctgttggggtggagtccacaggcacagg
KJ843179_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843167_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM585197_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM585193_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HE981183_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HE981182_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
FJ709465_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
FJ709463_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
AB116552_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
DQ823091_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
FJ709494_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM585187_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM585188_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM585189_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM585190_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM585196_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM585199_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM590473_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
JN688691_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
JN688699_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
JN688703_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843171_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843190_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843195_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843196_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843199_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843200_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KP995098_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KX264496_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
DQ823094_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
DQ823095_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
EU366118_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
FJ657529_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
HM585192_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843176_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843198_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843201_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KJ843206_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagtccacaggcacagg
KP995118_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacagg
X75663_PreS1_P-F        gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
KP995105_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
KP995111_PreS1_P-F      gttcacacccccacacggtggcctgctgggatggagccctcaggcacagg
AB116550_PreS1_P-F      gttcacaccaccacacggtggcctgctggggtggagccctcaggcacagg
JN604211_PreS1_P-F      gttcacacccccacatggtggcctgctgggatggagccctcaggcacagg
KP718106_PreS1_P-F      gttcacacccccacacggtggcctgctgggatggagccctcaggcacagg
DQ899150_PreS1_P-F      gttcacacccccacacggtggcctgatggggtggagccctcaggcacagg
AB036913_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036920_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036919_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036916_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036917_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036918_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036915_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036914_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036905_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036909_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036911_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036912_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
KX264498_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036906_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036907_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036908_PreS1_P-F      gtttacacccccacacggtggcctgctggggtggagccctcaggcacagg
KP995117_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
KP995101_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
DQ899149_PreS1_P-F      gttcacacccccacacggtggcctggtggggtggagccctcaggcacaag
KP718111_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
KP995123_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
KP995125_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
KP995106_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
KP718103_PreS1_P-F      gttcacacccccacacggtggcctactggggtggagccctcaggcacagg
FJ589066_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
AY311370_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
KP995124_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
KP995126_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
DQ899148_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
MH051986_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcccagg
MH051987_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcccagg
KP995119_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB116549_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
KJ638659_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
KP995109_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
JF439884_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
JF439885_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
KP718109_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
FJ589067_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB116551_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
AB036910_PreS1_P-F      gttcacaccccctcacggtggcctgctggggtggagccctcaggcacagg
KP718112_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacagg
KP995114_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
DQ899147_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacaag
DQ899144_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacaag
DQ899145_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaggcacaag
DQ899146_PreS1_P-F      gttcacacccccacacggtggcttgctagggtggagccctcaggcacaag
KC494399_PreS1_P-F      gttcacacccccacacggtggcctgctgggatggagccctcaagcacaag
KP995115_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KP995097_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacagg
KP995113_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KC494396_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacagg
KC494397_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
AY090455_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KP995110_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
DQ899142_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
DQ899143_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KT896494_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KP995104_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KP995107_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KC494401_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KP995120_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KJ843191_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagcccccaagcacaag
KC494402_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
X69798_PreS1_P-F        gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KC494403_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
AY311369_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KX264497_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KC494394_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KC494395_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KC494405_PreS1_P-F      gttcacacccccacacggtggcctgctggggtggagccctcaagcacaag
KJ676694_PreS1_P-F      gttcacacccccacacggtggcttgctgggatggagccctcaggcacaag
MG098584_PreS1_P-F      gttcacacccccacacggtggcttgctggggtggagccctcaggcacagg
MG098579_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
JQ272888_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
MG098578_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacaag
MG098577_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
EF576808_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KY476326_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaagcacaag
KJ843225_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacagg
JN688709_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
AB365453_PreS1_P-F      gttcacacccccacacgggggcctgttggggtggagccctcaggcacaag
MG098582_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagcccacaggcacaag
MG098583_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
MG098570_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
MG098566_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
X75658_PreS1_C-F        gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
EU366132_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
AB365449_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
MG098573_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
MG098575_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
JN688720_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
MG098569_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
MG098565_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
MG098574_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843185_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
AB166850_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
AB365446_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
AB214516_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
AB365450_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843223_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
DQ823089_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843226_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
JN811655_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
DQ823086_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843209_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
MG098564_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
AF223965_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
EF576812_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
MG098580_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
AF223962_PreS1_P-F      gttcacaccaccacacggtggcctgttgggatggagccctcaggcacaag
KJ843175_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843189_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
DQ823087_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
JN688701_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
DQ823088_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843211_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843212_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843219_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843221_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843222_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843224_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KY382411_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
FJ657528_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843220_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
JX079937_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
JN811656_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843207_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KC494398_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
FJ657519_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
DQ776247_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
EU366116_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
FJ657522_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843208_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843210_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KJ843213_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
DQ823090_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
HE981181_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
KX264499_PreS1_P-F      gttcacacccccacacggtggcctgttggggtggagccctcaggcacaag
                         *  ** *     ** ** *** *  * ** ***** ** ** ** ** *

KJ638660_PreS1_P-F      gtgttttaaccaccttgccagcggatccgcctcctgcttccaccaatcgg
KJ638662_PreS1_P-F      gtgttttaaccaccttgccagcggatccgcctcctgcttccaccaatcgg
KJ638663_PreS1_P-F      gtgtgcttactacattgccagcagatccgcctcctgcttccaccaatcgg
JN792921_PreS1_P-F      gtgtgctcacaacattgccagcagatccgcctcccgcttccaccaatcgg
KJ638664_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
JN604198_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
AY090456_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctccagcttccaccaatcgg
JN604225_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
AY090458_PreS1_C-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KP718104_PreS1_P-F      gagtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KP718113_PreS1_P-F      gagtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
AY090461_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
AY090459_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
JN604233_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ586807_PreS1_P-F      gtgtgcttacaacattgccaccagatccgcctcctgcttccaccaatcgg
JN604201_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ638657_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ638656_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KP995116_PreS1_P-F      gtgtacttacaactttgccagcagatccgcctcctgcttccaccaatcgg
KP718107_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
AB116654_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KP718110_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KY476325_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgctcccaccaatcgg
KY476328_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgctcccaccaatcgg
KY476329_PreS1_P-F      gtgtgcttacaacattgccagtagatccgcctcctgctcccaccaatcgg
KY476327_PreS1_P-F      gtgtgcttacaacatggccagcaaatccgcctactgcttccaccaatcgg
KY476324_PreS1_P-F      gtgtgcttacaacgttgccagcagatccgcctcctgctcccaccaatcgg
KY382415_PreS1_P-F      gtgtgcttacaacattgccagcggatccgcctcctgcttccaccaatcgg
KY382416_PreS1_P-F      gtgtgcttacaacattgccagcggatccgcctcctgcttccaccaatcgg
KY382417_PreS1_P-F      gtgtgcttacaacattgccagcggatccgcctcctgcttccaccaatcgg
JN604271_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
AB086397_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
FJ657525_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KY476330_PreS1_P-F      gtgtgcttacaacattgccagcagatccacctcctgcttccaccaatcgg
KY476331_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgctcccaccaatcgg
EU670262_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgctcccaccaatcgg
JN792922_PreS1_P-F      gtgtgctcacaacattgccagcagatccgcctcctgcttccaccaatcgg
JN792916_PreS1_P-F      gtgtgctcacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM627320_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
JN792917_PreS1_P-F      gtgtgctcacaacattgccagcagatccgcctcctgcttccaccaatcgg
KY476323_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgctcccaccaatcgg
HM585200_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KF779236_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KC494400_PreS1_P-F      gtgtgcttacaacattgccagcaaatccgcctcctgcttccaccaatcgg
HM590474_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KF199901_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585186_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM590471_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM590472_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KM233681_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ586808_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
JX079936_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgctcccaccaatcgg
KJ843177_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgctcccaccaatcgg
KJ843178_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgctcccaccaatcgg
JN792918_PreS1_P-F      gtgtgctcacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM622135_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585194_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
AB064316_PreS1_P-F      gtgtgcttacaacagtgccagcagatccgcctcctgcttccaccaatcgg
JN792914_PreS1_P-F      gtgtgctcacaacattgccagcagatccgcctcctgcttccaccaatcgg
AF223964_PreS1_P-F      gtgtgcttacaacattgccagcaaatccgcctcctgcttccaccaatcgg
FJ709457_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
FJ709462_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843168_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843169_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KY458062_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KM998715_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KY458061_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843194_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843181_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
DQ823092_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
DQ823093_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843164_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843180_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
FJ709464_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HQ378247_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843203_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843202_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843174_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843163_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KC494404_PreS1_P-F      gtgtgcttacaacattgccagcaaatccgcctcctgcttccaccaatcgg
KJ843197_PreS1_P-F      gtgtgcttacaacattgccagcaaatccgcctcctgcttccaccaatcgg
JN792920_PreS1_P-F      gtgtgctcacaacattgccagcagatccgcctcctgcttccaccaatcgg
JN792919_PreS1_P-F      gtgtgctcacaacattgccagcagatccgcctcctgcttccaccaatcgg
FJ709460_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
EU366133_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
AY179735_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KY476332_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585195_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
FJ709459_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
FJ709458_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585191_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585198_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
AF223963_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843170_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843205_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
MK058437_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KY476322_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843204_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843193_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843179_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843167_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585197_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585193_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HE981183_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HE981182_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
FJ709465_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
FJ709463_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
AB116552_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
DQ823091_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
FJ709494_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585187_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585188_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585189_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585190_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585196_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585199_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM590473_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
JN688691_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
JN688699_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
JN688703_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843171_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843190_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843195_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843196_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843199_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843200_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KP995098_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KX264496_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
DQ823094_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
DQ823095_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
EU366118_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
FJ657529_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
HM585192_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843176_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843198_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843201_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KJ843206_PreS1_P-F      gtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcgg
KP995118_PreS1_P-F      gtgttttgacaaccttgccagcagatccgcctcctgcttccaccaatcgg
X75663_PreS1_P-F        gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP995105_PreS1_P-F      gtgttttaacaaccttgccaacagatccgcctcctgcttccaccaatcgg
KP995111_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB116550_PreS1_P-F      gtgtgttaacaaccttgccagccgatccgcctcctgcttccaccaatcgg
JN604211_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP718106_PreS1_P-F      gtgttttaacaaccttgccagtagatccgcctcctgcttccaccaatcgg
DQ899150_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB036913_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB036920_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcctccaccaatcgg
AB036919_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB036916_PreS1_P-F      gtgttttaacaacctcgccagcagatccgcctcctgcttccaccaatcgg
AB036917_PreS1_P-F      gtgttttaacaacctcgccagcagatccgcctcctgcttccaccaatcgg
AB036918_PreS1_P-F      gtgttttaacaacctcgccagcagatccgcctcctgcttccaccaatcgg
AB036915_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB036914_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB036905_PreS1_P-F      gtgttttracaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB036909_PreS1_P-F      gtgttttracaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB036911_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB036912_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KX264498_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB036906_PreS1_P-F      gtgttttracaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB036907_PreS1_P-F      gtgttttracaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB036908_PreS1_P-F      gtgttttgacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP995117_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP995101_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
DQ899149_PreS1_P-F      gtgttctaactaccttgccagcagatccgcctcctgcttccaccaatcgg
KP718111_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctacttccaccaatcgg
KP995123_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP995125_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP995106_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP718103_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
FJ589066_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AY311370_PreS1_P-F      gtgttttgacaaccttgccagcagatccacctcctgcttccaccaatcgg
KP995124_PreS1_P-F      gtgttttgacaaccttgccagcagatccacctcctgcttccaccaatcgg
KP995126_PreS1_P-F      gtgttttgacaaccttgccagcagatccacctcctgcttccaccaatcgg
DQ899148_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
MH051986_PreS1_P-F      gtgttttaacaactttgccagcagatccgcctcctgcttccaccaatcgg
MH051987_PreS1_P-F      gtgttttaacaactttgccagcagatccgcctcctgcttccaccaatcgg
KP995119_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB116549_PreS1_P-F      gtgctttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ638659_PreS1_P-F      gtgctttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP995109_PreS1_P-F      gggttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
JF439884_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
JF439885_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP718109_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
FJ589067_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB116551_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB036910_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP718112_PreS1_P-F      gtgttttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP995114_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
DQ899147_PreS1_P-F      gtatgttaacaaccttgccagcagatccgcctcgtgcttccaccaatcgg
DQ899144_PreS1_P-F      gtatgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
DQ899145_PreS1_P-F      gtatgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
DQ899146_PreS1_P-F      gtatgttgtcaaccgtgccagcagatccgcctcctgcttccaccaatcgg
KC494399_PreS1_P-F      gtgtgttaacaaccttgccagcagaaccgcctcctgcttccaccaatcgg
KP995115_PreS1_P-F      gtgtgttaacaaccttgccagcaaatccgcctcctgcttccaccaatcgg
KP995097_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP995113_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KC494396_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KC494397_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AY090455_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP995110_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
DQ899142_PreS1_P-F      gtgtgctaacaaccttgtcagcagatccgcctcctgcttccaccaatcgg
DQ899143_PreS1_P-F      gtgtgctaacaaccttgtcagcagatccgcctcctgcttccaccaatcgg
KT896494_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP995104_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP995107_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KC494401_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KP995120_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843191_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KC494402_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
X69798_PreS1_P-F        gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KC494403_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AY311369_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KX264497_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KC494394_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KC494395_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KC494405_PreS1_P-F      gtgtgttaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ676694_PreS1_P-F      gtgttctaacaaccttgccagcaaatccgcctcctgcttccaccaatcgg
MG098584_PreS1_P-F      gtgttctaacaaccttgccagcaaatccgcctcctgcttccaccaatcgg
MG098579_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
JQ272888_PreS1_P-F      gtattctaacaaccttgccagcagatccacctcctgcttccaccaatcgg
MG098578_PreS1_P-F      gtgttctaacaacattgccagcagatccgcctcctgcttccaccaatcgg
MG098577_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
EF576808_PreS1_P-F      gtatcctaacaaccttgccagcgaatccgcctcctgcttccaccaatcgg
KY476326_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843225_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
JN688709_PreS1_P-F      gtgttctaacaaccttgccagcaaatccgcctcctgcctccaccaatcgg
AB365453_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
MG098582_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
MG098583_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcga
MG098570_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
MG098566_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
X75658_PreS1_C-F        gtgttctaacaaccttgccagcagatccgcctcctgcctccaccaatcgg
EU366132_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB365449_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
MG098573_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
MG098575_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
JN688720_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
MG098569_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
MG098565_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
MG098574_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843185_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB166850_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcctccaccaatcgg
AB365446_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AB214516_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcctccaccaatcgg
AB365450_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843223_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
DQ823089_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843226_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
JN811655_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
DQ823086_PreS1_P-F      gtgttctaacaaccttgccagcagatccacctcctgcttccaccaatcgg
KJ843209_PreS1_P-F      gtgttctaacaaccttgccagcagatccacctcctgcttccaccaatcgg
MG098564_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AF223965_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
EF576812_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
MG098580_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
AF223962_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843175_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843189_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
DQ823087_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
JN688701_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
DQ823088_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843211_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843212_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843219_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843221_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843222_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843224_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KY382411_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
FJ657528_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843220_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
JX079937_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
JN811656_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843207_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KC494398_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
FJ657519_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
DQ776247_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
EU366116_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
FJ657522_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843208_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843210_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KJ843213_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
DQ823090_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
HE981181_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
KX264499_PreS1_P-F      gtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcgg
                        *     *  * **   * **    * ** ***    *  ********** 

KJ638660_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ638662_PreS1_P-F      cggtccgggaggaag--ccaacaccartctctccacccctaagagacaca
KJ638663_PreS1_P-F      aggtcgggaagaaaa--ccaacccccgtctctccacctctaagagacact
JN792921_PreS1_P-F      cggtccgggagaaar--ccaaccccagtctctccacctctaagagacaca
KJ638664_PreS1_P-F      cggtcgggaagmcaa--c---ccctagtctctccacctctgagagacact
JN604198_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacacc
AY090456_PreS1_P-F      cggtccgggagaaaa--ccaaccccagcttcgccacctctaagggacact
JN604225_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
AY090458_PreS1_C-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagggacact
KP718104_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KP718113_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
AY090461_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
AY090459_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
JN604233_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ586807_PreS1_P-F      cggtccgggagaaaa--ccaaccccaatttctccacctctaaaagacact
JN604201_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ638657_PreS1_P-F      cggtcgggaaggaaaccccgaccctga--actcaaagtctaagagacact
KJ638656_PreS1_P-F      cggtcggggagaaaa--ccaaccccagtctctctacctctaagagacact
KP995116_PreS1_P-F      cggtcagggagaaag--cccaccccagtctctccacctctaagagacact
KP718107_PreS1_P-F      cggtcgggaagaaaa--ccaaccccagtctctccacctctaagagacacc
AB116654_PreS1_P-F      aggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KP718110_PreS1_P-F      cggtggggaagaaaa--ccaaccccagtctctccacctctaagagacact
KY476325_PreS1_P-F      aggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KY476328_PreS1_P-F      aggtccgggagaaaa--ccaaccccagtctctccacctctaagagacacg
KY476329_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KY476327_PreS1_P-F      cagtccgggagacaa--ccaaccccagtctctccacctctaagagacact
KY476324_PreS1_P-F      cggkccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KY382415_PreS1_P-F      cggtccgggagraaa--ccaaccccagtctctccacctctaagagacact
KY382416_PreS1_P-F      cggtccgggagraaa--ccaaccccagtctctccacctctaagagacact
KY382417_PreS1_P-F      cggtccgggagraaa--ccaaccccagtctctccacctctaagagacact
JN604271_PreS1_P-F      cggtccgggagaaaa--ccaaccccggtctctccacctctaagagacact
AB086397_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
FJ657525_PreS1_P-F      cgatccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KY476330_PreS1_P-F      cggtcggggagaaaa--ccaaccccagtctctccacctctaagagacact
KY476331_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
EU670262_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacact
JN792922_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
JN792916_PreS1_P-F      cgatccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM627320_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
JN792917_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KY476323_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagggacact
HM585200_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KF779236_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KC494400_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM590474_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KF199901_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585186_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM590471_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM590472_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KM233681_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ586808_PreS1_P-F      cggtccgggaaaaaa--ccaaccccagtctctccacctctaagagacact
JX079936_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843177_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843178_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
JN792918_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM622135_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585194_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
AB064316_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
JN792914_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
AF223964_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
FJ709457_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
FJ709462_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843168_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843169_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KY458062_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KM998715_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KY458061_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843194_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843181_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
DQ823092_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
DQ823093_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843164_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843180_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
FJ709464_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HQ378247_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843203_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843202_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843174_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843163_PreS1_P-F      cgatccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KC494404_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843197_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
JN792920_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
JN792919_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
FJ709460_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
EU366133_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
AY179735_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KY476332_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585195_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
FJ709459_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
FJ709458_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585191_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585198_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
AF223963_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843170_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843205_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
MK058437_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KY476322_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843204_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843193_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843179_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843167_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585197_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585193_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HE981183_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HE981182_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
FJ709465_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
FJ709463_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
AB116552_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
DQ823091_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
FJ709494_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585187_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585188_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585189_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585190_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585196_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585199_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM590473_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
JN688691_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
JN688699_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
JN688703_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843171_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843190_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843195_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843196_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843199_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843200_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KP995098_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KX264496_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
DQ823094_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
DQ823095_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
EU366118_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
FJ657529_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
HM585192_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843176_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843198_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843201_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KJ843206_PreS1_P-F      cggtccgggagaaaa--ccaaccccagtctctccacctctaagagacact
KP995118_PreS1_P-F      cggaccgggagaaag--ccaaccccagtctctccacctctaagagacaca
X75663_PreS1_P-F        ctgtccgggaggaag--ccaacccaagtctctccacctctaagagacaca
KP995105_PreS1_P-F      cggtccgagagaaag--ccaaccccagtctctccacctctaagagacaca
KP995111_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB116550_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
JN604211_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP718106_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
DQ899150_PreS1_P-F      cggaccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036913_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036920_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036919_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036916_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036917_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036918_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036915_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036914_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036905_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036909_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036911_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036912_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KX264498_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036906_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036907_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036908_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995117_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995101_PreS1_P-F      cggtccgggagaaag--ccaaccccaatctctccacctctaagagacacc
DQ899149_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP718111_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995123_PreS1_P-F      cggaccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995125_PreS1_P-F      cggaccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995106_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP718103_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
FJ589066_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AY311370_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995124_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995126_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
DQ899148_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
MH051986_PreS1_P-F      cggtccgggagaaag--ccaacccctgtctctccacctctaagagacaca
MH051987_PreS1_P-F      cggtccgggagaaag--ccaacccctgtctctccacctctaagagacaca
KP995119_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB116549_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KJ638659_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995109_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
JF439884_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
JF439885_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP718109_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
FJ589067_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB116551_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AB036910_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP718112_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995114_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
DQ899147_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctgtaagagacact
DQ899144_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctgtaagagacact
DQ899145_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacact
DQ899146_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacact
KC494399_PreS1_P-F      aggtccgggagaaag--ccaaccccggtctctccacctctaagagacaca
KP995115_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995097_PreS1_P-F      cggtccgggagaaag--ccgaccccagtctctccacctctaagagacaca
KP995113_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KC494396_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KC494397_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AY090455_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995110_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
DQ899142_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
DQ899143_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KT896494_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995104_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995107_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KC494401_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KP995120_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KJ843191_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KC494402_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
X69798_PreS1_P-F        cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KC494403_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
AY311369_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KX264497_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KC494394_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KC494395_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KC494405_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KJ676694_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
MG098584_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
MG098579_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
JQ272888_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
MG098578_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
MG098577_PreS1_P-F      crgtccaggaggaag--ccaaccccagtctctccacctctaagagacaca
EF576808_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KY476326_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843225_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacacg
JN688709_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
AB365453_PreS1_P-F      cggtccgggaggaag--cccaccccagtctctccacctctaagagacaca
MG098582_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
MG098583_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
MG098570_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
MG098566_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
X75658_PreS1_C-F        ctgtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
EU366132_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
AB365449_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
MG098573_PreS1_P-F      cagtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
MG098575_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
JN688720_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
MG098569_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
MG098565_PreS1_P-F      cagtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
MG098574_PreS1_P-F      cggtccgggaggaag--ccaactgctgtctctccacctctaagagacaca
KJ843185_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
AB166850_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
AB365446_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
AB214516_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
AB365450_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843223_PreS1_P-F      cggtccgggaggaag--ccgaccccagtctctccacctctaagagacaca
DQ823089_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843226_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
JN811655_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
DQ823086_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843209_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
MG098564_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
AF223965_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
EF576812_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacacw
MG098580_PreS1_P-F      cgatccgggaggaag--ccaaccccagtctctccacctctaagagacaca
AF223962_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843175_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
KJ843189_PreS1_P-F      cggtccgggagaaag--ccaaccccagtctctccacctctaagagacaca
DQ823087_PreS1_P-F      cggtccgggaggaag--ccaaccccagtgtctccacctctaagagacaca
JN688701_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
DQ823088_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843211_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843212_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843219_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843221_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843222_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843224_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KY382411_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
FJ657528_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843220_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
JX079937_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
JN811656_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843207_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KC494398_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
FJ657519_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
DQ776247_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
EU366116_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
FJ657522_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843208_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843210_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KJ843213_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
DQ823090_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
HE981181_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
KX264499_PreS1_P-F      cggtccgggaggaag--ccaaccccagtctctccacctctaagagacaca
                                 *   *   *   *        * * *    * *  ***** 

KJ638660_PreS1_P-F      cacccacaggccatgcagtggaacaccacccagttccaccaggctcttca
KJ638662_PreS1_P-F      catccacaggccatgcagtggaacacaacccagttccaccaggctctgtt
KJ638663_PreS1_P-F      catccacagttcatacagagcaactccactctgttccaccaggctctgtt
JN792921_PreS1_P-F      catccacaggcaatgcagtggaactcmactcagttccaccarrctctgtt
KJ638664_PreS1_P-F      catccacaggccataaagtggaagtggaacactttccaccaggctctgtt
JN604198_PreS1_P-F      catccacaggccatgcaatggaactcaatccagttccaccagg-------
AY090456_PreS1_P-F      catccccaggccatgcagtggaactcaagtcagttccaccaggctctgtt
JN604225_PreS1_P-F      catccacaggccatgcagtggaactcaactcagttccaccaggctctgtt
AY090458_PreS1_C-F      catccccaggccatgcagtggaactcaactcagttccaccaggctctgtt
KP718104_PreS1_P-F      catccacaggccatgcagtggaactcaactcagttccaccaggctctgtt
KP718113_PreS1_P-F      catccacaggccatgcagtggaactcaactcagttccaccaggctctgtt
AY090461_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AY090459_PreS1_P-F      catccacaggcaatgcagtggaactcaactcagttccaccaggctctgtt
JN604233_PreS1_P-F      catccacaggccatgcagtggaactcaactcagttccaccaggctctgtt
KJ586807_PreS1_P-F      catccacagggcatggcgtggaactcccctcaattccaccagggtctgtt
JN604201_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ638657_PreS1_P-F      catccacaggccatgcagaggaactccactcagttccaccaggctctgtt
KJ638656_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KP995116_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KP718107_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccatcaggctctgtt
AB116654_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KP718110_PreS1_P-F      catccacaggccatgcagtggaactccaatcagttccaccaggctctgtt
KY476325_PreS1_P-F      catccacaggccatgcaatggaactccactcagtttcaccaggctctgtt
KY476328_PreS1_P-F      catccacaggccatgcagtggaactccactcagtttcaccaggctctgtt
KY476329_PreS1_P-F      catccacaggccacacagtggaacacccctcagttccaccaggctctgtt
KY476327_PreS1_P-F      catccacaggccgtgcagtggaactccactcagttccaccaggctctgtt
KY476324_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KY382415_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KY382416_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KY382417_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
JN604271_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
AB086397_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggmtctgtt
FJ657525_PreS1_P-F      catccacaggccatgcagtggaactcaactcagttccaccaggctctgtt
KY476330_PreS1_P-F      catccacaggccatgcagtggaattccactcagttccaccaggctctgtt
KY476331_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
EU670262_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccatcaggctctgtt
JN792922_PreS1_P-F      catccacaggccgtgcagtggaactccactcagttccaccagactctgtt
JN792916_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM627320_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgty
JN792917_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccagactctgtt
KY476323_PreS1_P-F      catccacaggccatgcagtggaactccactcagtttcaccaggctctgtt
HM585200_PreS1_P-F      catccacaggccatgcagtggaactccactctgttccaccaggctctgtt
KF779236_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KC494400_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM590474_PreS1_P-F      catccacaggccatgcagtggaattccactcagtttcaccaggctctgtt
KF199901_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM585186_PreS1_P-F      catccacaggccatgcagtggaattccactcagtttcaccaggctctgtt
HM590471_PreS1_P-F      catccacaggccatgcagtggaattccactcagtttcaccaggctctgtt
HM590472_PreS1_P-F      catccacaggccatgcagtggaattccactcagtttcaccaggctctgtt
KM233681_PreS1_P-F      catccacaggccatgcagtggaattccactcagtttcaccaggctctgtt
KJ586808_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
JX079936_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843177_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843178_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
JN792918_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM622135_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM585194_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
AB064316_PreS1_P-F      catccacaggccatgcagtggaattccactcagttccaccagactctgtt
JN792914_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
AF223964_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
FJ709457_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccagactctgtt
FJ709462_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843168_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccagactctgtt
KJ843169_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccagactctgtt
KY458062_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KM998715_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KY458061_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843194_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccagactctgtt
KJ843181_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
DQ823092_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
DQ823093_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843164_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843180_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
FJ709464_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HQ378247_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843203_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843202_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccagactctgtt
KJ843174_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccacgctctgtt
KJ843163_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KC494404_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843197_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
JN792920_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
JN792919_PreS1_P-F      catccacaggccatgcaatggaactccactcagttccaccaggctctgtt
FJ709460_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccagactctgtt
EU366133_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
AY179735_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KY476332_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccatcaggctctgtt
HM585195_PreS1_P-F      catccacaggccatgcagtggaacgccactcagttccaccaggctctgtt
FJ709459_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
FJ709458_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM585191_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM585198_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
AF223963_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843170_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843205_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
MK058437_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KY476322_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843204_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843193_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843179_PreS1_P-F      catccacaggccatgcagtggaattccactcagttccaccaggctctgtt
KJ843167_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM585197_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM585193_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HE981183_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HE981182_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
FJ709465_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
FJ709463_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
AB116552_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
DQ823091_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
FJ709494_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM585187_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM585188_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM585189_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM585190_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM585196_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM585199_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM590473_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
JN688691_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
JN688699_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
JN688703_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843171_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843190_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843195_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843196_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843199_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843200_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KP995098_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KX264496_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
DQ823094_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
DQ823095_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
EU366118_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
FJ657529_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
HM585192_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843176_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843198_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843201_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KJ843206_PreS1_P-F      catccacaggccatgcagtggaactccactcagttccaccaggctctgtt
KP995118_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
X75663_PreS1_P-F        catcctcaggccatgcagtggaactcaactcacttccaccaagctctgtt
KP995105_PreS1_P-F      catccacaggcaatacagtggaactcaacccagttccaccaggctctgtt
KP995111_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB116550_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
JN604211_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
KP718106_PreS1_P-F      catccrcaggccrtgcagtggaactcaacccagttccaccaggctctgct
DQ899150_PreS1_P-F      catccccaggccgtgcagtggaactcaacccagttccaccaggctctgtt
AB036913_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036920_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036919_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036916_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036917_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036918_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036915_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036914_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036905_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036909_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036911_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036912_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
KX264498_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036906_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036907_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB036908_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
KP995117_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
KP995101_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
DQ899149_PreS1_P-F      catccacaggccatgcagtggaactcaactcagttccaccaggctctgtt
KP718111_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
KP995123_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
KP995125_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
KP995106_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
KP718103_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
FJ589066_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AY311370_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
KP995124_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccatcaggctctgtt
KP995126_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccatcaggctctgtt
DQ899148_PreS1_P-F      cacccacaggccatgcagtggaactcaacccagttccaccaggctctgtc
MH051986_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
MH051987_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
KP995119_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
AB116549_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
KJ638659_PreS1_P-F      catccacaggccatrcagtggaactcaacccagttccaccaggctctgtt
KP995109_PreS1_P-F      catccacaggccatgcaatggaattcaactcagttccaccaggctctgtt
JF439884_PreS1_P-F      catccacaggccatgcagtggaactcaactcagttccaccaggctctgtt
JF439885_PreS1_P-F      catccacaggccatgcagtggaactcaactcagttccaccaggctctgtt
KP718109_PreS1_P-F      catccacaggccatgcagtggaactcaactcagttccaccaggctctgtt
FJ589067_PreS1_P-F      catccacaggccatgcagtggaactcaactcagttccaccaggctctgtt
AB116551_PreS1_P-F      catccacaggccatgcagtggaattcaactcagttccaccaggctctgtt
AB036910_PreS1_P-F      catccacaggccatgcagtggaactcaactcagttccaccaggctctgtt
KP718112_PreS1_P-F      catccacaggccatgcagtggaactcaactcagttccaccaggctctgtt
KP995114_PreS1_P-F      catccacaggcaatgcaatggaactcaagcaagttccaccagcatctgtt
DQ899147_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
DQ899144_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
DQ899145_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
DQ899146_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
KC494399_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
KP995115_PreS1_P-F      catccacaggcgatgcagtggaactcaacccagttccaccaggctctgtt
KP995097_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggctctgtt
KP995113_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
KC494396_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
KC494397_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaagctctgtt
AY090455_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
KP995110_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
DQ899142_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
DQ899143_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
KT896494_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaacttctgtt
KP995104_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
KP995107_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
KC494401_PreS1_P-F      catccacaggcgatgcagtggaactcaacccagttccaccaggctctgtt
KP995120_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
KJ843191_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
KC494402_PreS1_P-F      catccacaggcgatgcagtggaactcaacccagttccaccaggctctgtt
X69798_PreS1_P-F        catccacaggcaatgcagtggaactcaacccagttccaccaagctctgtt
KC494403_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaagctctgtt
AY311369_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
KX264497_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
KC494394_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaagctctgtt
KC494395_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaagctctgtt
KC494405_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaagctctgtt
KJ676694_PreS1_P-F      catccacaggccrtgcagaacaactcaacccagtttcaccaggccctgtt
MG098584_PreS1_P-F      catccacaggccatgcagtggaactcaacccagttccaccaggccctgtt
MG098579_PreS1_P-F      catccacaggcaatgcaatggaactcaacccagttccaccatgccctgtt
JQ272888_PreS1_P-F      catccacaggcagtaaagtggaactcagccaagttccaccaggccttgtt
MG098578_PreS1_P-F      catccacaggcaatgcagtggaactcatccgagttccaccaggccctgtt
MG098577_PreS1_P-F      catccacaggcaatgcwgtggaactcaatccagttccaccgggccttgtt
EF576808_PreS1_P-F      catccacaggcaatgcaatggaactccacccagttccaccaggccttgtt
KY476326_PreS1_P-F      catccacaggcaatgcaatggaactcatcccagttccaccaggccctgtt
KJ843225_PreS1_P-F      catccacaggcaatgcaatggaactcaatccagttccaccaggccctgtt
JN688709_PreS1_P-F      catccacaggcaatgcaatggaactcaacccagttccactcaacccagtt
AB365453_PreS1_P-F      catccacaggcaatgcaatggaactcatcccagttccatcaggccttgtt
MG098582_PreS1_P-F      catccacaggcaatgcagtggaactcatccgagttccaccaggccctgtt
MG098583_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccttgtt
MG098570_PreS1_P-F      catccacaggcaatgcaatggaactcaacccagttccaccaggccctgtt
MG098566_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
X75658_PreS1_C-F        catccacaggcaatgcagtggaactcaactcacttccaccaggctctgtt
EU366132_PreS1_P-F      catccacaggcaatgcagtggacctcaacccagttccaccaggccctgtt
AB365449_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccatcaggccttgtt
MG098573_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccttgtt
MG098575_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccttgtt
JN688720_PreS1_P-F      catccacaggcaatgcaatggaactcaacccagttccaccaggccctgtt
MG098569_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccttgtt
MG098565_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccttgtt
MG098574_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843185_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccttgtt
AB166850_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
AB365446_PreS1_P-F      catccacaggcaatgcaatggaactcaacccagttccatcaggccttgtt
AB214516_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
AB365450_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccatcaggccttgtt
KJ843223_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
DQ823089_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggtcctgtt
KJ843226_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
JN811655_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggctctgtt
DQ823086_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccttgtt
KJ843209_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccttgtt
MG098564_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
AF223965_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccttgtt
EF576812_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccttgtt
MG098580_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
AF223962_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843175_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843189_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
DQ823087_PreS1_P-F      catccacaggcaatgcagtggaactcagccaagttccaccaggccctgtt
JN688701_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
DQ823088_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843211_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843212_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843219_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843221_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843222_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843224_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KY382411_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
FJ657528_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843220_PreS1_P-F      catccacatgcaatgcagtggaactcaacccagttccaccaggccctgtt
JX079937_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
JN811656_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843207_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KC494398_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
FJ657519_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
DQ776247_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
EU366116_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
FJ657522_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843208_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843210_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KJ843213_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
DQ823090_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
HE981181_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
KX264499_PreS1_P-F      catccacaggcaatgcagtggaactcaacccagttccaccaggccctgtt
                        ** ** **             *           ** **            

KJ638660_PreS1_P-F      agatcccagagtcagggccctgttgagtcctgctggtggctccagttcag
KJ638662_PreS1_P-F      ggatccaarggtaagggctctgtattttcctgctggtggctccagttcag
KJ638663_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JN792921_PreS1_P-F      aratccsagggtaagggctctgtayttycctgctggtggctccagttcag
KJ638664_PreS1_P-F      agatccgaaggtaagggctctgtattttcctgctggtggctccagttcag
JN604198_PreS1_P-F      --------gggtagagactctgtatcgtcctgctggtggctccagttcag
AY090456_PreS1_P-F      agatccgagggtgagg------------cctgctggtggctccagttcag
JN604225_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AY090458_PreS1_C-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP718104_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP718113_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AY090461_PreS1_P-F      agatccgagggtaagggctctgtactttcctgctggtggctccagttcag
AY090459_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JN604233_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ586807_PreS1_P-F      aattcccagggtaaagggtctcctgctggttgctggtgggtccagttcca
JN604201_PreS1_P-F      acatccgacggtaagggctcagt------ctgctggtggctccagttcag
KJ638657_PreS1_P-F      agatccgagggtaagggctctgtgtgttcctgctggtggctccagttcag
KJ638656_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP995116_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP718107_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB116654_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctgggggctccagttcag
KP718110_PreS1_P-F      agatccgagggtaagggctctgtatcttcctgctggtggctccagttcag
KY476325_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KY476328_PreS1_P-F      agatccaagggtaagggctctgtattttcctgctggtggctccagttcag
KY476329_PreS1_P-F      agatccgagggtaagggctctgtgttttcctgctggtggctccagttcag
KY476327_PreS1_P-F      agatccgagggtaagagctctgtattttcctgctggtggctccagttcag
KY476324_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KY382415_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KY382416_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KY382417_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JN604271_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB086397_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
FJ657525_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KY476330_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KY476331_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
EU670262_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctagtggctccagttcag
JN792922_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JN792916_PreS1_P-F      agatccgagggtaagggctc---------ctgctggtggctccagttcag
HM627320_PreS1_P-F      agatccgagggtaagggmyctgtatttkcctgctggtggctccagttcag
JN792917_PreS1_P-F      agatccgagggtaagggatctgtatcttcctgctggtggctccagttcag
KY476323_PreS1_P-F      agctccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM585200_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KF779236_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KC494400_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM590474_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KF199901_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctgggtgctccagttcag
HM585186_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM590471_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM590472_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KM233681_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ586808_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JX079936_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KJ843177_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KJ843178_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
JN792918_PreS1_P-F      agatccgagggtaagggatctgtattttcctgctggtggctccagttcag
HM622135_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM585194_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB064316_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JN792914_PreS1_P-F      agatccgagggtaagggctctgt------ctgctggtggctccagttcag
AF223964_PreS1_P-F      agatccgagggtaagggctctgtattttcatgctggtggctccagttcag
FJ709457_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
FJ709462_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KJ843168_PreS1_P-F      agatccgagagtaaggg------------ctgctggtggctccagttcag
KJ843169_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KY458062_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KM998715_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KY458061_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843194_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843181_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
DQ823092_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
DQ823093_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843164_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843180_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
FJ709464_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HQ378247_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843203_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KJ843202_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843174_PreS1_P-F      agatcccagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843163_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KC494404_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843197_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JN792920_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JN792919_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
FJ709460_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
EU366133_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AY179735_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KY476332_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM585195_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
FJ709459_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
FJ709458_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM585191_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM585198_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AF223963_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843170_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843205_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
MK058437_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KY476322_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843204_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KJ843193_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KJ843179_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KJ843167_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM585197_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
HM585193_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
HE981183_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HE981182_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
FJ709465_PreS1_P-F      agatccgagggtaaggactctgtattttcctgctggtggctccagttcag
FJ709463_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
AB116552_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
DQ823091_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
FJ709494_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM585187_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM585188_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM585189_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM585190_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM585196_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM585199_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HM590473_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JN688691_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JN688699_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JN688703_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843171_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843190_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843195_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843196_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843199_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843200_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP995098_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KX264496_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
DQ823094_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
DQ823095_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
EU366118_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
FJ657529_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
HM585192_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KJ843176_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KJ843198_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KJ843201_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KJ843206_PreS1_P-F      agatccgagagtaagggctctgtattttcctgctggtggctccagttcag
KP995118_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
X75663_PreS1_P-F        ggatcccagggtaagggcactgtattttcctgctggtggctccagttcag
KP995105_PreS1_P-F      agatccgagggtaagggctctgtatcttcctgctggtggctccagttcag
KP995111_PreS1_P-F      agatccgaaggtaacggctctgtattttcctgctggtggctccagttcag
AB116550_PreS1_P-F      ggatccgaagggtaaggctttgtattttcctgctggtggctccagttcag
JN604211_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP718106_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
DQ899150_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036913_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036920_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036919_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036916_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036917_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036918_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036915_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036914_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036905_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036909_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036911_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036912_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KX264498_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036906_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036907_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036908_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP995117_PreS1_P-F      aaatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP995101_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagtccag
DQ899149_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP718111_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP995123_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP995125_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP995106_PreS1_P-F      agatccgcgggtaagggctctgtatcttcctgctggtggctccagttcag
KP718103_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
FJ589066_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AY311370_PreS1_P-F      agatccgagggtaagggctctgtatcttcctgctggtggctccagttcag
KP995124_PreS1_P-F      agatccgagggtaagggctctgtatcttcctgctggtggctccagttcag
KP995126_PreS1_P-F      agatccgagggtaagggctctgtatcttcctgctggtggctccagttcag
DQ899148_PreS1_P-F      agatccgagggtaagggctctgtatcttcctgctggtggctccagttcag
MH051986_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
MH051987_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP995119_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB116549_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ638659_PreS1_P-F      agatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP995109_PreS1_P-F      ggatccgagggtaagggctctgtcttttcctgctggtggctccagttcag
JF439884_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JF439885_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP718109_PreS1_P-F      ggatccgagggtaagggctctgtattctcctgctggtggctccagttcag
FJ589067_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB116551_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AB036910_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP718112_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KP995114_PreS1_P-F      ggaacccggggtaagggctctgtgtctccctgctggtggctccagttcag
DQ899147_PreS1_P-F      ggatcccagggtaagggctctgtatcttcctgctggtggctccagttcaa
DQ899144_PreS1_P-F      ggatcccagggtaaaggctctgtattttcctgctggtggctccagttcag
DQ899145_PreS1_P-F      ggatcccagggtaagggctctgtattttcctgctggtggctccagttcag
DQ899146_PreS1_P-F      ggatcccagggtaaaggctctgtattttcctgctggtggctccagttcag
KC494399_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KP995115_PreS1_P-F      ggatcccagggtaagggctctgtatttccctgctggtggctccagttcag
KP995097_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KP995113_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KC494396_PreS1_P-F      ggatcccagggtatgggctctgtactttcctgctggtggctccagttcag
KC494397_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
AY090455_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KP995110_PreS1_P-F      ggatcccagggtgagggctctgtacttccctgctggtggctccagttcag
DQ899142_PreS1_P-F      ggatcccatggtaagggctctgtatttccctgctggtggctccagttcag
DQ899143_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KT896494_PreS1_P-F      ggatcccagggtaagggctctgtgcttccctgctggtggctccagttcag
KP995104_PreS1_P-F      ggatcccagggtaagggctctgtacctccctgctggtggctccagttcag
KP995107_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KC494401_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KP995120_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KJ843191_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KC494402_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
X69798_PreS1_P-F        ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KC494403_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
AY311369_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KX264497_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KC494394_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KC494395_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KC494405_PreS1_P-F      ggatcccagggtaagggctctgtacttccctgctggtggctccagttcag
KJ676694_PreS1_P-F      agacccaagggtaagggctctgtattttcctgctggtggctccagttcag
MG098584_PreS1_P-F      agacccaagggtaagggctctgtattttcctgctggtggctccagttcag
MG098579_PreS1_P-F      ggatccgagggtagcggc---------tcctgctggtgcatacagttcag
JQ272888_PreS1_P-F      ggatccgagggtaagggctctgtatcttcctgctggtggctccagttcag
MG098578_PreS1_P-F      ggatccgagggtaagggctctgtatcttcctgctggtggctccacttcaa
MG098577_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
EF576808_PreS1_P-F      ggatccgagggtaaggggtctgtatcttcctgctggtggctccagttcag
KY476326_PreS1_P-F      ggatccgagggtaagggctctgtatyttcctgctggtggctccagttcag
KJ843225_PreS1_P-F      ggatcagagggtaaggactctgtgtcttcctgctggtggctccagttcag
JN688709_PreS1_P-F      ggatccgagggtaagggctctgtatyttcctgctggtggctccagttcag
AB365453_PreS1_P-F      ggatccgagggtaagggctctgtatcttcctgctggtggctccagttcag
MG098582_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
MG098583_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
MG098570_PreS1_P-F      gcatccgggggtaagggctctgtatcttcctgctggtggctccagttcag
MG098566_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
X75658_PreS1_C-F        ggatccgagggtaagggcactgtattttcctgctggtggctccagttcag
EU366132_PreS1_P-F      ggatccgagggtaagggctctgtatcttyctgctggtggctccagttcag
AB365449_PreS1_P-F      ggatccgagggtaagggctctgtatcttcctgctggtggctccagttcag
MG098573_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
MG098575_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JN688720_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
MG098569_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
MG098565_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
MG098574_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843185_PreS1_P-F      ggatccgagggtaagggctctgtatcttcctgctggtggctccagttcag
AB166850_PreS1_P-F      ggatccgagggtaagggctctgtctcctcctgctggtggctccagttcag
AB365446_PreS1_P-F      ggatccgagggtaagggctctgtatcttcctgctggtggctccagttcag
AB214516_PreS1_P-F      ggatccgagggtaagggctctgtctcctcctgctggtggctccagttcag
AB365450_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843223_PreS1_P-F      ggatccgagggtaaaggctctgtattttcctgctggtggctccagttcag
DQ823089_PreS1_P-F      ggatccgagggtaaaggctctgtattatcctgctggtggctccagttcag
KJ843226_PreS1_P-F      ggatccgagagtaagggctctgtattttcctgctggtggctccagttcag
JN811655_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
DQ823086_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843209_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
MG098564_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AF223965_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
EF576812_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
MG098580_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
AF223962_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843175_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843189_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
DQ823087_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JN688701_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
DQ823088_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843211_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843212_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843219_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843221_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843222_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843224_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KY382411_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
FJ657528_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843220_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JX079937_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
JN811656_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843207_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KC494398_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
FJ657519_PreS1_P-F      ggatccgagggtawgggctctgtattttcctgctggtggctccagttcag
DQ776247_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
EU366116_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
FJ657522_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843208_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843210_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KJ843213_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
DQ823090_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
HE981181_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
KX264499_PreS1_P-F      ggatccgagggtaagggctctgtattttcctgctggtggctccagttcag
                                  *                   **** *    * ** * *  

KJ638660_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ638662_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ638663_PreS1_P-F      agacacagaaccctgctccgactattgcctctcgcacatcatcaatctcc
JN792921_PreS1_P-F      rgacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ638664_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN604198_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AY090456_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN604225_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AY090458_PreS1_C-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP718104_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP718113_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AY090461_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AY090459_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN604233_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ586807_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN604201_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ638657_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ638656_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995116_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP718107_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB116654_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP718110_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaaccttc
KY476325_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KY476328_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KY476329_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KY476327_PreS1_P-F      agacacagcaccctgctccgattattgcctctctcacatcatcaatcttc
KY476324_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KY382415_PreS1_P-F      agacacagaaccctgctccgactattgccyctctcacatcatcaatcttc
KY382416_PreS1_P-F      agacacagaaccctgctccgactattgccyctctcacatcatcaatcttc
KY382417_PreS1_P-F      agacacagaaccctgctccgactattgccyctctcacatcatcaatcttc
JN604271_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaagcttc
AB086397_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ657525_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KY476330_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KY476331_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
EU670262_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN792922_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN792916_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM627320_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN792917_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KY476323_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585200_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KF779236_PreS1_P-F      gaacagtaaaccctgctccgactattgcctctctcacatcatcaatcttc
KC494400_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM590474_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KF199901_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585186_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM590471_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM590472_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KM233681_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ586808_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JX079936_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843177_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843178_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN792918_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM622135_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585194_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB064316_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN792914_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AF223964_PreS1_P-F      gcacgcagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ709457_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ709462_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843168_PreS1_P-F      agacacagaaccctgctccgactattgtctctctcacatcatcaatcttc
KJ843169_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KY458062_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KM998715_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KY458061_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843194_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843181_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
DQ823092_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
DQ823093_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843164_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843180_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ709464_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HQ378247_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843203_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843202_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843174_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843163_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KC494404_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843197_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN792920_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN792919_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ709460_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
EU366133_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AY179735_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KY476332_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585195_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ709459_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ709458_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585191_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585198_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AF223963_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843170_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843205_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
MK058437_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KY476322_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843204_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843193_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843179_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843167_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585197_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585193_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HE981183_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HE981182_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ709465_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ709463_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB116552_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
DQ823091_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ709494_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585187_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585188_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585189_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585190_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585196_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585199_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM590473_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN688691_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN688699_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JN688703_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843171_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843190_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843195_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843196_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843199_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843200_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995098_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KX264496_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
DQ823094_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
DQ823095_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
EU366118_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ657529_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
HM585192_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843176_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843198_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843201_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ843206_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995118_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
X75663_PreS1_P-F        gaacacagaaccctgctccgactattgcctctctcacatcatcaatctcc
KP995105_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995111_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB116550_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaaccttc
JN604211_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP718106_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
DQ899150_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB036913_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036920_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036919_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036916_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036917_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036918_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036915_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036914_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036905_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036909_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036911_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036912_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
KX264498_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036906_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036907_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
AB036908_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
KP995117_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaaccttc
KP995101_PreS1_P-F      gaacacaaaaccctgttccgactattgcctctctcacatcatcaatcttc
DQ899149_PreS1_P-F      ggacacagaaccctgttccgactattgcctctctcacatcatcaatcttc
KP718111_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995123_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995125_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995106_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP718103_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcgtcaatcttc
FJ589066_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AY311370_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995124_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995126_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
DQ899148_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
MH051986_PreS1_P-F      ggacgcagaaccctgctccgactattgcctctctcacatcatcaatcttc
MH051987_PreS1_P-F      ggacgcagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995119_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB116549_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KJ638659_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995109_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
JF439884_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatctcc
JF439885_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatctcc
KP718109_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
FJ589067_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB116551_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AB036910_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaaccttc
KP718112_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995114_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
DQ899147_PreS1_P-F      ggacacaaaaccctgctccgactattgcctctctcacatcatcaatctac
DQ899144_PreS1_P-F      gaacacaaaaccctgctccgactattgcctctctcacatcatcaatctac
DQ899145_PreS1_P-F      gaacacaaaaccctgctccgactattgcctctctcacatcatcaatctac
DQ899146_PreS1_P-F      gaacacaaaaccctgctccgactattgcctctctcacatcatcaatctac
KC494399_PreS1_P-F      gaacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995115_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995097_PreS1_P-F      ggacacagaaccctgctccgactattgcctctcttacatcatcaatcttc
KP995113_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KC494396_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttt
KC494397_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
AY090455_PreS1_P-F      ggacacagaaccctgctccgactattgcctctcttacatcatcaatcttc
KP995110_PreS1_P-F      ggacacaaaaccctgctccgactattgcctctctcacatcatcaatcttc
DQ899142_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatctcc
DQ899143_PreS1_P-F      agacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KT896494_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995104_PreS1_P-F      ggacacaaaaccctgctccgactattgcctctctcacatcatcaatcttc
KP995107_PreS1_P-F      ggacacagaaccctgctccgactattgcctctctcacatcatcaatcttc
KC494401