HBVdb

Dataset for nucleotide sequence PreC of genotype F

[Download (right click)] [Edit] [Sequences] [Repertoires]

283 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


JN792921_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
MG098582_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ638660_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
MG098584_PreC_P-F      atgcaactttttcacctctgcctaatcatcacttgttcatgtcctactgt
KJ638662_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AB365453_PreC_P-F      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttt
MG098569_PreC_P-F      atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
JQ272888_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ676694_PreC_P-F      atgcaactttttcacctctgcctaatcnncttttgttcatgtcctactgt
MG098575_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
MG098583_PreC_P-F      acgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
MG098574_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN688709_PreC_P-F      atgcaactttttcacctctgcctaatcatctyttgttcatgtcctactgt
EU366132_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
MG098566_PreC_P-F      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MG098579_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
X75658_PreC_C-F        atgcaactttttcacctctgcctaatcatctcttgtttatgtcccactgt
MG098570_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN688720_PreC_P-F      atgcaactttttcacctctgcctaatcatctgttgttcatgtcctactgt
EF576808_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AB365450_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
MG098577_PreC_P-F      atgcaactttttcacctctgcctaatcatcctttgttcatgtcctactgt
MG098580_PreC_P-F      atgcaactttttcacctctgcctaatcatcacttgttcatgtcctactgt
MG098573_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY476326_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AB166850_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AB214516_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
MG098578_PreC_P-F      ctgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN688701_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
MG098565_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AB365446_PreC_P-F      agtcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AB365449_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843226_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843225_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
MG098564_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
DQ823087_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KC494398_PreC_P-F      atgcaactttttcacctctgcctaatcacttttgtttcatgtcctactgt
KJ843212_PreC_P-F      atgcaactttctcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843210_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843209_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JX079937_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ657519_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HQ420165_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HQ420166_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
DQ823088_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ657528_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN811655_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN811656_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843211_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843219_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843221_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843222_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843224_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY382411_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AF223965_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
EF576812_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843185_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AF223962_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
DQ776247_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
DQ823089_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
DQ823090_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
EU366116_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ657522_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HE981181_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843175_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843189_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843207_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843208_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843213_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843220_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843223_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KX264499_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
DQ823086_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KP995115_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP995097_PreC_P-F      atgcaactttttgacctctgcctaatcatcttttgttcatgtcccactgt
KP995113_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP995114_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KC494399_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
DQ899146_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
DQ899144_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
DQ899147_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
DQ899145_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KC494396_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KT896494_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtctcactgt
KP995107_PreC_P-F      atgcaactttttcacctctgcctaatcatctcttgttcatgtctcactgt
AY254498_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgtgcatgtcccactgt
KP995104_PreC_P-F      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
AY090455_PreC_P-F      atgcaactttttcacctctgcctaatcatttcttgttcatgtcccactgt
KJ843191_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KC494405_PreC_P-F      atgcacctttttcacctctgcctaatcattttttgttcatgtcccactgt
KC494401_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KC494395_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KX264497_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KC494403_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KC494394_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KC494402_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
X69798_PreC_P-F        atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KC494397_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AY311369_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP995110_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
DQ899142_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
DQ899143_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP995120_PreC_P-F      atgctactttttcacctctgcctaatcatcttttgttcatgtcccactgt
FJ589066_PreC_P-F      nnnnnnctttttcacctctgcctaatcatcttttgttcatgtcctactgt
KP995101_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB116550_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP718106_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
X75663_PreC_P-F        atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
KP995111_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
FJ589067_PreC_P-F      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
KP995105_PreC_P-F      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
KP995106_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP995119_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP995109_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP995118_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
DQ899148_PreC_P-F      atgcaacattttcacctctgcctaatcatcttttgttcatgtcccactgt
KP995117_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP718103_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
DQ899149_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AY311370_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
DQ899150_PreC_P-F      atggaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036920_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036911_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036914_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036915_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036916_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036917_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036919_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036905_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036906_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036907_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036909_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036912_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036913_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KX264498_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036908_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KJ638659_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP995123_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP995125_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB116549_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
MH051986_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
MH051987_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP995124_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP995126_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB116551_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP718109_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP718112_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
AB036910_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KP718111_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KJ638663_PreC_P-F      atgtaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY476329_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY476330_PreC_P-F      atgcaactttttcacctctgcctagtcatcttttgttcatgtcctactgt
KX757665_PreC_P-F      atgcaactttttsacctctgcctaatcatcttttgttcatgtcctactgt
AB116654_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ657525_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY476328_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AB086397_PreC_P-F      ctgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ638664_PreC_P-F      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KP718110_PreC_P-F      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KY476325_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ638656_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KP718107_PreC_P-F      atgcaactttttaacctctgcctaatcatcttttgttcatgtcctactgt
KJ638657_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY476324_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ589065_PreC_P-F      atgcttctttttcacctctgcctaatcatcttttgttcatgtcctactgt
AY090459_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JX899376_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AY090458_PreC_C-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AY090461_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KP718104_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KP718113_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY476327_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM627320_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AF223963_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ586805_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN792916_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
EU185743_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843195_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843167_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KC494400_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843190_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcgtgtcctactgt
KJ843193_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843202_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KC494404_PreC_P-F      atgcaactttttcacctctgcctaatcattttttgttcatgtcctactgt
HM622135_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
EU185744_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY382415_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY382416_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY382417_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN688699_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843199_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KP995116_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KP995098_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgt
KJ843198_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843194_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843181_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843176_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843174_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843169_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843168_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843163_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ586808_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ586806_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585193_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
EU366133_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
DQ823091_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585188_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM590473_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ709494_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585190_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ709465_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
MK058437_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ709458_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ709459_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585191_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585195_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585198_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
EU366118_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ657529_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843201_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843203_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843206_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
DQ823092_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
DQ823093_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ709460_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ709464_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HQ378247_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843164_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843180_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KM998715_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY458061_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY458062_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AB116552_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AF223964_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AY179735_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
DQ823094_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
DQ823095_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ709457_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ709462_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
FJ709463_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HE981182_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585187_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585189_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585192_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585196_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585197_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585199_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN688691_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN688703_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KF199901_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ586807_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843170_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843171_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843179_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843196_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843197_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843200_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843204_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843205_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KX264496_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AB064316_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN792919_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY476331_PreC_P-F      atgcaactttttcacctctgcctagtcatcttttgttcatgtcctactgt
JN792920_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN792917_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
EU670262_PreC_P-F      atgtaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN792918_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY476332_PreC_P-F      atgcaactttttcacctctgcctagtcatcttttgttcatgtcctactgt
KY476323_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JX079936_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN792914_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585194_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
EU670261_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM590474_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgc
HM585186_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM590471_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM590472_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KM233681_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
HM585200_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
JN792922_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843177_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KJ843178_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
KY476322_PreC_P-F      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
                             * ** * *********** **     *  *   ****  ***  

JN792921_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacc
MG098582_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ638660_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttrgggcatggacatygacc
MG098584_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KJ638662_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AB365453_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
MG098569_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
JQ272888_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ676694_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
MG098575_PreC_P-F      tcaagcctccaanctgtgccttgggtggctttagggcatggacattgacc
MG098583_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MG098574_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JN688709_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
EU366132_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
MG098566_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
MG098579_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttaggrcatggacatygacc
X75658_PreC_C-F        tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MG098570_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
JN688720_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
EF576808_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AB365450_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
MG098577_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
MG098580_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
MG098573_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KY476326_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AB166850_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AB214516_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
MG098578_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JN688701_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
MG098565_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AB365446_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB365449_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KJ843226_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843225_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MG098564_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ823087_PreC_P-F      tcaagcctccaagctgtgccttgggtgcctttggggcatggacattgacc
KC494398_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843212_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843210_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843209_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacc
JX079937_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ657519_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HQ420165_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HQ420166_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ823088_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ657528_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JN811655_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JN811656_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843211_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843219_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843221_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843222_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843224_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KY382411_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF223965_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
EF576812_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843185_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF223962_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ776247_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ823089_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ823090_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
EU366116_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ657522_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HE981181_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843175_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843189_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843207_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843208_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843213_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843220_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843223_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KX264499_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ823086_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995115_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995097_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995113_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995114_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
KC494399_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ899146_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ899144_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ899147_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ899145_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KC494396_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KT896494_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttgrggcatggacattgacc
KP995107_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttgaggcatggacattgacc
AY254498_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995104_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
AY090455_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843191_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KC494405_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KC494401_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KC494395_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KX264497_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KC494403_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KC494394_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KC494402_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
X69798_PreC_P-F        tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KC494397_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY311369_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995110_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ899142_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ899143_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995120_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ589066_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KP995101_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB116550_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP718106_PreC_P-F      tcaagcctycaagctgtgccttgggtggctttgggacatggacattgacc
X75663_PreC_P-F        tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995111_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ589067_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995105_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995106_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995119_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995109_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995118_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ899148_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995117_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP718103_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ899149_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY311370_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacc
DQ899150_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036920_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036911_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036914_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036915_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036916_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036917_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036919_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036905_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036906_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036907_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036909_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036912_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036913_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KX264498_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036908_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ638659_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995123_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995125_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB116549_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH051986_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH051987_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995124_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995126_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB116551_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP718109_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP718112_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB036910_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP718111_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ638663_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KY476329_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KY476330_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KX757665_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB116654_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
FJ657525_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KY476328_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AB086397_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KJ638664_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KP718110_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KY476325_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KJ638656_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KP718107_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KJ638657_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttgggrcatggacattgacc
KY476324_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
FJ589065_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY090459_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JX899376_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY090458_PreC_C-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY090461_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP718104_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP718113_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KY476327_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
HM627320_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF223963_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ586805_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JN792916_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
EU185743_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843195_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843167_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KC494400_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843190_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843193_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843202_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KC494404_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM622135_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
EU185744_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KY382415_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KY382416_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KY382417_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JN688699_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843199_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995116_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KP995098_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843198_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843194_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843181_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843176_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843174_PreC_P-F      tcaagcctccaagctgtgccttggggggctttggggcatggacattgacc
KJ843169_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843168_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843163_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ586808_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ586806_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585193_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
EU366133_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ823091_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585188_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM590473_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ709494_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585190_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ709465_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MK058437_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ709458_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ709459_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585191_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585195_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585198_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
EU366118_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ657529_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843201_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843203_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843206_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ823092_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ823093_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ709460_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ709464_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HQ378247_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843164_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843180_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KM998715_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KY458061_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KY458062_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB116552_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF223964_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY179735_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ823094_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ823095_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ709457_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ709462_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ709463_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HE981182_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585187_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585189_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585192_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585196_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585197_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585199_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JN688691_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JN688703_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF199901_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ586807_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843170_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843171_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843179_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843196_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843197_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843200_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843204_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843205_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KX264496_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB064316_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
JN792919_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
KY476331_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JN792920_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JN792917_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
EU670262_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JN792918_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KY476332_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KY476323_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
JX079936_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JN792914_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585194_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
EU670261_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM590474_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585186_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM590471_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM590472_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KM233681_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM585200_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JN792922_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843177_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KJ843178_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KY476322_PreC_P-F      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
                       ******** *** ************ * ****  * ********* ****

JN792921_PreC_P-F      cttataaagaatttggagcttctgtggarttactctcktttttgcctkct
MG098582_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ638660_PreC_P-F      cttataaagaatttggmgcttctttagaattgctctcttttttgcctyct
MG098584_PreC_P-F      cttataaagaatttggagcttctgtggagttgctctcttttttgccttct
KJ638662_PreC_P-F      cttataaagaatttggagcttctgtagaattgctctcttttttgccttct
AB365453_PreC_P-F      cttataaagaatttggagcgtctgtggaattgctctcttttttgccttct
MG098569_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgcctcat
JQ272888_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ676694_PreC_P-F      cttataaagaatttggcgcttctctggaattgctctcttttttgccttct
MG098575_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
MG098583_PreC_P-F      cttataaagaatttggtgcttctgtggaattgctctcttttttgccttct
MG098574_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
JN688709_PreC_P-F      cttataaagaatttggagcttctgtggaattgmtctcttttttgccttct
EU366132_PreC_P-F      cttataaagaatttggagcttctagggaattgctctcttttttgcctaat
MG098566_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
MG098579_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
X75658_PreC_C-F        cttataaagaatttggagcttctgtggaattgttctcttttttgccttct
MG098570_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
JN688720_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccgtct
EF576808_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgcctact
AB365450_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgcctamt
MG098577_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgcctaat
MG098580_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
MG098573_PreC_P-F      cttataaagaatttggcgcttctgtggaattgctctcttttttgcctatt
KY476326_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB166850_PreC_P-F      cttataaagaatttggcgcttctgcggaattgctctcttttttgccttct
AB214516_PreC_P-F      cttataaagaatttggcgcttctgcggaattgctctcttttttgccttct
MG098578_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgcctwct
JN688701_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
MG098565_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB365446_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB365449_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843226_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843225_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
MG098564_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
DQ823087_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KC494398_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843212_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843210_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843209_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
JX079937_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
FJ657519_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
HQ420165_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
HQ420166_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
DQ823088_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
FJ657528_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
JN811655_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
JN811656_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843211_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843219_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843221_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843222_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843224_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KY382411_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AF223965_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
EF576812_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843185_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AF223962_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
DQ776247_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
DQ823089_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
DQ823090_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
EU366116_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
FJ657522_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
HE981181_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843175_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843189_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843207_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843208_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843213_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843220_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ843223_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KX264499_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
DQ823086_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KP995115_PreC_P-F      cttataaagaatttggagcttctgtggagttgctctcgtttttgccttct
KP995097_PreC_P-F      cttataaagaatttggcgcttctgtggagttactctcgtttttacctgct
KP995113_PreC_P-F      cttataaagaattcggagcttctgtggagttactctcgtttttgcctcct
KP995114_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgcctact
KC494399_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttaccttct
DQ899146_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcttttttgccttcc
DQ899144_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcttttttgccttcc
DQ899147_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcttttttgccttcc
DQ899145_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcttttttgccttcc
KC494396_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KT896494_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KP995107_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
AY254498_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KP995104_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
AY090455_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KJ843191_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KC494405_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KC494401_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KC494395_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KX264497_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KC494403_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KC494394_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KC494402_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
X69798_PreC_P-F        cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KC494397_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
AY311369_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KP995110_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
DQ899142_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
DQ899143_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KP995120_PreC_P-F      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
FJ589066_PreC_P-F      cttataaagaatttggagcttctgtggaattgctcacttttttgccttct
KP995101_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB116550_PreC_P-F      cttttaaagaatttggagcttctgaggaattactctcttttttgcctctt
KP718106_PreC_P-F      mttataaagaatttggagcttctgyggaattgctctcttttttgccttct
X75663_PreC_P-F        cttataaagaatttggagcttctgtggaattgttctcttttttggcttct
KP995111_PreC_P-F      cgtataaagaatttggagcttctgtggaattgctctcttttttgcctatt
FJ589067_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KP995105_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KP995106_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KP995119_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgcctact
KP995109_PreC_P-F      cttataaagaatttggagcttctgtggaattgctgtcatttttgccttct
KP995118_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
DQ899148_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KP995117_PreC_P-F      cttataaagaatttggagcttctgcggaattgctctcttttttgccttct
KP718103_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
DQ899149_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AY311370_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
DQ899150_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036920_PreC_P-F      cttataaagaatttggcgcttctgtggaattgctctcttttttgccttct
AB036911_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036914_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036915_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036916_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036917_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036919_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036905_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036906_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036907_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036909_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036912_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036913_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KX264498_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036908_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ638659_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KP995123_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KP995125_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB116549_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
MH051986_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
MH051987_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KP995124_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KP995126_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB116551_PreC_P-F      cttataaagaatttggagcttctgtggaattgctgtcgtttttgccttct
KP718109_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KP718112_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
AB036910_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KP718111_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ638663_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KY476329_PreC_P-F      cttataaagaattcggagcttctgtggaattactctcttttttgccttct
KY476330_PreC_P-F      cttataaagaatatggagcttccgcggaattactctcttttttgcctact
KX757665_PreC_P-F      cttataaagaatttggagcttctgtggaactactctcttttttgccttct
AB116654_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgcctact
FJ657525_PreC_P-F      cttataaagaatttggagcctctgtggaattactctcttttttgccttct
KY476328_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgcctgrt
AB086397_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgcctctg
KJ638664_PreC_P-F      cttataaagaatttggagcttctgaggaattactctcttttttgcctctt
KP718110_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgcctact
KY476325_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
KJ638656_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KP718107_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ638657_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KY476324_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgccttct
FJ589065_PreC_P-F      cttataaagaatttggagcttctgtggaactactctcttttttgccttct
AY090459_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
JX899376_PreC_P-F      cttataaagaatttggagcttctgcggaattactctcttttttgcctcct
AY090458_PreC_C-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
AY090461_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KP718104_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KP718113_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KY476327_PreC_P-F      cttataaagaatttggagcttctgtggaattgctctcttttttgcctctt
HM627320_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
AF223963_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ586805_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
JN792916_PreC_P-F      cttataaagaatttggagcttctgcggaattactctcttttttgccttct
EU185743_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843195_PreC_P-F      cttataaagaatttggagcttctctggaattactctcttttttgccttct
KJ843167_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KC494400_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843190_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843193_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843202_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KC494404_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM622135_PreC_P-F      cttataaagaatttggagcttctgcggaattactctcttttttgccttct
EU185744_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KY382415_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KY382416_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KY382417_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
JN688699_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843199_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KP995116_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KP995098_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843198_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843194_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843181_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843176_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843174_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843169_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843168_PreC_P-F      cttataaagaatttggagcttctgcggaattactctcttttttgccttct
KJ843163_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ586808_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ586806_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM585193_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
EU366133_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
DQ823091_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM585188_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM590473_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
FJ709494_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM585190_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
FJ709465_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
MK058437_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
FJ709458_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
FJ709459_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM585191_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM585195_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM585198_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
EU366118_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
FJ657529_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843201_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843203_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843206_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
DQ823092_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
DQ823093_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
FJ709460_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
FJ709464_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HQ378247_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843164_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843180_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KM998715_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KY458061_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KY458062_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
AB116552_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
AF223964_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
AY179735_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
DQ823094_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
DQ823095_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
FJ709457_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
FJ709462_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
FJ709463_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HE981182_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM585187_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM585189_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM585192_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM585196_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM585197_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM585199_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
JN688691_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
JN688703_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KF199901_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ586807_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843170_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843171_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843179_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843196_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843197_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843200_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843204_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843205_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KX264496_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
AB064316_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
JN792919_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KY476331_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
JN792920_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
JN792917_PreC_P-F      cttataaagaatttggagcttctgcggaattactctcttttttgccttct
EU670262_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
JN792918_PreC_P-F      cttataaagaatttggagcttctgcggaattactctcttttttgccttct
KY476332_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KY476323_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
JX079936_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
JN792914_PreC_P-F      cttataaagaatttggagcttctgcggaattactctcttttttgccttct
HM585194_PreC_P-F      cttataaagaatttggagcttctgcggaattactctcttttttgccttct
EU670261_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
HM590474_PreC_P-F      cttataaagaatttggagcttctgtggaactactctcttttttgccttct
HM585186_PreC_P-F      cttataaagaatttggagcttctgtggaactactctcttttttgccttct
HM590471_PreC_P-F      cttataaagaatttggagcttctgtggaactactctcttttttgccttct
HM590472_PreC_P-F      cttataaagaatttggagcttctgtggaactactctcttttttgccttct
KM233681_PreC_P-F      cttataaagaatttggagcttctgtggaactactctcttttttgccttct
HM585200_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
JN792922_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843177_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KJ843178_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
KY476322_PreC_P-F      cttataaagaatttggagcttctgtggaattactctcttttttgccttct
                         * ********  ** ** **    **  *  *  * *****  *    

JN792921_PreC_P-F      gatttcttcccrtcrgttcgggacctactcgacaccgcttcagcyctyta
MG098582_PreC_P-F      gatttcttcccgtcggttcggaacctactcaaccccgcttcacccctcca
KJ638660_PreC_P-F      gatttctttccgtcgrytcgggacctcatcgacaccgcttcagccctcta
MG098584_PreC_P-F      gatttctttccttcggttcgggacctactcracaccgcttcasccctctt
KJ638662_PreC_P-F      gatttctttccgtcggttcgggacctcctcgacaccgcttcagccctcta
AB365453_PreC_P-F      gatttcttcccgtcggttagggacctaatcgacaccgctacagctctcta
MG098569_PreC_P-F      gatttctacccgtccattcgggacctactcgacaccgctgcagctctctt
JQ272888_PreC_P-F      gatttctttccgtcggttcgggacctactcgacaccgcttcagctctcta
KJ676694_PreC_P-F      gatttctacccttcggttcgggacctaatcgacaccgcttcagccctcta
MG098575_PreC_P-F      gatttctacccgtcagttcgggacctactcgacaccgcttcagctctcta
MG098583_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagctctcta
MG098574_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagctctcta
JN688709_PreC_P-F      gatttcttcccgtcrgttcgggacctactcgacaccgcttcagccctctt
EU366132_PreC_P-F      gatttctacccgtcggctcgggacctactcgacaccgctacagccctcta
MG098566_PreC_P-F      gatttctacccgtcggttcgggacctactcgacaccgcttcagccctcta
MG098579_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgctwcagccctctt
X75658_PreC_C-F        gacttctttccgtcaatccgagaccttctcgacaccgcctcagctctgta
MG098570_PreC_P-F      gacttcttcccgccggttcgggacctactcgacaccgcttcagccctata
JN688720_PreC_P-F      gatttcttcccgtcggctcgggacctactcgacaccgctkcagccctcta
EF576808_PreC_P-F      gatttcttcccgtcagctcgggacctattcgacaccgcttcagctctcta
AB365450_PreC_P-F      gattwctwcccgtcggttcgggacctactcgacaccgcttcagctctcta
MG098577_PreC_P-F      gatttcttcccgtcggctcgggacctactcgacaccgcttcagctctcta
MG098580_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctt
MG098573_PreC_P-F      gatttcttcccgtcggctcgggacctactcgacaccgcttcagctctcta
KY476326_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
AB166850_PreC_P-F      gatttctttccgtcggttcgggatctactcgacaccgcttcagccctcta
AB214516_PreC_P-F      gatttctttccgtcggttcgggatctactcgacaccgcttcagccctcta
MG098578_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
JN688701_PreC_P-F      gatttcttcccgtcgattcgggacctactcgacaccgcttcagccctcta
MG098565_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagctctcta
AB365446_PreC_P-F      gatttcttcccgaatgttcgggacctactcgacaccgcttcagctctcta
AB365449_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagctctcta
KJ843226_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843225_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
MG098564_PreC_P-F      gatttcttcccgtcggttcgggacctactcnacaccgcttcagccctcta
DQ823087_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KC494398_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843212_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843210_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843209_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
JX079937_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
FJ657519_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
HQ420165_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
HQ420166_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
DQ823088_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
FJ657528_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
JN811655_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
JN811656_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843211_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843219_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843221_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843222_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843224_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KY382411_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
AF223965_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagctctcta
EF576812_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagctctcta
KJ843185_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagctctcta
AF223962_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
DQ776247_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
DQ823089_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
DQ823090_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
EU366116_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
FJ657522_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
HE981181_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843175_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843189_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843207_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843208_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843213_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843220_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KJ843223_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KX264499_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
DQ823086_PreC_P-F      gatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcta
KP995115_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagcccttta
KP995097_PreC_P-F      gatttcttcccttcggctcgggacctattcgacaccgcttcagctcttta
KP995113_PreC_P-F      gatttcttcccatcggttcgggacctaatcgacaccgcttcagctcttta
KP995114_PreC_P-F      gatttcttcccatcggttcgggatctactcgacaccgcttcagctcttca
KC494399_PreC_P-F      gatttctacccatcggttcgggacctaatcgacaccgcttcagctcttta
DQ899146_PreC_P-F      gatttctttccatcggttcgggacctattcgacaccgcttcagcccttta
DQ899144_PreC_P-F      gatttctttccatcggttcgggacctactcgacaccgcttcagcccttta
DQ899147_PreC_P-F      gatttctttccatcggttcgggacctactcgacaccgcttcagcccttta
DQ899145_PreC_P-F      gatttctttccatcggttcgggacctactggacaccgcttcagcccttta
KC494396_PreC_P-F      gatttctttccatcggttcgggacctactcgacaccgcttcagctcttta
KT896494_PreC_P-F      gatttcttcccatcggctcgggacctactcgacaccgcttcagctcttta
KP995107_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
AY254498_PreC_P-F      gacttcttcccttcggttcgagacctactagacaccgcttcagctcttta
KP995104_PreC_P-F      gatttcttcccatcggttcgggatctactcgacaccgcttcagctcttta
AY090455_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
KJ843191_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
KC494405_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
KC494401_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
KC494395_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
KX264497_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
KC494403_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
KC494394_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
KC494402_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
X69798_PreC_P-F        gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
KC494397_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
AY311369_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
KP995110_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
DQ899142_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
DQ899143_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
KP995120_PreC_P-F      gatttcttcccatcggttcgggacctactcgacaccgcttcagctcttta
FJ589066_PreC_P-F      gatttcttcccgtctattcgggacctactcgacaccgcttcagcccttta
KP995101_PreC_P-F      gatttcttcccatctgttcgggacctactcgacaccgctgcagcccttta
AB116550_PreC_P-F      gatttcttcccgaatgttcgggatctactcgacaccgcttcagcccttta
KP718106_PreC_P-F      gatttcttcccgtctgytcgggacctactcgacaccgcttcagcccttta
X75663_PreC_P-F        gacttctttccgtctgttcgggacctcctcgacaccgcctcagccctgta
KP995111_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgctacagccctata
FJ589067_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgta
KP995105_PreC_P-F      gatttcttcccgtctgctcgggacctactcgacaccgcttcagcccttta
KP995106_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
KP995119_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgta
KP995109_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgta
KP995118_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
DQ899148_PreC_P-F      gatttcttcccttctgttcgggacctactcgacaccgcttcagccttgta
KP995117_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcctcagccctgta
KP718103_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
DQ899149_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgta
AY311370_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcctcagccctgta
DQ899150_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036920_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036911_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036914_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036915_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036916_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036917_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036919_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036905_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036906_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036907_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036909_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036912_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036913_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
KX264498_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB036908_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
KJ638659_PreC_P-F      gatttcttcccgtctgttcgggatctactcgacaccgcttcagcccttta
KP995123_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
KP995125_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagcccttta
AB116549_PreC_P-F      gatttcttcccgtctgttcgggatctactcgacaccgcttcagcccttta
MH051986_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgta
MH051987_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgta
KP995124_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcctcagccctgta
KP995126_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcctcagccctgta
AB116551_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgta
KP718109_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgta
KP718112_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgta
AB036910_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgta
KP718111_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgta
KJ638663_PreC_P-F      gatttcttcccgtcagcwcgggacctactcgamaccgcttcagccctcta
KY476329_PreC_P-F      gatttcttcccgtcaattcgggacctactcgacaccgcttcagccctcta
KY476330_PreC_P-F      gatttctacccgtcagttcgggacctactcgacaccgctcaagccctttt
KX757665_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctgta
AB116654_PreC_P-F      gatttcttcccgtcagttcgggaccttctcgacaccgcttcagcccttta
FJ657525_PreC_P-F      gatttctacccgtcagttcgggacctactcgacaccgcttcagccctcta
KY476328_PreC_P-F      gatttcttyccgtcaattcgggacctactcgacaccgctgcagccctcta
AB086397_PreC_P-F      gatttcttcccgtcagctcgggatctactcgacaccgcttcagccctcta
KJ638664_PreC_P-F      gatttcttcccgtcagctcgggacctactcgacaccgcttcagccctcta
KP718110_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagctctctt
KY476325_PreC_P-F      gatttcttcccgtcaactcgggacctactcgacaccgcttcagccctcta
KJ638656_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KP718107_PreC_P-F      gatttcttcccgtctgttcgggacctactcgacaccgcttcagccctcta
KJ638657_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KY476324_PreC_P-F      gatttctacccgtcagttcgggacttactcgacaccgcttcagccctcta
FJ589065_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagcccttta
AY090459_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagcccttta
JX899376_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagcccttta
AY090458_PreC_C-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagcccttta
AY090461_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagcccttta
KP718104_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagcccttta
KP718113_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagcccttta
KY476327_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM627320_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
AF223963_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagctctgta
KJ586805_PreC_P-F      gactttttcccgtcagttcgggacctactcgacaccgcttcagccctcta
JN792916_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
EU185743_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843195_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843167_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KC494400_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843190_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843193_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843202_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KC494404_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM622135_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
EU185744_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KY382415_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KY382416_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KY382417_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
JN688699_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843199_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KP995116_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctata
KP995098_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843198_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcacccctcta
KJ843194_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843181_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagctctcta
KJ843176_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843174_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843169_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843168_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843163_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ586808_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ586806_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM585193_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
EU366133_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
DQ823091_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM585188_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM590473_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
FJ709494_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM585190_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
FJ709465_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
MK058437_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
FJ709458_PreC_P-F      gacttcttcccgtcagtacgggacctactcgacaccgcttcagccctcta
FJ709459_PreC_P-F      gacttcttcccgtcagtacgggacctactcgacaccgcttcagccctcta
HM585191_PreC_P-F      gacttcttcccgtcagtacgggacctactcgacaccgcttcagccctcta
HM585195_PreC_P-F      gacttcttcccgtcagtacgggacctactcgacaccgcttcagccctcta
HM585198_PreC_P-F      gacttcttcccgtcagtacgggacctactcgacaccgcttcagccctcta
EU366118_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
FJ657529_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843201_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843203_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843206_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
DQ823092_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
DQ823093_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
FJ709460_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
FJ709464_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HQ378247_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843164_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843180_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KM998715_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KY458061_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KY458062_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
AB116552_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
AF223964_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
AY179735_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
DQ823094_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
DQ823095_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
FJ709457_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
FJ709462_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
FJ709463_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HE981182_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM585187_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM585189_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM585192_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM585196_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM585197_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM585199_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
JN688691_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
JN688703_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KF199901_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ586807_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843170_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843171_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843179_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843196_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843197_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843200_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843204_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843205_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KX264496_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
AB064316_PreC_P-F      gacttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
JN792919_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KY476331_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
JN792920_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
JN792917_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
EU670262_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
JN792918_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KY476332_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KY476323_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
JX079936_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
JN792914_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM585194_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
EU670261_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM590474_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM585186_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM590471_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM590472_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KM233681_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
HM585200_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
JN792922_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843177_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KJ843178_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
KY476322_PreC_P-F      gatttcttcccgtcagttcgggacctactcgacaccgcttcagccctcta
                       ** *  *  **        *  *  *  *  *  ****   * *  *   

JN792921_PreC_P-F      ccgggatgctttagartcaccwgaacattgcacwccyaaccatacygctc
MG098582_PreC_P-F      cagcgatgctttaaagtccccggaactttgcccccccaatcataccgctc
KJ638660_PreC_P-F      ccgggatgcattagagtcaccggaacattgcacccccaatcataccgctc
MG098584_PreC_P-F      cagggatgctttaragtcaccggaacwttgcaccccccatcataccgctc
KJ638662_PreC_P-F      ccgggatgctttagagtcaccggaacattgcaccccccatcataccgctc
AB365453_PreC_P-F      cagggatgacttagagtcaccggaacattgcaccgcccatcataccgctc
MG098569_PreC_P-F      cagggatgctttagagtcaccggaacattgcaccccccaccatacagcta
JQ272888_PreC_P-F      cagggatgctttagagtcacctgaacattgcaccccccatcataccgcta
KJ676694_PreC_P-F      cagggatgcgttagagtcaccggaacattgcaccccccatcataccgctc
MG098575_PreC_P-F      cagggatgctttagagtcaccaaaacattgctccccccatcataccgcta
MG098583_PreC_P-F      cagggattctttagagtcaccggaacattgctccccccatcataccgctc
MG098574_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
JN688709_PreC_P-F      cagggatgctttagagtcaccggaacattgcaccccccatcataccgctc
EU366132_PreC_P-F      cagggatgctttagagtcaccggaacattgctccccccatcataccgtta
MG098566_PreC_P-F      cagggatgctttagagtcaccagaacattgcacccaccatcataccgctc
MG098579_PreC_P-F      caaggatgctttagagtcaccggaacattgcaccccccatcataccgctc
X75658_PreC_C-F        tcgggatgcgttagagtcaccggaacattgcacccccaatcataccgctc
MG098570_PreC_P-F      cagggatgctttagagtcaccggaacattgcactccccatcataccgctc
JN688720_PreC_P-F      cagggatgctttagagtcaccggaacattgcaccccccatcataccgcta
EF576808_PreC_P-F      cagggatgctttagagtcaccgcaacattgcaccccccatcataccgctc
AB365450_PreC_P-F      cagggatgctttagagtcaccggaacattkcaccccccatcatamcgctc
MG098577_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
MG098580_PreC_P-F      cagggatgctttagagtcaccggaacattgcaccccccatcataccgctc
MG098573_PreC_P-F      cagggatgctttagagtcaccggaacattgctccccccatcataccgcta
KY476326_PreC_P-F      cagggatgctttagagtcaccggaacattgytccccccatcataccgctc
AB166850_PreC_P-F      cagggatgctttagagtcaccggaacattgcactcccaatcataccgctc
AB214516_PreC_P-F      cagggatgctttagagtcaccggaacattgcactcccaatcataccgctc
MG098578_PreC_P-F      cagggatgctttagagtcaccggaacattgcaccccccatcataccgctc
JN688701_PreC_P-F      cagggawgctttagagtcaccggaacattgcacccacmatcataccgctc
MG098565_PreC_P-F      cagggatgctttagagtcaccggaacattgcaccccctctcataccgctc
AB365446_PreC_P-F      cagggatgctttagagtcaccggaacattgcaccccccatcataccgctc
AB365449_PreC_P-F      cagggaggctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843226_PreC_P-F      cagggatgctctagagtcaccggaacattgcacccccaatcataccgctc
KJ843225_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
MG098564_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
DQ823087_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KC494398_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843212_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843210_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843209_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
JX079937_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
FJ657519_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
HQ420165_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
HQ420166_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
DQ823088_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
FJ657528_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
JN811655_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
JN811656_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843211_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843219_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843221_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843222_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843224_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KY382411_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
AF223965_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
EF576812_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843185_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
AF223962_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
DQ776247_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
DQ823089_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
DQ823090_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
EU366116_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
FJ657522_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
HE981181_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843175_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843189_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843207_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843208_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843213_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843220_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ843223_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KX264499_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
DQ823086_PreC_P-F      cagggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KP995115_PreC_P-F      ccgggatgccttggagtcacctgagcattgctctccccaccatactgctc
KP995097_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactccccaccatactgctc
KP995113_PreC_P-F      ccgggatgctttagagtcacctgagcattgcactcccaaccatactgcta
KP995114_PreC_P-F      ccgggatgctttagagtcacctgagcattgctctccccaccatactgcta
KC494399_PreC_P-F      ccgggatgctttagagtcacctgaacattgctctccccaccatacggctc
DQ899146_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaatcacactgctc
DQ899144_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaatcacactgctc
DQ899147_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaatcacactgctc
DQ899145_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaatcacactgctc
KC494396_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactccccaccataccgctc
KT896494_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactccccaccatactgctc
KP995107_PreC_P-F      ccgggatgctttagagtcacctgaacattgctctcccaaccatactgctc
AY254498_PreC_P-F      ccgggatgctttagagtctcctgaacattgctctcccaaccatactgctc
KP995104_PreC_P-F      ccgggatgctctagagtcacctgagcattgcactcccaaccatactgctc
AY090455_PreC_P-F      ccgggatgctttagagtcacctgagcattgcactcccaaccatactgctc
KJ843191_PreC_P-F      ccgggatgctttaragtcacctgaacattgcactcccaaccatactgctc
KC494405_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaaccatactgctc
KC494401_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaaccatactgctc
KC494395_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaaccatactgctc
KX264497_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaaccatactgctc
KC494403_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaaccatactgctc
KC494394_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaaccatactgctc
KC494402_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaaccatactgctc
X69798_PreC_P-F        ccgggatgctttagagtcacctgaacattgcactcccaaccatactgctc
KC494397_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaaccatactgctc
AY311369_PreC_P-F      ccgggatgctttagagtcacctgagcattgcactcccaaccatactgctc
KP995110_PreC_P-F      ccgggatgctttagagtcacctgagcattgcactcccaaccatactgctc
DQ899142_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaaccatactgctc
DQ899143_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaaccatactgctc
KP995120_PreC_P-F      ccgggatgctttagagtcacctgaacattgcactcccaaccatactgctc
FJ589066_PreC_P-F      ccgggatgctctagagtcaccggaacattgctccccccatcataccgctc
KP995101_PreC_P-F      ccgggatgctcttgagtcaccggaacattgctccccccatcacaccgcta
AB116550_PreC_P-F      ccgggatgctcttgagtcatcggaacattgcaccccccatcataccgctc
KP718106_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccctaatcataccgctc
X75663_PreC_P-F        ccgggatgccttagagtcaccggaacattgcacccccaatcataccgctc
KP995111_PreC_P-F      ccgggatgctctagagtcaccggaacattgcaccccccatcataccgctc
FJ589067_PreC_P-F      ccgggatgctcttgagtcaccggaacattgcacccccaatcataccgctc
KP995105_PreC_P-F      ccggcaagctctagagtcaccggaacattgcaccccccatcataccgctc
KP995106_PreC_P-F      ccgggatgctctggagtccccggaacattgcacccccaatcataccgctc
KP995119_PreC_P-F      ccgggatgctctagagtcaccagaacattgcaccccccatcataccgctc
KP995109_PreC_P-F      ccgggatgctctggagtcaccggaacattgcacccccaatcataccgctc
KP995118_PreC_P-F      ccgagatgcgctagagtcaccggaacattgcacccccaatcataccgctc
DQ899148_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
KP995117_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
KP718103_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
DQ899149_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
AY311370_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
DQ899150_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
AB036920_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
AB036911_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
AB036914_PreC_P-F      ccgggatgctctagagtcaccggagcattgcacccccaatcataccgctc
AB036915_PreC_P-F      ccgggatgctctagagtcaccggagcattgcacccccaatcataccgctc
AB036916_PreC_P-F      ccgggatgctctagagtcaccggagcattgcacccccaatcataccgctc
AB036917_PreC_P-F      ccgggatgctctagagtcaccggagcattgcacccccaatcataccgctc
AB036919_PreC_P-F      ccgggatgctctagagtcaccggagcattgcacccccaatcataccgctc
AB036905_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
AB036906_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
AB036907_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
AB036909_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
AB036912_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
AB036913_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
KX264498_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
AB036908_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
KJ638659_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
KP995123_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
KP995125_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
AB116549_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
MH051986_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcatactgctc
MH051987_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcatactgctc
KP995124_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
KP995126_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
AB116551_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
KP718109_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
KP718112_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
AB036910_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
KP718111_PreC_P-F      ccgggatgctctagagtcaccggaacattgcacccccaatcataccgctc
KJ638663_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctcaccatacagctc
KY476329_PreC_P-F      ccgggatgctttagagtcacctgaacattgctcacctaaccataccgctc
KY476330_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctcaccataccgctc
KX757665_PreC_P-F      ccgggatgctctagaatcaccggaacattgcacmccyaatcataccgctc
AB116654_PreC_P-F      ccgggatgctttagaatcaccagaacactgcacagctcaccataccgcta
FJ657525_PreC_P-F      tcgggatgctttggaatcaccagaacattgctcacctcaccataccgctc
KY476328_PreC_P-F      ccgggatgctttagaatcatcggaacattgcacccatcaccataccgctc
AB086397_PreC_P-F      ccgggaggctttagaatcaccagaacattgcacagctcaccataccgctc
KJ638664_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctcaccataccgctc
KP718110_PreC_P-F      ccgggatgctttagaatcaccagaacattgctcacatcaccataccgccc
KY476325_PreC_P-F      ccgggatgctttagaatcaccggaacattgcacccatcaccataccgctc
KJ638656_PreC_P-F      tcgggatgctttagaatcaccagaacattgcacacctcaccataccgcta
KP718107_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctcaccataccgctc
KJ638657_PreC_P-F      ccgggatgctttagaatcaccagagcattgcacacctmaccataccgctc
KY476324_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctcaccataccgctc
FJ589065_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
AY090459_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
JX899376_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
AY090458_PreC_C-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
AY090461_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KP718104_PreC_P-F      ccgggatgctttagaatcacctgaacattgcacacctaaccataccgctc
KP718113_PreC_P-F      ccgggatgctttagaatcacctgaacattgcacacctaaccataccgctc
KY476327_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctcaccataccgctc
HM627320_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctcaccataccgctc
AF223963_PreC_P-F      ccgggatgctttagagtcaccggaacattgcacccccaatcataccgctc
KJ586805_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctt
JN792916_PreC_P-F      ccgggacgctttagaatcaccagaacattgcacacctaaccataccgctc
EU185743_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccatacagctc
KJ843195_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843167_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KC494400_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843190_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843193_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843202_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KC494404_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM622135_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
EU185744_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KY382415_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KY382416_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KY382417_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
JN688699_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843199_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KP995116_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KP995098_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843198_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843194_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843181_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843176_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843174_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843169_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843168_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843163_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ586808_PreC_P-F      ccgggatgctttaaaatcaccagaacattgcacacctaaccataccgctc
KJ586806_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585193_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
EU366133_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
DQ823091_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585188_PreC_P-F      ccgagatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM590473_PreC_P-F      ccgagatgctttagaatcaccagaacattgcacacctaaccataccgctc
FJ709494_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585190_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
FJ709465_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
MK058437_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
FJ709458_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
FJ709459_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585191_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585195_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585198_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
EU366118_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
FJ657529_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843201_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843203_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843206_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
DQ823092_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
DQ823093_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
FJ709460_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
FJ709464_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HQ378247_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843164_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843180_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KM998715_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KY458061_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KY458062_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
AB116552_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
AF223964_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
AY179735_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
DQ823094_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
DQ823095_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
FJ709457_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
FJ709462_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
FJ709463_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HE981182_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585187_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585189_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585192_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585196_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585197_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585199_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
JN688691_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
JN688703_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KF199901_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ586807_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843170_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843171_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843179_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843196_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843197_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843200_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843204_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843205_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KX264496_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
AB064316_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
JN792919_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KY476331_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
JN792920_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
JN792917_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
EU670262_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaatcatactgctc
JN792918_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacatcaccataccgctc
KY476332_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KY476323_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
JX079936_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
JN792914_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585194_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
EU670261_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaatcatactgctc
HM590474_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585186_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM590471_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM590472_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KM233681_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
HM585200_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
JN792922_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843177_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KJ843178_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
KY476322_PreC_P-F      ccgggatgctttagaatcaccagaacattgcacacctaaccataccgctc
                            *     *  * **  *  * *  *   *       ** *  *   

JN792921_PreC_P-F      tcaggcaagctatwttgtgytggggtgagttaatgactttggcttcctgg
MG098582_PreC_P-F      tcaggcaasttatttcgtgttggggtgaattaataactttggcttccggg
KJ638660_PreC_P-F      tcaggcaagctattgtgtgttggggtgaggtaatgactttggctgcctgg
MG098584_PreC_P-F      tcaggcaagctattgtgtgttgaaatgaggtaatagctctagcttcctgg
KJ638662_PreC_P-F      tyagrcaarttattttgtgttggggtgagttaacgaatttgggttcctgg
AB365453_PreC_P-F      tcaggcaagctattgtgtgttggggtgaagtaatgactttggcttcctgg
MG098569_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatggttttcgcttcctgg
JQ272888_PreC_P-F      tcaggcaagctatattgtgttggggcgaattaatggttttcgcttcctgg
KJ676694_PreC_P-F      tcaggcaagctattttgtgttggacagaggtaatgactctggcttcctgg
MG098575_PreC_P-F      tcaggcaagctgttttgtgttggggtgaattaatgactttggcttcctgg
MG098583_PreC_P-F      tcaggcaagctatttcgtgttggggtgaattaatgactttggcttcctgg
MG098574_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgattttggcttcctgg
JN688709_PreC_P-F      tcaggcaagctattgtgtgttggggtgaagtawcgactttkgcttcctgg
EU366132_PreC_P-F      tcaggcaagctgttttgtgttggggtgaattaatgactttggcttcctgg
MG098566_PreC_P-F      tcaggcaagctattttgtgttggaatgaattaatgacttttgcttcctgg
MG098579_PreC_P-F      tcaggcaagctgttttgtgttggggtgaattaatgaatttggcttcctgg
X75658_PreC_C-F        tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
MG098570_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
JN688720_PreC_P-F      tcaggcaagctgttttgtgttggaatgaattaatgactttcgcttcctgg
EF576808_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaacgactctggcttcctgg
AB365450_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
MG098577_PreC_P-F      tcaggcaagctattttgtgttgggatgaattaatgacttttgctgcctgg
MG098580_PreC_P-F      tcaggcaagctattgtgtgttggaatgaggtaatagctttggcttcctgg
MG098573_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KY476326_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
AB166850_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
AB214516_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
MG098578_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
JN688701_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgaatttggcttcctgg
MG098565_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
AB365446_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
AB365449_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843226_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843225_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
MG098564_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
DQ823087_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KC494398_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843212_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843210_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843209_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
JX079937_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
FJ657519_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
HQ420165_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
HQ420166_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
DQ823088_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
FJ657528_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
JN811655_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
JN811656_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843211_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843219_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843221_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843222_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843224_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KY382411_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
AF223965_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
EF576812_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843185_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
AF223962_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
DQ776247_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
DQ823089_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
DQ823090_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
EU366116_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
FJ657522_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
HE981181_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843175_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843189_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843207_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843208_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843213_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843220_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KJ843223_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KX264499_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
DQ823086_PreC_P-F      tcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgg
KP995115_PreC_P-F      tcaggcaagctattttgtgttgggatgagttaatgattttcgcttcctgg
KP995097_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaacgactttggcttcctgg
KP995113_PreC_P-F      tcaggcaagttcttttgtgctggaatgagttaatgacttttgcttcctgg
KP995114_PreC_P-F      tcaggcaagctgtttcgtgttggggtgaattaataactttggcttcctgg
KC494399_PreC_P-F      tcaggcaagctgttgggtgttggggtgaggtatcgactttggcttcctgg
DQ899146_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
DQ899144_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
DQ899147_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
DQ899145_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KC494396_PreC_P-F      tcaggcaagctattttatgttggggtgagttaatgactttggcttcctgg
KT896494_PreC_P-F      tcaggcaagctattttgtgttgggttgagttaatgactttggcttcctgg
KP995107_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
AY254498_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
KP995104_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
AY090455_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
KJ843191_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
KC494405_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
KC494401_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
KC494395_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
KX264497_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
KC494403_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
KC494394_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
KC494402_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
X69798_PreC_P-F        tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
KC494397_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
AY311369_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
KP995110_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
DQ899142_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
DQ899143_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
KP995120_PreC_P-F      tcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgg
FJ589066_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatggttttcgcttcctgg
KP995101_PreC_P-F      tcaggcaaattattttgtgctggggtgagttaatgtctttggcttcctgg
AB116550_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgattttcgctgcttgg
KP718106_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
X75663_PreC_P-F        tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KP995111_PreC_P-F      tcaggcaaactgttttgtgctggggtgagttaatgactttggcttcctgg
FJ589067_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KP995105_PreC_P-F      tcaggcaagctattttgtgctggggtgaattaatgactttggcttcctgg
KP995106_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KP995119_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KP995109_PreC_P-F      tcaggcaagctattgtgtgctggggtgaggtaatgactttggcttcctgg
KP995118_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
DQ899148_PreC_P-F      tcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgg
KP995117_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KP718103_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
DQ899149_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcctcctgg
AY311370_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
DQ899150_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036920_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036911_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036914_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036915_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036916_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036917_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036919_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036905_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036906_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036907_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036909_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036912_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036913_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KX264498_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036908_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KJ638659_PreC_P-F      tcaggcaagctattttgtgctggactgaggtaatgactttggcttcctgg
KP995123_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KP995125_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB116549_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
MH051986_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
MH051987_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KP995124_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KP995126_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB116551_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KP718109_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KP718112_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB036910_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KP718111_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
KJ638663_PreC_P-F      tcaggcaagctgtattgtgctggactgaggtaatgactttggctacctgg
KY476329_PreC_P-F      tccggcaagctatattgtgctggaatgaggtaacggagtttggtaactgg
KY476330_PreC_P-F      tcaggcatgttatattgtgctggggtgagttaatgactttggcttcctgg
KX757665_PreC_P-F      tcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgg
AB116654_PreC_P-F      tcaggcaaattgtattgtgctggggtgagttgatgactttggcttcctgg
FJ657525_PreC_P-F      tcaggcaagttagtttgtgctggagtgagttaatgactttcgctatctgg
KY476328_PreC_P-F      tcaggcaagctatattgtgctggggtgaggtaatgaatttggcttcctgg
AB086397_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaacgactttggctacctgg
KJ638664_PreC_P-F      tcaggcaagctatattgtgctggaatgaggtaacgactttggcttcctgg
KP718110_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KY476325_PreC_P-F      tcaggcaagctatagtgtgctggttggaggtaacgactttggcttcctgg
KJ638656_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KP718107_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ638657_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttsgcttcctgg
KY476324_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
FJ589065_PreC_P-F      tcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgg
AY090459_PreC_P-F      tcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgg
JX899376_PreC_P-F      tcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgg
AY090458_PreC_C-F      tcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgg
AY090461_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KP718104_PreC_P-F      tcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgg
KP718113_PreC_P-F      tcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgg
KY476327_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM627320_PreC_P-F      tyaggcaarytatattgtgctggggtgagttaatgactttggcttcctgg
AF223963_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ586805_PreC_P-F      tcaggcaagctatattgtgctggggggagttaatgactttggcttcctgg
JN792916_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
EU185743_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttccttg
KJ843195_PreC_P-F      tcaggcaagctatattgtgctggagtgaggtaatgactttggcttcctgg
KJ843167_PreC_P-F      tcaggcaagctatattgggctggggtgagttaatgactttggcttcctgg
KC494400_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843190_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843193_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843202_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KC494404_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM622135_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
EU185744_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KY382415_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KY382416_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KY382417_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
JN688699_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843199_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KP995116_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KP995098_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843198_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843194_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843181_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843176_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843174_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843169_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843168_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843163_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ586808_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ586806_PreC_P-F      tcaggcaagctatattgtgctggggggagttaatgactttggcttcctgg
HM585193_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
EU366133_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
DQ823091_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585188_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM590473_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
FJ709494_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585190_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
FJ709465_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
MK058437_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
FJ709458_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
FJ709459_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585191_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585195_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585198_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
EU366118_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcctcctgg
FJ657529_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcctcctgg
KJ843201_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcctcctgg
KJ843203_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcctcctgg
KJ843206_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcctcctgg
DQ823092_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
DQ823093_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
FJ709460_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
FJ709464_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HQ378247_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843164_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843180_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KM998715_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KY458061_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KY458062_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
AB116552_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
AF223964_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
AY179735_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
DQ823094_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
DQ823095_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
FJ709457_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
FJ709462_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
FJ709463_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HE981182_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585187_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585189_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585192_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585196_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585197_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585199_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
JN688691_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
JN688703_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KF199901_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ586807_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843170_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843171_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843179_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843196_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843197_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843200_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843204_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843205_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KX264496_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
AB064316_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
JN792919_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgattttcgcttcctgg
KY476331_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
JN792920_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
JN792917_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
EU670262_PreC_P-F      tcagacaagctatattgtgctggggtgagttagtgactttggcttcctgg
JN792918_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KY476332_PreC_P-F      tcaggcaagctatattgtgttggggtgagttaatgactttggcttcctgg
KY476323_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
JX079936_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
JN792914_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585194_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
EU670261_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM590474_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585186_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM590471_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM590472_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KM233681_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
HM585200_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
JN792922_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843177_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KJ843178_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
KY476322_PreC_P-F      tcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgg
                       *  * **   *       * **    **  *        * *       *

JN792921_PreC_P-F      gtgggcaataatttggargaycctgswgctagggayytagtrgttaacta
MG098582_PreC_P-F      gtgggcaataatttgaagaaccctgctgccagggatttattatttaacta
KJ638660_PreC_P-F      gtgggccataatttggaggaccctgcagctagggatttagtagtgaatta
MG098584_PreC_P-F      gtgggcaataatttgratgaacctgcatctagggatttagtagttaacta
KJ638662_PreC_P-F      gtgggcaataatttggaggacmctgcagctagggattyagtagtgaatta
AB365453_PreC_P-F      gtgggcaataatttggacgaccctggagccagggatttagtagttaacta
MG098569_PreC_P-F      gtgggcaacaatttgcaggaccctgcatccagggatttagtagttgacta
JQ272888_PreC_P-F      gtgggcaataatttgcaagacgctgcagccagggatttagtagtcgacta
KJ676694_PreC_P-F      gtgggcaataatttggaagaccctgcagctagggatttagtagttaacta
MG098575_PreC_P-F      gtgggcaataatttggatgaccctgcagccagggatttagtagttaacta
MG098583_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
MG098574_PreC_P-F      gggggcaatattttggagaaccctgcagccggggatttattagttaactc
JN688709_PreC_P-F      gtgggccataatttrgaggaccctgcagccagggatttagtagttaacta
EU366132_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagtgaacta
MG098566_PreC_P-F      gtgggcaataatttggatgaccctgcagccagggatttagtagttaacta
MG098579_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
X75658_PreC_C-F        gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
MG098570_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
JN688720_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
EF576808_PreC_P-F      gtgggcaataatttggaggaccctgcatccagggatttagtagttaacta
AB365450_PreC_P-F      gtgggcaataatttggatgaccctgcagccagggatttagtagttaacta
MG098577_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
MG098580_PreC_P-F      gtgggcaataatttggatgaccctgcagccagggatttagtagttaacta
MG098573_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KY476326_PreC_P-F      gtgggcaataatttggaagaccctgcagccagggatttagtagttaacta
AB166850_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
AB214516_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
MG098578_PreC_P-F      gtgggcaataatttggaggaccctgccgccagggatttagtagttaacta
JN688701_PreC_P-F      gtgggcaataatttggaygaccctgcagccagggatttagtagttaacta
MG098565_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
AB365446_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
AB365449_PreC_P-F      gtgggcaataatttgcaggaccctgcagcaagggatttagtagttaacta
KJ843226_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843225_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
MG098564_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
DQ823087_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KC494398_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843212_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843210_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843209_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
JX079937_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
FJ657519_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
HQ420165_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
HQ420166_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
DQ823088_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
FJ657528_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
JN811655_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
JN811656_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843211_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843219_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843221_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843222_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843224_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KY382411_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
AF223965_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
EF576812_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843185_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
AF223962_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
DQ776247_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
DQ823089_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
DQ823090_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
EU366116_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
FJ657522_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
HE981181_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843175_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843189_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843207_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843208_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843213_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843220_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KJ843223_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KX264499_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
DQ823086_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
KP995115_PreC_P-F      gtgggcaataatttggacgaccctgcatctagggatttagtagttaacta
KP995097_PreC_P-F      gtgggcaataatttggatgacgctgcagctagggatttagtagttaacta
KP995113_PreC_P-F      gtgggcgagaatttggatgaccctgcagctaggaattcagtagttaacta
KP995114_PreC_P-F      gtgggcaataatttggatgaccctgcagctagggatttagtagttaacta
KC494399_PreC_P-F      gtgggcaataatttggaggaccctgcagccagggatttagtagttaacta
DQ899146_PreC_P-F      gtgggcaataacttggaggaccctgctgccagggatttagtagttaacta
DQ899144_PreC_P-F      gtgggcaataacttggaggaccctgctgccagggatttagtagttaacta
DQ899147_PreC_P-F      gtgggcaataacttggaggaccctgctgccagggatttagtagttaacta
DQ899145_PreC_P-F      gtgggcaataacttggaggaccctgctgccagggatttagtagttaacta
KC494396_PreC_P-F      gtgggcaataatttggacgaccctggagctagggatttagtagttaacta
KT896494_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
KP995107_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaacta
AY254498_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
KP995104_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
AY090455_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggacttagttgttaacta
KJ843191_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
KC494405_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
KC494401_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
KC494395_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
KX264497_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
KC494403_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
KC494394_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
KC494402_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
X69798_PreC_P-F        gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
KC494397_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
AY311369_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
KP995110_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
DQ899142_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
DQ899143_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
KP995120_PreC_P-F      gtgggcaataatttggaggaccctgcagctagggatttagtagttaacta
FJ589066_PreC_P-F      gtgggcaataatttggaagatcctgcagctagggatttagtagttaatta
KP995101_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB116550_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KP718106_PreC_P-F      gtgggtmataatttggaaraccctgcwgctagggatttartarttaatta
X75663_PreC_P-F        gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KP995111_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
FJ589067_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KP995105_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KP995106_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KP995119_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KP995109_PreC_P-F      gtgggtcataatttggaagaccctgcagctagggatttagtagttaatta
KP995118_PreC_P-F      gtgggtaataatttggaagatcctgcagctagggatttagtagttaatta
DQ899148_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaacta
KP995117_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KP718103_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
DQ899149_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AY311370_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttggtagttaatta
DQ899150_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatctagtagttaatta
AB036920_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036911_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036914_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036915_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036916_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036917_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036919_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036905_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036906_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036907_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036909_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036912_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036913_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KX264498_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036908_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KJ638659_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KP995123_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KP995125_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB116549_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
MH051986_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
MH051987_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KP995124_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttggtagttaatta
KP995126_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttggtagttaatta
AB116551_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KP718109_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KP718112_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
AB036910_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KP718111_PreC_P-F      gtgggtaataatttggaagaccctgcagctagggatttagtagttaatta
KJ638663_PreC_P-F      gtgggccataatttggacgatcctgcagctagggacctagtggttaacta
KY476329_PreC_P-F      gtgggcaataatttggaagatcctgctgccagggacttagtggttgacta
KY476330_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
KX757665_PreC_P-F      gtggggaataatttggaagatcctgcagctagggatctagtggttaacta
AB116654_PreC_P-F      gtgggcaataatttggacgatcctgctgctagggacctagtggttaacta
FJ657525_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggatctagtggttaacta
KY476328_PreC_P-F      gtgggcaataatttgcaagatcctgctgcaagggacctcgtggttaacta
AB086397_PreC_P-F      gtgggcaataatttggacgatcctgctgctagggacctagtggttaacta
KJ638664_PreC_P-F      gtgggcaataatttggaagatcctgcagctagggaccaagtggttaacta
KP718110_PreC_P-F      gtgggcaataatttggaagatcctgcagctagggacctagtggttaacta
KY476325_PreC_P-F      gtgggcaataatttggacgatcctgctgctagggacctcgtggttaacta
KJ638656_PreC_P-F      gtgggcaataatttggaagatcctgcagctagggacctagtggttaacta
KP718107_PreC_P-F      gtgggcaataatttggaagatcctgcagctagggacctagtggttaacta
KJ638657_PreC_P-F      gtgggcaataatttggaagatcctgsagctaggracctagtggttracta
KY476324_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacttagtggttaacta
FJ589065_PreC_P-F      gtggggaataatttggaagatcctgcagctagggacctagtggttaacta
AY090459_PreC_P-F      gtgggtaataatttggaagatcctgcagatagggacytagtggttaacta
JX899376_PreC_P-F      gtggggaataatttggaagatcctgcagctagggacctagtggttaacta
AY090458_PreC_C-F      gtggggaataatttggaagatcctgcagctagggacctagtggttaacta
AY090461_PreC_P-F      gtggggaataatttggaagatcctgcagctagggacctagtggttaacta
KP718104_PreC_P-F      gtggggaataatttggaagatcctgcagctagggacctagtggttaacta
KP718113_PreC_P-F      gtggggaataatttggaagatcctgcagctagggacctagtggttaacta
KY476327_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacttagtggttaacta
HM627320_PreC_P-F      gtgggcaataatttggacgatcctgctgctagggacctagtggttaacta
AF223963_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacttagtggttaacta
KJ586805_PreC_P-F      gggggcaataacttggaagatcctgctgctagggacctagtggttaacta
JN792916_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
EU185743_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843195_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843167_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KC494400_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaaata
KJ843190_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
KJ843193_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
KJ843202_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KC494404_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HM622135_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
EU185744_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KY382415_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagyggttaacta
KY382416_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagyggttaacta
KY382417_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagyggttaacta
JN688699_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843199_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KP995116_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KP995098_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
KJ843198_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843194_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
KJ843181_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
KJ843176_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843174_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
KJ843169_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843168_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843163_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ586808_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ586806_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HM585193_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
EU366133_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
DQ823091_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HM585188_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HM590473_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
FJ709494_PreC_P-F      gtgggcaacaacttggaagatcctgctgctagggacctagtggttaacta
HM585190_PreC_P-F      gtgggcaacaacttggaagatcctgctgctagggacctagtggttaacta
FJ709465_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
MK058437_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
FJ709458_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
FJ709459_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HM585191_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HM585195_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HM585198_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
EU366118_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
FJ657529_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843201_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843203_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843206_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
DQ823092_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
DQ823093_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
FJ709460_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
FJ709464_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
HQ378247_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
KJ843164_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
KJ843180_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
KM998715_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
KY458061_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
KY458062_PreC_P-F      gtgggcaataacttggaagatcctgctgccagggacctagtggttaacta
AB116552_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
AF223964_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
AY179735_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
DQ823094_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
DQ823095_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
FJ709457_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
FJ709462_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
FJ709463_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HE981182_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HM585187_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HM585189_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HM585192_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HM585196_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HM585197_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
HM585199_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
JN688691_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
JN688703_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KF199901_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ586807_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843170_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843171_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843179_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843196_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843197_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843200_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843204_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KJ843205_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
KX264496_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
AB064316_PreC_P-F      gtgggcaataacttggaagatcctgctgctagggacctagtggttaacta
JN792919_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
KY476331_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacttagtggttaacta
JN792920_PreC_P-F      gtgggcaataatttggaagatcctggtgctagggacctagtggttaacta
JN792917_PreC_P-F      gtgggcaataatttgcaagatcctgctgctagggaccaagtggttaacta
EU670262_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
JN792918_PreC_P-F      gtgggcaataatttggacgatcctgctgctagggacctagtggttaacta
KY476332_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
KY476323_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctcgtggttaacta
JX079936_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
JN792914_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
HM585194_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
EU670261_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
HM590474_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
HM585186_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
HM590471_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
HM590472_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
KM233681_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
HM585200_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
JN792922_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
KJ843177_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
KJ843178_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
KY476322_PreC_P-F      gtgggcaataatttggaagatcctgctgctagggacctagtggttaacta
                       * ***  * *  **  *  *  ***      ** *        *  * * 

JN792921_PreC_P-F      tgtyaayactaacatgggcctmaaaattagacaaytrytgtggtttcaca
MG098582_PreC_P-F      tgttaacactaatatgggcttaaagataaaacaactatgatggtttcaca
KJ638660_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaactattgtggtttcaca
MG098584_PreC_P-F      tgttaacactaatatgggcctaaagatcaaacaactatngtggtttcaca
KJ638662_PreC_P-F      tgtcaatactaacatgggcctaaaaactagacaactattgtggtttcaca
AB365453_PreC_P-F      tgttaacactcacatgggcctaaagattagacaattattgtggtttcaca
MG098569_PreC_P-F      tgttaacattaacatgggcttaaagattacacaattattgtggtttcaca
JQ272888_PreC_P-F      tgttaacactcacatgggcttaaagattagacatttattgtggtttcacc
KJ676694_PreC_P-F      tgttaacactcacatgggcctaaagatyagacaactattgtggtttcaca
MG098575_PreC_P-F      tgttaacactcacatgggcttaaagattagacaattattgtggtttcaca
MG098583_PreC_P-F      tgttaacactcacatgggcgtaaagatgagacaatatttgtggtttcacg
MG098574_PreC_P-F      tgttaacactcacgtgggcttaaagatgaaacaattattgtggtttcaca
JN688709_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
EU366132_PreC_P-F      tgttaacactaccgtgggcctaaagcttagacaactattgtggtttcaca
MG098566_PreC_P-F      tgttaacattaacatgggcttaaagattagacaactattgtggtttcacg
MG098579_PreC_P-F      tgttaacavtcacatgggattaaagattagacaaatattgtggtttcaca
X75658_PreC_C-F        tgttaacactaatatgggcttaaagattagacaactattgtggtttcaca
MG098570_PreC_P-F      tgttaacaataacatgggcttaaaaattagacaactattgtggtttcaca
JN688720_PreC_P-F      tgttaacattaacatgggcttaaagattagacaactattgtggtttcaca
EF576808_PreC_P-F      tgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
AB365450_PreC_P-F      tgttaacactcacatgggcttaaagattagacaattattgtggtttcaca
MG098577_PreC_P-F      tgttaacattaacatgggcttaaagattagacaattattgtggtttcaca
MG098580_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
MG098573_PreC_P-F      tgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
KY476326_PreC_P-F      tgttaacactcacatgggcttaaagattagacaactattgtggtttcaca
AB166850_PreC_P-F      tgttaacactaacatgggcttaaaaattagacaactattgtggtttcaca
AB214516_PreC_P-F      tgttaacactaacatgggcttaaaaattagacaactattggggtttcaca
MG098578_PreC_P-F      tgttaacactcatatgggcttaaagattagacaactattgtggtttcaca
JN688701_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
MG098565_PreC_P-F      tgtcaacaataacatgggcttaaagattagacaattattgtggtttcaca
AB365446_PreC_P-F      tgttaacactcacatgggcttaaagattagacaattattgtggtttcaca
AB365449_PreC_P-F      tgttaacactcacatgggcttaaagattagacaattattgtggtttcaca
KJ843226_PreC_P-F      tgttaacactaacatgggcttaaaaattagacaactattgtggtttcaca
KJ843225_PreC_P-F      tgttaacactaacatgggcttaaaaattagacaactattgtggtttcaca
MG098564_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
DQ823087_PreC_P-F      tgttaacactcacatgggcttaaagattagacaactattgtggtttcaca
KC494398_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843212_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843210_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843209_PreC_P-F      tgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
JX079937_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
FJ657519_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
HQ420165_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
HQ420166_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
DQ823088_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
FJ657528_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
JN811655_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
JN811656_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843211_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843219_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843221_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843222_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843224_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KY382411_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
AF223965_PreC_P-F      tgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
EF576812_PreC_P-F      tgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
KJ843185_PreC_P-F      tgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
AF223962_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
DQ776247_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
DQ823089_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
DQ823090_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
EU366116_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
FJ657522_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
HE981181_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843175_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843189_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843207_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843208_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843213_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843220_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KJ843223_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
KX264499_PreC_P-F      tgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
DQ823086_PreC_P-F      tgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
KP995115_PreC_P-F      tgttaacattaacatgggcctcaaaattagacgactgttgtggtttcaca
KP995097_PreC_P-F      tgttaacactcacatgggcctaaaaattagacaattgttgtggtttcaca
KP995113_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
KP995114_PreC_P-F      tgttaacactcacatgggcctaaaaattagacaactgttgtggtttcaca
KC494399_PreC_P-F      tgttaacactaacatgggcctaaaacttagacaactgttgtggtttcaca
DQ899146_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactactgtggtttcaca
DQ899144_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactactgtggtttcaca
DQ899147_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactactgtggtttcaca
DQ899145_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactactgtggtttcaca
KC494396_PreC_P-F      tgttaacactaacatgggcctaaaagttagacaactgttgtggtttcaca
KT896494_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
KP995107_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
AY254498_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
KP995104_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
AY090455_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
KJ843191_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
KC494405_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
KC494401_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
KC494395_PreC_P-F      tgttaacaccaacatgggcctaaaaattagacaactgttgtggtttcaca
KX264497_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
KC494403_PreC_P-F      tgtcaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
KC494394_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
KC494402_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
X69798_PreC_P-F        tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
KC494397_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
AY311369_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
KP995110_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
DQ899142_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
DQ899143_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
KP995120_PreC_P-F      tgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
FJ589066_PreC_P-F      tgtcaacactcatatgggcctgaaaattagacaactgttgtggtttcaca
KP995101_PreC_P-F      tgtcaacaataatatgggcctgaaaattagacaaatgttgtggtttcaca
AB116550_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacgactgttgtggtttcaca
KP718106_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
X75663_PreC_P-F        tgtcaacactaatatgggcttaaagattagacaactattgtggtttcaca
KP995111_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
FJ589067_PreC_P-F      tgtcaacactcatatgggcctgaaaattagacaactgttgtggtttcaca
KP995105_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
KP995106_PreC_P-F      tgtcaacactaatatgggcctaaaaattagacaaatgttgtggtttcaca
KP995119_PreC_P-F      tgtcaacaataatatgggcctgaaaattagacaactgttatggtttcaca
KP995109_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
KP995118_PreC_P-F      tgtcaacacaaatatgggcctgaaaattagacaactgttgtggtttcaca
DQ899148_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
KP995117_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
KP718103_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
DQ899149_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacagctgttgtggtttcaca
AY311370_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
DQ899150_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB036920_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB036911_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaattgttgtggtttcaca
AB036914_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB036915_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB036916_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB036917_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB036919_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB036905_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB036906_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB036907_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB036909_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB036912_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB036913_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
KX264498_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB036908_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
KJ638659_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
KP995123_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
KP995125_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB116549_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
MH051986_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
MH051987_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
KP995124_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
KP995126_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
AB116551_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
KP718109_PreC_P-F      tgtcaacactaatatgggcctaaaaattagacaactgttgtggtttcaca
KP718112_PreC_P-F      tgtcaacactaatatgggcctaaaaattagacaactgttgtggtttcaca
AB036910_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
KP718111_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
KJ638663_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
KY476329_PreC_P-F      tgtcaatactaacatgggcctaaagattagacaattactgtggtttcaca
KY476330_PreC_P-F      tgtcaatactcacatgggcctaaaaattagacaattactgtggtttcaca
KX757665_PreC_P-F      tgtcaacactaatatgggcctgaaaattagacaattactgtggtttcaca
AB116654_PreC_P-F      tgtcaatactcacatgggcctaaaaattagacaattactgtggtttcaca
FJ657525_PreC_P-F      tgtcaatactcacatgggcctaaaaattagacaattactgtggtttcacr
KY476328_PreC_P-F      tgtcaatactcacatgggcctaaaaattagacaattactgtggtttcacg
AB086397_PreC_P-F      tgtcaatactcacatgggcctaaaaaccagacaattgctgtggtttcaca
KJ638664_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaactactgtggtttcaca
KP718110_PreC_P-F      tgtcaatactcacatgggcctaaaaattagacaattactgtggtttcaca
KY476325_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
KJ638656_PreC_P-F      tgtcaatactcacatgggcctaaaaattagacaattactgtggtttcaca
KP718107_PreC_P-F      tgtcaatactcacatgggcctaaaaattagrcaattactgtggtttcaca
KJ638657_PreC_P-F      tgtcaataytaacatgggcctaaaaattagacawttactgtggtttcaca
KY476324_PreC_P-F      tgtcaatactcacatgggcctaaagattagacaattactgtggtttcaca
FJ589065_PreC_P-F      tgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
AY090459_PreC_P-F      tgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
JX899376_PreC_P-F      tgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
AY090458_PreC_C-F      tgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
AY090461_PreC_P-F      tgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
KP718104_PreC_P-F      tgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
KP718113_PreC_P-F      tgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
KY476327_PreC_P-F      tgtcaatactaacatgggcctaaagattagacaattactgtggtttcaca
HM627320_PreC_P-F      tgtcaatactmacatgggcctaaaaattagacaattactgtggtttcaca
AF223963_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ586805_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctggggtttcaca
JN792916_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacc
EU185743_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843195_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843167_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KC494400_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843190_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843193_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843202_PreC_P-F      tgtcaacactaacatgggcctaaaaattagacaattgctgtggtttcaca
KC494404_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM622135_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
EU185744_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KY382415_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KY382416_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KY382417_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
JN688699_PreC_P-F      tgtcaatactaacatgggcctaaaaattanacaattgctgtggtttcaca
KJ843199_PreC_P-F      tgtcaatactaacatgggcctaaaaattaracaattgctgtggtttcaca
KP995116_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KP995098_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843198_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843194_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843181_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843176_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843174_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843169_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843168_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843163_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ586808_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ586806_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM585193_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcata
EU366133_PreC_P-F      tgtcaatactcacatgggcctaaaaattagacaattgctgtggtttcaca
DQ823091_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM585188_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM590473_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
FJ709494_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM585190_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
FJ709465_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
MK058437_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
FJ709458_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
FJ709459_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM585191_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM585195_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM585198_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
EU366118_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
FJ657529_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843201_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843203_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843206_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
DQ823092_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
DQ823093_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
FJ709460_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
FJ709464_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HQ378247_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843164_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843180_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KM998715_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KY458061_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KY458062_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
AB116552_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
AF223964_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
AY179735_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
DQ823094_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
DQ823095_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
FJ709457_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
FJ709462_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
FJ709463_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HE981182_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM585187_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM585189_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM585192_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM585196_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM585197_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
HM585199_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
JN688691_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
JN688703_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KF199901_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ586807_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843170_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843171_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843179_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843196_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843197_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843200_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843204_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KJ843205_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
KX264496_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
AB064316_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
JN792919_PreC_P-F      tgtcaatattaacatgggcctaaaaattagacgattactgtggtttcaca
KY476331_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
JN792920_PreC_P-F      tgtcaatamtaacatgggcctaaaaattagacaattactgtggtttcaca
JN792917_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
EU670262_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
JN792918_PreC_P-F      tgtcaatactcacatgggcctaaaaattagacaattactgtggtttcaca
KY476332_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
KY476323_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
JX079936_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
JN792914_PreC_P-F      tgtcaatactcacatgggcctaaaaattagacaattactgtggtttcaca
HM585194_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
EU670261_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
HM590474_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
HM585186_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
HM590471_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
HM590472_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
KM233681_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
HM585200_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
JN792922_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
KJ843177_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
KJ843178_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
KY476322_PreC_P-F      tgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
                       *** ** *      ****  * **    *  *         *******  

JN792921_PreC_P-F      tttcctgccttacttttggaagagaaryagttctwgagtatttggtgtcy
MG098582_PreC_P-F      tttcctgccttagttttgaaagagaaacatttcttgagtatttggtgtct
KJ638660_PreC_P-F      tttcctgccttacttttggaagagaagtagttcttgagyatttggtgtcc
MG098584_PreC_P-F      tttcctgccttacttttgggagagaaacagttcttgagtatttggtgtcc
KJ638662_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
AB365453_PreC_P-F      tttcctgtcttatgtttggaagacaaacagttcttgagtatttggtgtcc
MG098569_PreC_P-F      tttcctgcctaacttttgaaagagaaacagttcttgagtatttggtgtcc
JQ272888_PreC_P-F      tttcctgccttatgtttggaagagatacagttcttgagtatttggtgtcc
KJ676694_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
MG098575_PreC_P-F      tttcctgccttacttttggaagacaaacagttattgagtatttggtgtcc
MG098583_PreC_P-F      tttcctgccttatgtttggaagagatacagttcttgagtatttggtgtcc
MG098574_PreC_P-F      tttcctgcctaatttttgaaagaaaaacagttcttgagtatttggagtac
JN688709_PreC_P-F      tttcctgcmttayttttggaagagatacagttcttgagtatttggtgtcc
EU366132_PreC_P-F      tttcctgccttacttttggaagagaaacagttgttgagtatttggtgtcc
MG098566_PreC_P-F      tttcctgccttacttttggaagagaagtacttcttgagtatttggtgtcc
MG098579_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
X75658_PreC_C-F        tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
MG098570_PreC_P-F      tttcctgccttacttttggaagagaantagttcttgagtatttggtgtcc
JN688720_PreC_P-F      tttcctgccttacttttggaagacaaacagttcttgagtatttggtgtcc
EF576808_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtttttggtgtcc
AB365450_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
MG098577_PreC_P-F      tttcctgcctaacttttggaagagaaacagttsttcagtatttggtgtcc
MG098580_PreC_P-F      tttcctgccttacttttgggagagaaacagttcttgagtatttggtgtcc
MG098573_PreC_P-F      tttcctgcctaatgtttggaagagaaacagttcttgagtatttggtgtcc
KY476326_PreC_P-F      tttcctgccttacttttggaagaccaacagttcttgagtatttggtgtcc
AB166850_PreC_P-F      tttcttgccttacttttggaagagaaacagttcttgagtatttggtgtcc
AB214516_PreC_P-F      tttcttgccttacttttggaagagaaacagttcttgagtatttggtgtcc
MG098578_PreC_P-F      tttcctgccttacttttggaagaccaacagttcttgagtatttggtgtct
JN688701_PreC_P-F      tttcctgccttacttttggaagagatacagttcttgagtatttggtgtcc
MG098565_PreC_P-F      tttcctgcctaacttttggaagagaaacagttcttgagtatttggtgtcc
AB365446_PreC_P-F      tttcctgcctttsttttggaagagaaacagttcttgagtatttggtgtcc
AB365449_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843226_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgaatatttggtgtcc
KJ843225_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
MG098564_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
DQ823087_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KC494398_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843212_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843210_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843209_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
JX079937_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
FJ657519_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
HQ420165_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
HQ420166_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
DQ823088_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
FJ657528_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
JN811655_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
JN811656_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843211_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843219_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843221_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843222_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843224_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KY382411_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
AF223965_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
EF576812_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843185_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
AF223962_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
DQ776247_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
DQ823089_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
DQ823090_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
EU366116_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
FJ657522_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
HE981181_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843175_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843189_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843207_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843208_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843213_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843220_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843223_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KX264499_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
DQ823086_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KP995115_PreC_P-F      tttcctgcatcatgtttggaagagacctagttcttgagtatttggtgtct
KP995097_PreC_P-F      tttcctgccttacttttggaagagaaacagttgttcagtatttggtgtcc
KP995113_PreC_P-F      tttcctgcctcacttttggaacacaaacagttgttgagtatttggtgtct
KP995114_PreC_P-F      tttcctgcctcacttttggaagacaagtagttcttgagtatttggtgtct
KC494399_PreC_P-F      tttcctgccttacttttggaagagaaacagttgtagagtatttggtgtcc
DQ899146_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
DQ899144_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
DQ899147_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
DQ899145_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KC494396_PreC_P-F      tttcctgccttacttttggaagagaaacagttctcgagtatttggtgtcc
KT896494_PreC_P-F      tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcc
KP995107_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtctcc
AY254498_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KP995104_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
AY090455_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ843191_PreC_P-F      tttcctgccttacttttggaagagaaacagttttagagtatttggtgtcc
KC494405_PreC_P-F      tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcc
KC494401_PreC_P-F      tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcc
KC494395_PreC_P-F      tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcc
KX264497_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KC494403_PreC_P-F      tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcc
KC494394_PreC_P-F      tttcctcccttacttttggaagagaaacagttctagagtatttggtgtcc
KC494402_PreC_P-F      tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcc
X69798_PreC_P-F        tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcc
KC494397_PreC_P-F      tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcc
AY311369_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KP995110_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
DQ899142_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
DQ899143_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
KP995120_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcc
FJ589066_PreC_P-F      tttcctgtcttacttttggaagagatacagttattcagtatttggtgtcc
KP995101_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtct
AB116550_PreC_P-F      tttcctgtcttacttttggaagacaagtagttcttgagtatttggtgtcc
KP718106_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgartatttggtgtcc
X75663_PreC_P-F        tctcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KP995111_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
FJ589067_PreC_P-F      tttcctgtctgacttttggaagagacacagttcttgagtatttggtgtcc
KP995105_PreC_P-F      tttcctgtcttacttttggaagagacacagttcttgagtatttggtgtcc
KP995106_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KP995119_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KP995109_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KP995118_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
DQ899148_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KP995117_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KP718103_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgaatatttggtgtcc
DQ899149_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AY311370_PreC_P-F      tttcctgtcttacgtttggaagagaaacagttcttgagtatttggtgtcc
DQ899150_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036920_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036911_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036914_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036915_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036916_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036917_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036919_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036905_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036906_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036907_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036909_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036912_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036913_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KX264498_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036908_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ638659_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KP995123_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KP995125_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB116549_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
MH051986_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
MH051987_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KP995124_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KP995126_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB116551_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KP718109_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KP718112_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
AB036910_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtctcc
KP718111_PreC_P-F      tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcc
KJ638663_PreC_P-F      tttcctgccttacttttggaagagaaacggttcttaactatttggtgtct
KY476329_PreC_P-F      tttcctgccttacttttggaagagaagtagttcttgagtatttggtgtct
KY476330_PreC_P-F      cttcctgccttacttttggaagagaagtagttcttgaatatttggtgtct
KX757665_PreC_P-F      tctcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcy
AB116654_PreC_P-F      tttcctgccttacttttggaagacaaacagttctggagtatttggtgtct
FJ657525_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KY476328_PreC_P-F      tttcctgccttacttttggaagagaagtagttcttgagtatttggtgtct
AB086397_PreC_P-F      tttcctgccttagttttggaagagaaacagttcttgagtatttggtgtct
KJ638664_PreC_P-F      tttcctgccttacttttggaagaactacagttcttgagtatttggtgtct
KP718110_PreC_P-F      tttcctgcattatttttggaagagatatagttcttgartatttggtgtct
KY476325_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ638656_PreC_P-F      tttcctgccttacttttggaagacaaacagttcttgagtatttggtgtct
KP718107_PreC_P-F      tttcctgccttacttttggaagmaacacagttcttgagtatttggtgtct
KJ638657_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KY476324_PreC_P-F      tttcctgccttacttttggaagagaagtagttattgagtatttggtgtct
FJ589065_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
AY090459_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
JX899376_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
AY090458_PreC_C-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
AY090461_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KP718104_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KP718113_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KY476327_PreC_P-F      tttcctgccttacgtttggaagagaaacagttcttgagtatttggtgtct
HM627320_PreC_P-F      tttcctgccttacttttggaagagaaryagttcttgagtatttggtgtct
AF223963_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ586805_PreC_P-F      tttcctcccttacttttggaagagaaacagttcttgagtatttggtgttt
JN792916_PreC_P-F      tttcctgcattacttttggaagagaaacagttcttgagtatttggtgtct
EU185743_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843195_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843167_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KC494400_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843190_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatctggtgtct
KJ843193_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatctggtgtct
KJ843202_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KC494404_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM622135_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
EU185744_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KY382415_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KY382416_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KY382417_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
JN688699_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843199_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KP995116_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KP995098_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843198_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843194_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843181_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843176_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843174_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843169_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843168_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843163_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ586808_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ586806_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585193_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
EU366133_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
DQ823091_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585188_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM590473_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
FJ709494_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585190_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
FJ709465_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
MK058437_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
FJ709458_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
FJ709459_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585191_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585195_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585198_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
EU366118_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
FJ657529_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843201_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843203_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843206_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
DQ823092_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
DQ823093_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
FJ709460_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
FJ709464_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HQ378247_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843164_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843180_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KM998715_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KY458061_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KY458062_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
AB116552_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
AF223964_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
AY179735_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
DQ823094_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
DQ823095_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
FJ709457_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
FJ709462_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
FJ709463_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HE981182_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585187_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585189_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585192_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585196_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585197_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585199_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
JN688691_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
JN688703_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KF199901_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ586807_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843170_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843171_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843179_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843196_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843197_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843200_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843204_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843205_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KX264496_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
AB064316_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
JN792919_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KY476331_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
JN792920_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
JN792917_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
EU670262_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
JN792918_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KY476332_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KY476323_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
JX079936_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
JN792914_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585194_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
EU670261_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM590474_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585186_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM590471_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM590472_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KM233681_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
HM585200_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
JN792922_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843177_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KJ843178_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
KY476322_PreC_P-F      tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtct
                         ** *   *    ****  *         ** *  *   * ***  *  

JN792921_PreC_P-F      tttggagtgtggattcgcactcctcctgcttayagaccaccaaatgcccc
MG098582_PreC_P-F      tttgaagtgtggattcgcactcctccagcttatagaccaccaaatgccct
KJ638660_PreC_P-F      ttcggagtgtggattcgcactcctcctgcgtataggccaccaaatgcccc
MG098584_PreC_P-F      tttggagtgtggattcccactcctcctgcatataaaccacaaaatgcccc
KJ638662_PreC_P-F      tttggagtgtggattcgcactcctcctgcgtataggccaccaaatgcccc
AB365453_PreC_P-F      tttggagtgtggattcgcactcctcctgcttatagaccacaaaatgcccc
MG098569_PreC_P-F      tttggagtgtggcttcgcactcctccagcttatagaccaccaaatgcccc
JQ272888_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ676694_PreC_P-F      tttggagtgtggattcgcactcctcctacatatagaccaccaaatgcccc
MG098575_PreC_P-F      tttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccc
MG098583_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccacaaaatgcccc
MG098574_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
JN688709_PreC_P-F      tttggagtgtggattcgcactcctcmagcttatagaccaccaaatgcccc
EU366132_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
MG098566_PreC_P-F      tttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccc
MG098579_PreC_P-F      tttggagtgtggattcgcactcctgcaccttatagaccaccaaatgcccc
X75658_PreC_C-F        tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
MG098570_PreC_P-F      tttggggtgtggatacgcactcctctaccttatagaccaccaaatgcccc
JN688720_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccacaaaatgcccc
EF576808_PreC_P-F      tttggagtgtggattcgcactcctccagcttataggccaccaaatgcccc
AB365450_PreC_P-F      tytggagtgtggatacgcactcctccascttatagaccaccaaatgcccc
MG098577_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
MG098580_PreC_P-F      tttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccc
MG098573_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccagcaaatgcccc
KY476326_PreC_P-F      tttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccc
AB166850_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
AB214516_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
MG098578_PreC_P-F      tttggagtgtggattcgcactcctgcaccttatagaccaccaaatgcccc
JN688701_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
MG098565_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
AB365446_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
AB365449_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843226_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843225_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
MG098564_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgccct
DQ823087_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KC494398_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843212_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843210_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagacgaccaaatgcccc
KJ843209_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
JX079937_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
FJ657519_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
HQ420165_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
HQ420166_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
DQ823088_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
FJ657528_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
JN811655_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
JN811656_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843211_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843219_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843221_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843222_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843224_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KY382411_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
AF223965_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
EF576812_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843185_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
AF223962_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
DQ776247_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
DQ823089_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
DQ823090_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
EU366116_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
FJ657522_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
HE981181_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843175_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843189_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843207_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843208_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843213_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843220_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KJ843223_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KX264499_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
DQ823086_PreC_P-F      tttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc
KP995115_PreC_P-F      tttggagtgtggattcgcactcctccaaattatagaccaccaaatgcccc
KP995097_PreC_P-F      tttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccc
KP995113_PreC_P-F      tttggagtgtggattcgcactcctcttccttatagaccaccaaatgcccc
KP995114_PreC_P-F      tttggagtgtggattcgcactcctgctccttatagaccaccaaatgcccc
KC494399_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccagtaaatgcccc
DQ899146_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccc
DQ899144_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccc
DQ899147_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccc
DQ899145_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccc
KC494396_PreC_P-F      tttggagtgtggattcgcactcctccggcttatagaccaccaaatgcccc
KT896494_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccc
KP995107_PreC_P-F      tttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccc
AY254498_PreC_P-F      tttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccc
KP995104_PreC_P-F      tttggagtgtggattcgcactcctcttgcttatagaccaccaaatgcccc
AY090455_PreC_P-F      tttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccc
KJ843191_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccc
KC494405_PreC_P-F      tttggagtgtggattcgcacacctcctgcttacagaccaccaaatgcccc
KC494401_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccc
KC494395_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccc
KX264497_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccc
KC494403_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccc
KC494394_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccc
KC494402_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccc
X69798_PreC_P-F        tttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccc
KC494397_PreC_P-F      tttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccc
AY311369_PreC_P-F      tttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccc
KP995110_PreC_P-F      tttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccc
DQ899142_PreC_P-F      tttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccc
DQ899143_PreC_P-F      tttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccc
KP995120_PreC_P-F      tttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccc
FJ589066_PreC_P-F      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
KP995101_PreC_P-F      tttggagtgtggattcgcactccacctccctatagaccaccaaatgcccc
AB116550_PreC_P-F      tttggagtgtggattcgcactccacctgcttatagaccagcaaatgcccc
KP718106_PreC_P-F      tttggagtgtggattcscactccacctgcttatasaccaccaaatgcccc
X75663_PreC_P-F        tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
KP995111_PreC_P-F      tttggagtgtggattcgcactccacctccttatagaccaccaaatgcccc
FJ589067_PreC_P-F      tttggagtgtggattcgcactccacctccttatagaccaccaaatgcccc
KP995105_PreC_P-F      tttggagtgtggattcgcactccacctgcttatagacctccaaatgcccc
KP995106_PreC_P-F      tttggagtgtggattcgcactccacaggcttatagaccaccaaatgcccc
KP995119_PreC_P-F      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
KP995109_PreC_P-F      tttggagtgtggattcgcactccacctgtttatagaccaccaaatgcccc
KP995118_PreC_P-F      tttggagtgtggattcgcactccacctgcttataggccaccaaatgcccc
DQ899148_PreC_P-F      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
KP995117_PreC_P-F      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
KP718103_PreC_P-F      tttggggtgtggattcgcactccacctgcttatagaccaccaaatgcccc
DQ899149_PreC_P-F      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
AY311370_PreC_P-F      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
DQ899150_PreC_P-F      tttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccc
AB036920_PreC_P-F      tttggagtgtggattcgcactccacctgcttataggccaccaaatgcccc
AB036911_PreC_P-F      tttggagtgtggattcgcactccacctgcttataggccaccaaatgcccc
AB036914_PreC_P-F      tttggagtgtggattcgcactccacctgcttataggccaccaaatgcccc
AB036915_PreC_P-F      tttggagtgtggattcgcactccacctgcttataggccaccaaatgcccc
AB036916_PreC_P-F      tttggagtgtggattcgcactccacctgcttataggccaccaaatgcccc
AB036917_PreC_P-F      tttggagtgtggattcgcactccacctgcttataggccaccaaatgcccc
AB036919_PreC_P-F      tttggagtgtggattcgcactccacctgcttataggccaccaaatgcccc
AB036905_PreC_P-F      tttggagtgtggattcgcactccacctgcttataggccaccaaatgcccc
AB036906_PreC_P-F      tttggagtgtggattcgcactccacctgcttataggccaccaaatgcccc
AB036907_PreC_P-F      ttt