HBVdb

Dataset for nucleotide sequence Genomes of genotype F

[Download (right click)] [Edit] [Sequences] [Repertoires]

303 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


JN792921_FT00000_P-F      ctcmactcagttccaccarrctctgttaratccsagggtaagggctctgt
KJ638662_FT00000_P-F      cacaacccagttccaccaggctctgttggatccaarggtaagggctctgt
KJ638660_FT00000_P-F      caccacccagttccaccaggctcttcaagatcccagagtcagggccctgt
KJ638663_FT00000_P-F      ctccactctgttccaccaggctctgttagatccgagggtaagggctctgt
KJ638664_FT00000_P-F      gtggaacactttccaccaggctctgttagatccgaaggtaagggctctgt
KJ638657_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KP718107_FT00000_P-F      ctccactcagttccatcaggctctgttagatccgagggtaagggctctgt
AB116654_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
AY090458_FT00000_C-F      ctcaactcagttccaccaggctctgttagatccgagggtaagggctctgt
KP718113_FT00000_P-F      ctcaactcagttccaccaggctctgttagatccgagggtaagggctctgt
KP718104_FT00000_P-F      ctcaactcagttccaccaggctctgttagatccgagggtaagggctctgt
AY090461_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AY090459_FT00000_P-F      ctcaactcagttccaccaggctctgttagatccgagggtaagggctctgt
FJ657525_FT00000_P-F      ctcaactcagttccaccaggctctgttagatccgagggtaagggctctgt
MG877700_FT00000_P-F      ctcaactcagttccaccaggctctgttagatccgagggtaagggctctgt
KY476329_FT00000_P-F      cacccctcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ638656_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KP718110_FT00000_P-F      ctccaatcagttccaccaggctctgttagatccgagggtaagggctctgt
KY476330_FT00000_P-F      ttccactcagttccaccaggctctgttagatccgagggtaagggctctgt
AB086397_FT00000_P-F      ctccactcagttccaccaggmtctgttagatccgagggtaagggctctgt
KY476324_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KY476325_FT00000_P-F      ctccactcagtttcaccaggctctgttagatccgagggtaagggctctgt
KY476328_FT00000_P-F      ctccactcagtttcaccaggctctgttagatccaagggtaagggctctgt
KY476327_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagagctctgt
KP995116_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ586807_FT00000_P-F      ctcccctcaattccaccagggtctgttaattcccagggtaaagggtctcc
KY382416_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KY382417_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KY382415_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KF199901_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ586806_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ586805_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
OK106257_FT00000_P-F      ctcaactcagttccaccaggctctgttagatccgagggtaagggctctgt
AF223963_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843202_FT00000_P-F      ctccactcagttccaccagactctgttagatccgagggtaagggctctgt
KC494400_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843193_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
AB064316_FT00000_P-F      ttccactcagttccaccagactctgttagatccgagggtaagggctctgt
HM622135_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KC494404_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
DQ823091_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843167_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843195_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843200_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843199_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843196_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843197_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
AF223964_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
JN688699_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843170_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
JN688703_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
JN688691_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843169_FT00000_P-F      ctccactcagttccaccagactctgttagatccgagagtaagggctctgt
KJ843168_FT00000_P-F      ctccactcagttccaccagactctgttagatccgagagtaaggg------
EU366133_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
MK058437_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
FJ709462_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
KJ843194_FT00000_P-F      ctccactcagttccaccagactctgttagatccgagggtaagggctctgt
KJ843181_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
FJ709457_FT00000_P-F      ctccactcagttccaccagactctgttagatccgagagtaagggctctgt
KJ843163_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
KJ843205_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KP995098_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843174_FT00000_P-F      ctccactcagttccaccacgctctgttagatcccagggtaagggctctgt
KJ586808_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
FJ709465_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaaggactctgt
FJ709459_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
FJ709458_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HM585198_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HM585191_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HM585195_FT00000_P-F      cgccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HE981182_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HE981183_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HM585187_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843171_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HM585189_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HM585196_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HM585188_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HM590473_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HM585190_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HM585199_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
FJ709494_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843204_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
AB116552_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843190_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KY458062_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HM585192_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
KJ843164_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
AY179735_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
HM585193_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
KM998715_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KY458061_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843180_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
FJ709463_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
HM585197_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
KJ843179_FT00000_P-F      ttccactcagttccaccaggctctgttagatccgagagtaagggctctgt
KJ843203_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
KJ843176_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
FJ709460_FT00000_P-F      ctccactcagttccaccagactctgttagatccgagagtaagggctctgt
DQ823094_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
DQ823095_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
DQ823092_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KX264496_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HQ378247_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
FJ709464_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
DQ823093_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843198_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
KJ843201_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
FJ657529_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
EU366118_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
KJ843206_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
EU670262_FT00000_P-F      ctccactcagttccatcaggctctgttagatccgagggtaagggctctgt
KY476331_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HM627320_FT00000_P-F      ctccactcagttccaccaggctctgtyagatccgagggtaagggmyctgt
HM585200_FT00000_P-F      ctccactctgttccaccaggctctgttagatccgagggtaagggctctgt
HM585194_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
HM590474_FT00000_P-F      ttccactcagtttcaccaggctctgttagatccgagggtaagggctctgt
HM590472_FT00000_P-F      ttccactcagtttcaccaggctctgttagatccgagggtaagggctctgt
HM585186_FT00000_P-F      ttccactcagtttcaccaggctctgttagatccgagggtaagggctctgt
HM590471_FT00000_P-F      ttccactcagtttcaccaggctctgttagatccgagggtaagggctctgt
KM233681_FT00000_P-F      ttccactcagtttcaccaggctctgttagatccgagggtaagggctctgt
JN792916_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctc---
JN792919_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KJ843178_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
KJ843177_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
JX079936_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagagtaagggctctgt
KY476323_FT00000_P-F      ctccactcagtttcaccaggctctgttagctccgagggtaagggctctgt
KY476322_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
KY476332_FT00000_P-F      ctccactcagttccatcaggctctgttagatccgagggtaagggctctgt
JN792922_FT00000_P-F      ctccactcagttccaccagactctgttagatccgagggtaagggctctgt
JN792920_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
JN792918_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggatctgt
JN792917_FT00000_P-F      ctccactcagttccaccagactctgttagatccgagggtaagggatctgt
JN792914_FT00000_P-F      ctccactcagttccaccaggctctgttagatccgagggtaagggctctgt
X75663_FT00000_P-F        ctcaactcacttccaccaagctctgttggatcccagggtaagggcactgt
KP995101_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
KP995111_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgaaggtaacggctctgt
KP995118_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
KP718106_FT00000_P-F      ctcaacccagttccaccaggctctgctagatccgagggtaagggctctgt
KP995105_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
FJ589066_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
FJ589067_FT00000_P-F      ctcaactcagttccaccaggctctgttggatccgagggtaagggctctgt
AB116550_FT00000_P-F      ctcaacccagttccaccaggctctgttggatccgaagggtaaggctttgt
KP995106_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgcgggtaagggctctgt
KP718103_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
KP995117_FT00000_P-F      ctcaacccagttccaccaggctctgttaaatccgagggtaagggctctgt
KP995119_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
DQ899148_FT00000_P-F      ctcaacccagttccaccaggctctgtcagatccgagggtaagggctctgt
AB036908_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB036913_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB036920_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB036906_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB036907_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB036911_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB036905_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB036909_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB036912_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
KX264498_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB036915_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB036914_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB036917_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB036916_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB036919_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
DQ899150_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
KP995125_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
KP995123_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
AB116549_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
KJ638659_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
KP995124_FT00000_P-F      ctcaacccagttccatcaggctctgttagatccgagggtaagggctctgt
KP995126_FT00000_P-F      ctcaacccagttccatcaggctctgttagatccgagggtaagggctctgt
AY311370_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
KP718111_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
MH051987_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
MH051986_FT00000_P-F      ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgt
DQ899149_FT00000_P-F      ctcaactcagttccaccaggctctgttggatccgagggtaagggctctgt
KP995109_FT00000_P-F      ttcaactcagttccaccaggctctgttggatccgagggtaagggctctgt
AB036910_FT00000_P-F      ctcaactcagttccaccaggctctgttggatccgagggtaagggctctgt
AB116551_FT00000_P-F      ttcaactcagttccaccaggctctgttggatccgagggtaagggctctgt
KP718112_FT00000_P-F      ctcaactcagttccaccaggctctgttggatccgagggtaagggctctgt
KP718109_FT00000_P-F      ctcaactcagttccaccaggctctgttggatccgagggtaagggctctgt
DQ899147_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
DQ899146_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaaaggctctgt
DQ899145_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
DQ899144_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaaaggctctgt
KP995114_FT00000_P-F      ctcaagcaagttccaccagcatctgttggaacccggggtaagggctctgt
KP995097_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
KP995115_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
KP995113_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
KC494399_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
KP995104_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
KP995107_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
KC494396_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtatgggctctgt
DQ899142_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccatggtaagggctctgt
DQ899143_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
AY090455_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
KT896494_FT00000_P-F      ctcaacccagttccaccaacttctgttggatcccagggtaagggctctgt
AY311369_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
KP995110_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtgagggctctgt
KJ843191_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
KP995120_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
KC494394_FT00000_P-F      ctcaacccagttccaccaagctctgttggatcccagggtaagggctctgt
KC494397_FT00000_P-F      ctcaacccagttccaccaagctctgttggatcccagggtaagggctctgt
KC494401_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
KC494405_FT00000_P-F      ctcaacccagttccaccaagctctgttggatcccagggtaagggctctgt
KC494403_FT00000_P-F      ctcaacccagttccaccaagctctgttggatcccagggtaagggctctgt
KC494402_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
KX264497_FT00000_P-F      ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgt
X69798_FT00000_P-F        ctcaacccagttccaccaagctctgttggatcccagggtaagggctctgt
KC494395_FT00000_P-F      ctcaacccagttccaccaagctctgttggatcccagggtaagggctctgt
JQ272888_FT00000_P-F      ctcagccaagttccaccaggccttgttggatccgagggtaagggctctgt
JN688720_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MG098582_FT00000_P-F      ctcatccgagttccaccaggccctgttggatccgagggtaagggctctgt
MG098579_FT00000_P-F      ctcaacccagttccaccatgccctgttggatccgagggtagcggc-----
MG877717_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MG877715_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MG877716_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MG877708_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
MG877706_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
MG877707_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
MK183632_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
MG098578_FT00000_P-F      ctcatccgagttccaccaggccctgttggatccgagggtaagggctctgt
MG098577_FT00000_P-F      ctcaatccagttccaccgggccttgttggatccgagggtaagggctctgt
AB365453_FT00000_P-F      ctcatcccagttccatcaggccttgttggatccgagggtaagggctctgt
KY476326_FT00000_P-F      ctcatcccagttccaccaggccctgttggatccgagggtaagggctctgt
MG098569_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
JN688709_FT00000_P-F      ctcaacccagttccactcaacccagttggatccgagggtaagggctctgt
X75658_FT00000_C-F        ctcaactcacttccaccaggctctgttggatccgagggtaagggcactgt
AB214516_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MG098570_FT00000_P-F      ctcaacccagttccaccaggccctgttgcatccgggggtaagggctctgt
KJ843225_FT00000_P-F      ctcaatccagttccaccaggccctgttggatcagagggtaaggactctgt
EF576808_FT00000_P-F      ctccacccagttccaccaggccttgttggatccgagggtaaggggtctgt
MK183636_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
AB166850_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MG098575_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
MG098583_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
MG098566_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MG098574_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MK183631_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MK183645_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MG877714_FT00000_P-F      ctcaactcagttccaccagrccctgttggacccgagggtaagggctctgt
MG877712_FT00000_P-F      ctcaacccagttccaccaggccctgttggacccgagggtaagggctctgt
EU366132_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MG098573_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
MG098565_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
MG877722_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MG877721_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MG098580_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
AB365450_FT00000_P-F      ctcaacccagttccatcaggccttgttggatccgagggtaagggctctgt
MG877704_FT00000_P-F      ctcaacccagttccaccrggccttgttggatccgagggtaagggctctgt
MG877705_FT00000_P-F      ctcaacccagttccaccrggccttgttggatccgagggtaagggctctgt
KJ843185_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
AB365449_FT00000_P-F      ctcaacccagttccatcaggccttgttggatccgagggtaagggctctgt
MG877703_FT00000_P-F      ctcaacccagttccaccgggccttgttggatccgagggtaagggctctgt
AB365446_FT00000_P-F      ctcaacccagttccatcaggccttgttggatccgagggtaagggctctgt
KJ843226_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagagtaagggctctgt
MK183640_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
MK183643_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgaaggtaagggctctgt
KJ843209_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
MK183633_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgaaggtaagggctctgt
MK183638_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
MK183644_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgaaggtaagggctctgt
MK183639_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
MK183630_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
JN688701_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
DQ823087_FT00000_P-F      ctcagccaagttccaccaggccctgttggatccgagggtaagggctctgt
DQ823086_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
KJ843223_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaaaggctctgt
DQ823089_FT00000_P-F      ctcaacccagttccaccaggtcctgttggatccgagggtaaaggctctgt
KJ843175_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KJ843189_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
EF576812_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
AF223965_FT00000_P-F      ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgt
DQ823088_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MG098564_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
JN811655_FT00000_P-F      ctcaacccagttccaccaggctctgttggatccgagggtaagggctctgt
KJ843211_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MK183641_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KJ843212_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
FJ657528_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MK183647_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KJ843221_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KY382411_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KJ843222_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KJ843219_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KJ843224_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
AF223962_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KJ843207_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
JN811656_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
JX079937_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KJ843220_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KX264499_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KC494398_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
HE981181_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
DQ823090_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KJ843213_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
FJ657522_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KJ843208_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
KJ843210_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
FJ657519_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtawgggctctgt
EU366116_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
DQ776247_FT00000_P-F      ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgt
MG098584_FT00000_P-F      ctcaacccagttccaccaggccctgttagacccaagggtaagggctctgt
KJ676694_FT00000_P-F      ctcaacccagtttcaccaggccctgttagacccaagggtaagggctctgt
                                    ** **                *     *            

JN792921_FT00000_P-F      ayttycctgctggtggctccagttcagrgacacagaaccctgctccgact
KJ638662_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ638660_FT00000_P-F      tgagtcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ638663_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ638664_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ638657_FT00000_P-F      gtgttcctgctggtggctccagttcagagacacagaaccctgctccgact
KP718107_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
AB116654_FT00000_P-F      attttcctgctgggggctccagttcagagacacagaaccctgctccgact
AY090458_FT00000_C-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KP718113_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KP718104_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
AY090461_FT00000_P-F      actttcctgctggtggctccagttcagagacacagaaccctgctccgact
AY090459_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ657525_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MG877700_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY476329_FT00000_P-F      gttttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ638656_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KP718110_FT00000_P-F      atcttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY476330_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
AB086397_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY476324_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY476325_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY476328_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY476327_FT00000_P-F      attttcctgctggtggctccagttcagagacacagcaccctgctccgatt
KP995116_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ586807_FT00000_P-F      tgctggttgctggtgggtccagttccaagacacagaaccctgctccgact
KY382416_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY382417_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY382415_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KF199901_FT00000_P-F      attttcctgctgggtgctccagttcagagacacagaaccctgctccgact
KJ586806_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ586805_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
OK106257_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
AF223963_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843202_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KC494400_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843193_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
AB064316_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM622135_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KC494404_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
DQ823091_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843167_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843195_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843200_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843199_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843196_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843197_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
AF223964_FT00000_P-F      attttcatgctggtggctccagttcaggcacgcagaaccctgctccgact
JN688699_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843170_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
JN688703_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
JN688691_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843169_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843168_FT00000_P-F      ------ctgctggtggctccagttcagagacacagaaccctgctccgact
EU366133_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MK058437_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ709462_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843194_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843181_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ709457_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843163_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843205_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KP995098_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843174_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ586808_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ709465_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ709459_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ709458_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585198_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585191_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585195_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HE981182_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HE981183_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585187_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843171_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585189_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585196_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585188_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM590473_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585190_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585199_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ709494_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843204_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
AB116552_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843190_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY458062_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585192_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843164_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
AY179735_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585193_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KM998715_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY458061_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843180_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ709463_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585197_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843179_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843203_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843176_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ709460_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
DQ823094_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
DQ823095_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
DQ823092_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KX264496_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HQ378247_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ709464_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
DQ823093_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843198_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843201_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ657529_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
EU366118_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843206_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
EU670262_FT00000_P-F      attttcctgctagtggctccagttcagagacacagaaccctgctccgact
KY476331_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM627320_FT00000_P-F      atttkcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585200_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585194_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM590474_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM590472_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM585186_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HM590471_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KM233681_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
JN792916_FT00000_P-F      ------ctgctggtggctccagttcagagacacagaaccctgctccgact
JN792919_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843178_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843177_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
JX079936_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY476323_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY476322_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY476332_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
JN792922_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
JN792920_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
JN792918_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
JN792917_FT00000_P-F      atcttcctgctggtggctccagttcagagacacagaaccctgctccgact
JN792914_FT00000_P-F      ------ctgctggtggctccagttcagagacacagaaccctgctccgact
X75663_FT00000_P-F        attttcctgctggtggctccagttcaggaacacagaaccctgctccgact
KP995101_FT00000_P-F      attttcctgctggtggctccagtccaggaacacaaaaccctgttccgact
KP995111_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP995118_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP718106_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP995105_FT00000_P-F      atcttcctgctggtggctccagttcagggacacagaaccctgctccgact
FJ589066_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
FJ589067_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
AB116550_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP995106_FT00000_P-F      atcttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP718103_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP995117_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP995119_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
DQ899148_FT00000_P-F      atcttcctgctggtggctccagttcagggacacagaaccctgctccgact
AB036908_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
AB036913_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
AB036920_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
AB036906_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
AB036907_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
AB036911_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
AB036905_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
AB036909_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
AB036912_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
KX264498_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
AB036915_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
AB036914_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
AB036917_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
AB036916_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
AB036919_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
DQ899150_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP995125_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP995123_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
AB116549_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
KJ638659_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP995124_FT00000_P-F      atcttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP995126_FT00000_P-F      atcttcctgctggtggctccagttcagggacacagaaccctgctccgact
AY311370_FT00000_P-F      atcttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP718111_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
MH051987_FT00000_P-F      attttcctgctggtggctccagttcagggacgcagaaccctgctccgact
MH051986_FT00000_P-F      attttcctgctggtggctccagttcagggacgcagaaccctgctccgact
DQ899149_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgttccgact
KP995109_FT00000_P-F      cttttcctgctggtggctccagttcagggacacagaaccctgctccgact
AB036910_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
AB116551_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP718112_FT00000_P-F      attttcctgctggtggctccagttcagggacacagaaccctgctccgact
KP718109_FT00000_P-F      attctcctgctggtggctccagttcagggacacagaaccctgctccgact
DQ899147_FT00000_P-F      atcttcctgctggtggctccagttcaaggacacaaaaccctgctccgact
DQ899146_FT00000_P-F      attttcctgctggtggctccagttcaggaacacaaaaccctgctccgact
DQ899145_FT00000_P-F      attttcctgctggtggctccagttcaggaacacaaaaccctgctccgact
DQ899144_FT00000_P-F      attttcctgctggtggctccagttcaggaacacaaaaccctgctccgact
KP995114_FT00000_P-F      gtctccctgctggtggctccagttcagggacacagaaccctgctccgact
KP995097_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KP995115_FT00000_P-F      atttccctgctggtggctccagttcagggacacagaaccctgctccgact
KP995113_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KC494399_FT00000_P-F      acttccctgctggtggctccagttcaggaacacagaaccctgctccgact
KP995104_FT00000_P-F      acctccctgctggtggctccagttcagggacacaaaaccctgctccgact
KP995107_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KC494396_FT00000_P-F      actttcctgctggtggctccagttcagggacacagaaccctgctccgact
DQ899142_FT00000_P-F      atttccctgctggtggctccagttcagggacacagaaccctgctccgact
DQ899143_FT00000_P-F      acttccctgctggtggctccagttcagagacacagaaccctgctccgact
AY090455_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KT896494_FT00000_P-F      gcttccctgctggtggctccagttcagggacacagaaccctgctccgact
AY311369_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KP995110_FT00000_P-F      acttccctgctggtggctccagttcagggacacaaaaccctgctccgact
KJ843191_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KP995120_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KC494394_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KC494397_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KC494401_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KC494405_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KC494403_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KC494402_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KX264497_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
X69798_FT00000_P-F        acttccctgctggtggctccagttcagggacacagaaccctgctccgact
KC494395_FT00000_P-F      acttccctgctggtggctccagttcagggacacagaaccctgctccgact
JQ272888_FT00000_P-F      atcttcctgctggtggctccagttcagagacgcagaaccctgctccgact
JN688720_FT00000_P-F      attttcctgctggtggctccagttcagacacacagaaccctgctccgact
MG098582_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MG098579_FT00000_P-F      ----tcctgctggtgcatacagttcagagacaccaaaccctgctccgact
MG877717_FT00000_P-F      atcttcctgctggtggctccagttcagagacacaaaaccctgctccgact
MG877715_FT00000_P-F      atcttcctgctggtggctccagttcagagacacaaaaccctgctccgact
MG877716_FT00000_P-F      atcttcctgctggtggctccagttcagagacacaaaaccctgctccgact
MG877708_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MG877706_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MG877707_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MK183632_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MG098578_FT00000_P-F      atcttcctgctggtggctccacttcaaagacacagaaccctgctccgact
MG098577_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
AB365453_FT00000_P-F      atcttcctgctggtggctccagttcagagacgcagaaccctgctccgact
KY476326_FT00000_P-F      atyttcctgctggtggctccagttcagagacacagaaccctgctccgact
MG098569_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
JN688709_FT00000_P-F      atyttcctgctggtggctccagttcagagacacagaaccttgctcagact
X75658_FT00000_C-F        attttcctgctggtggctccagttcaggcacgcagaaccctgctccgact
AB214516_FT00000_P-F      ctcctcctgctggtggctccagttcagagacacagaaccctgctccgact
MG098570_FT00000_P-F      atcttcctgctggtggctccagttcagagacgcaaaaccctgctccgact
KJ843225_FT00000_P-F      gtcttcctgctggtggctccagttcagagacacagaaccctgctccgact
EF576808_FT00000_P-F      atcttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MK183636_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccaact
AB166850_FT00000_P-F      ctcctcctgctggtggctccagttcagagacacagaaccctgctccgact
MG098575_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MG098583_FT00000_P-F      attttcctgctggtggctccagttcagagacgcaaagccctgctccgact
MG098566_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MG098574_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MK183631_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MK183645_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MG877714_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MG877712_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
EU366132_FT00000_P-F      atcttyctgctggtggctccagttcagagacacagaaccctgctccgact
MG098573_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MG098565_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MG877722_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MG877721_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MG098580_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
AB365450_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MG877704_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MG877705_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
KJ843185_FT00000_P-F      atcttcctgctggtggctccagttcagagacgcagaaccctgctccgact
AB365449_FT00000_P-F      atcttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MG877703_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
AB365446_FT00000_P-F      atcttcctgctggtggctccagttcagagacgcagaaccctgctccgact
KJ843226_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MK183640_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MK183643_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
KJ843209_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MK183633_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MK183638_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MK183644_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MK183639_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
MK183630_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
JN688701_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
DQ823087_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
DQ823086_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
KJ843223_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
DQ823089_FT00000_P-F      attatcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843175_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843189_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
EF576812_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
AF223965_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
DQ823088_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MG098564_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
JN811655_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843211_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MK183641_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843212_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ657528_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MK183647_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843221_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KY382411_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843222_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843219_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843224_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
AF223962_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843207_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
JN811656_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
JX079937_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843220_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KX264499_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KC494398_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
HE981181_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
DQ823090_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843213_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ657522_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843208_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
KJ843210_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
FJ657519_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
EU366116_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
DQ776247_FT00000_P-F      attttcctgctggtggctccagttcagagacacagaaccctgctccgact
MG098584_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
KJ676694_FT00000_P-F      attttcctgctggtggctccagttcagagacgcagaaccctgctccgact
                                 **** *    * ** * *    ** *    ** ** **  * *

JN792921_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ638662_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgttat
KJ638660_FT00000_P-F      attgcctctctcacatcatcaatcttcwcgaagactgggggccctgttat
KJ638663_FT00000_P-F      attgcctctcgcacatcatcaatctccgtgaagactggggaccctgctgt
KJ638664_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
KJ638657_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
KP718107_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
AB116654_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
AY090458_FT00000_C-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
KP718113_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactggggcccctgctat
KP718104_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactggggcccctgctat
AY090461_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
AY090459_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
FJ657525_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
MG877700_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KY476329_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactggggcccctgctac
KJ638656_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
KP718110_FT00000_P-F      attgcctctctcacatcatcaaccttcttgamgactgggggccctgctat
KY476330_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
AB086397_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KY476324_FT00000_P-F      attgcctctctcacatcatcaatcttcttgacgactggggcccctgctac
KY476325_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KY476328_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KY476327_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactggggcccctgctac
KP995116_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ586807_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KY382416_FT00000_P-F      attgccyctctcacatcatcaatcttctygaagactgggggccctgctay
KY382417_FT00000_P-F      attgccyctctcacatcatcaatcttctygaagactgggggccctgctay
KY382415_FT00000_P-F      attgccyctctcacatcatcaatcttctygaagactgggggccctgctay
KF199901_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ586806_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
KJ586805_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
OK106257_FT00000_P-F      attgccyctctcacatcatcaatcttcttgaagactgggggccctgctac
AF223963_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843202_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KC494400_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843193_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
AB064316_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
HM622135_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KC494404_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
DQ823091_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843167_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843195_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843200_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843199_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843196_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843197_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
AF223964_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
JN688699_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843170_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
JN688703_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
JN688691_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843169_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843168_FT00000_P-F      attgtctctctcacatcatcaatcttcttgaagactgggggccctgctac
EU366133_FT00000_P-F      attgcctctctcacatcatcaatcttctggaagactgggggccctgctac
MK058437_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
FJ709462_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843194_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843181_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
FJ709457_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843163_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843205_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KP995098_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843174_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ586808_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
FJ709465_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
FJ709459_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccttgctac
FJ709458_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccttgctac
HM585198_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccttgctac
HM585191_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccttgctac
HM585195_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccttgctac
HE981182_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
HE981183_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
HM585187_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843171_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
HM585189_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
HM585196_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
HM585188_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
HM590473_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
HM585190_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
HM585199_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
FJ709494_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843204_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
AB116552_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843190_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KY458062_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
HM585192_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843164_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
AY179735_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
HM585193_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KM998715_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KY458061_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843180_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
FJ709463_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
HM585197_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843179_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843203_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843176_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
FJ709460_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
DQ823094_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
DQ823095_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
DQ823092_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KX264496_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
HQ378247_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
FJ709464_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
DQ823093_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843198_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843201_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
FJ657529_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
EU366118_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843206_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
EU670262_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactggggcccctgctac
KY476331_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactggggcccctgctac
HM627320_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
HM585200_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
HM585194_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
HM590474_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
HM590472_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
HM585186_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
HM590471_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctat
KM233681_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctgt
JN792916_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
JN792919_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843178_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KJ843177_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
JX079936_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KY476323_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KY476322_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
KY476332_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
JN792922_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
JN792920_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
JN792918_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
JN792917_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
JN792914_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgctac
X75663_FT00000_P-F        attgcctctctcacatcatcaatctcctcgaagactgggggccctgctat
KP995101_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
KP995111_FT00000_P-F      attgcctctctcacatcatcaatcttctcgacgactgggggccctgccat
KP995118_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
KP718106_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
KP995105_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgcaat
FJ589066_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
FJ589067_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
AB116550_FT00000_P-F      attgcctctctcacatcatcaaccttctcgaagactgggggccctgccat
KP995106_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
KP718103_FT00000_P-F      attgcctctctcacatcgtcaatcttctcgaagactgggggccctgccat
KP995117_FT00000_P-F      attgcctctctcacatcatcaaccttctcgaagactgggggccctgccat
KP995119_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
DQ899148_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
AB036908_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB036913_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB036920_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB036906_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB036907_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB036911_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB036905_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB036909_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB036912_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KX264498_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB036915_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB036914_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB036917_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB036916_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB036919_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
DQ899150_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgcaat
KP995125_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgcaat
KP995123_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgcaat
AB116549_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
KJ638659_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
KP995124_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
KP995126_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
AY311370_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
KP718111_FT00000_P-F      attgcctctctcacatcatcaatcttcttgaagactgggggccctgccat
MH051987_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaggactggggaccctgccat
MH051986_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
DQ899149_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
KP995109_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
AB036910_FT00000_P-F      attgcctctctcacatcatcaaccttctcgaagactgggggccctgccat
AB116551_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
KP718112_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
KP718109_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgccat
DQ899147_FT00000_P-F      attgcctctctcacatcatcaatctactcgaagactgggggccctgctat
DQ899146_FT00000_P-F      attgcctctctcacatcatcaatctactcgaagactgggggccctgctat
DQ899145_FT00000_P-F      attgcctctctcacatcatcaatctactcgaagactgggggccctgctat
DQ899144_FT00000_P-F      attgcctctctcacatcatcaatctactcgaagactgggggccctgctat
KP995114_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KP995097_FT00000_P-F      attgcctctcttacatcatcaatcttctcgaagactgggggccctgctat
KP995115_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KP995113_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KC494399_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KP995104_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KP995107_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KC494396_FT00000_P-F      attgcctctctcacatcatcaatctttccgaagactgggggccctgctat
DQ899142_FT00000_P-F      attgcctctctcacatcatcaatctcctcgaagactgggggccctgctat
DQ899143_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AY090455_FT00000_P-F      attgcctctcttacatcatcaatcttctcgaagactgggggccctgctat
KT896494_FT00000_P-F      attgcctctctcacatcatcaatcttctcgacgactgggggccctgctat
AY311369_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KP995110_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843191_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KP995120_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KC494394_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KC494397_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KC494401_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KC494405_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KC494403_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KC494402_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KX264497_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
X69798_FT00000_P-F        attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KC494395_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
JQ272888_FT00000_P-F      attgcctctctcacatcatcaatcttctcgacgactggggaccttgctat
JN688720_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG098582_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG098579_FT00000_P-F      attgcgtctctcacatcatcaatctcctcgacgactggggaccctgctat
MG877717_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgcyat
MG877715_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG877716_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG877708_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG877706_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG877707_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MK183632_FT00000_P-F      attgcctctcccacatcatcaatctcctcgacgactgggggccctgctat
MG098578_FT00000_P-F      attgcctctcycacatcatcaatcttctcgaacactggtggccctgctat
MG098577_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaanactgggggccctgctat
AB365453_FT00000_P-F      attgcctctctcacatcatcaatcttctcgacgactgggggccctgctat
KY476326_FT00000_P-F      attgcctctctcacatcatcaatctcctcgaagactgggggccctgctat
MG098569_FT00000_P-F      attgcctctctcayatcatcaatcttctsgaagactgggggccctgctat
JN688709_FT00000_P-F      attgcctctctcanatcatcaatcttctcgaagactgggggccntgctat
X75658_FT00000_C-F        attgcctctctcacatcatcaatctcctcgaagactgggggccctgctat
AB214516_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG098570_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843225_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
EF576808_FT00000_P-F      attgcctctctcatatcatcaatatccttgacgactgggggccctgctat
MK183636_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB166850_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaaaactgggggccctgctat
MG098575_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG098583_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG098566_FT00000_P-F      attgcctcgctcacatcatcaatcttctcgaagactgggggccctgctat
MG098574_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MK183631_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MK183645_FT00000_P-F      attgcctctcacacatcatcaatcttctcgaagactgggggccctgctat
MG877714_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG877712_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactggggaccctgctat
EU366132_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG098573_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG098565_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG877722_FT00000_P-F      attgcctctctcacatcatcaatcttctcgamgactgggggccctgctat
MG877721_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG098580_FT00000_P-F      attgtctctctcacatcatcaatcttctcgaagactgggggccctgttat
AB365450_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG877704_FT00000_P-F      attgcctctcttacatcatcaatcttctcgaagactgggggccctgctat
MG877705_FT00000_P-F      attgcctctcttacatcatcaatcttctcgaagactgggggccctgctat
KJ843185_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AB365449_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG877703_FT00000_P-F      attgcctctcttacatcatcaatcttctcgaagactgggggccctgctat
AB365446_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843226_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MK183640_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MK183643_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843209_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MK183633_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MK183638_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MK183644_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MK183639_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MK183630_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
JN688701_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
DQ823087_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
DQ823086_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843223_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
DQ823089_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843175_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843189_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
EF576812_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AF223965_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
DQ823088_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG098564_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
JN811655_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843211_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MK183641_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843212_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
FJ657528_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MK183647_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843221_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KY382411_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843222_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843219_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843224_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
AF223962_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843207_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
JN811656_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
JX079937_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843220_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KX264499_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KC494398_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
HE981181_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
DQ823090_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843213_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
FJ657522_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843208_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ843210_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
FJ657519_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
EU366116_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
DQ776247_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
MG098584_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
KJ676694_FT00000_P-F      attgcctctctcacatcatcaatcttctcgaagactgggggccctgctat
                          ****   * *  * *** ****  *    **  ***** * ** **    

JN792921_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ638662_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ638660_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ638663_FT00000_P-F      gaacagggacaacaccacatccggacacctagaacccctgcccgtgttac
KJ638664_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ638657_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KP718107_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AB116654_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AY090458_FT00000_C-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KP718113_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KP718104_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AY090461_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AY090459_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ657525_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG877700_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KY476329_FT00000_P-F      gaacatggacaacatctcatcaggactcctaggacccctgctcgtgttac
KJ638656_FT00000_P-F      gaacatggacaacaccacatcaggacacctaggactcctgctcgtgttac
KP718110_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KY476330_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AB086397_FT00000_P-F      gaacatggacaacatcacgtcaggactcctaggacccctgctcgtgttac
KY476324_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KY476325_FT00000_P-F      gaacatggacagcatcacatcaggactcctaggacccctgctcgtgttac
KY476328_FT00000_P-F      gaacatggacagcatcacatcaggactcctaggacccctgctcgtgttac
KY476327_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KP995116_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ586807_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KY382416_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KY382417_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KY382415_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KF199901_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ586806_FT00000_P-F      gaacatggagaacatcacatcaggattcctaggaccccttctcgtgttac
KJ586805_FT00000_P-F      gaacatggagaacatcacatcaggattcctaggaccccttctcgtgttac
OK106257_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AF223963_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843202_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KC494400_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843193_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AB064316_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM622135_FT00000_P-F      gaacatggacaacatcacatcaggacacctaggacccctgctcgtgttac
KC494404_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
DQ823091_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843167_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843195_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843200_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843199_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843196_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843197_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AF223964_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JN688699_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843170_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JN688703_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JN688691_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843169_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843168_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
EU366133_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK058437_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ709462_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843194_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843181_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ709457_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843163_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843205_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KP995098_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843174_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ586808_FT00000_P-F      aaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ709465_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ709459_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ709458_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585198_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585191_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585195_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HE981182_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HE981183_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585187_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843171_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585189_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585196_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585188_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM590473_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585190_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585199_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ709494_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843204_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AB116552_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843190_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KY458062_FT00000_P-F      gaacatggacaacatctcatcaggactcctaggacccctgctcgtgttac
HM585192_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843164_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AY179735_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585193_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KM998715_FT00000_P-F      gaacatggacaacatctcatcaggactcctaggacccctgctcgtgttac
KY458061_FT00000_P-F      gaacatggacaacatctcatcaggactcctaggacccctgctcgtgttac
KJ843180_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ709463_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585197_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843179_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843203_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843176_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ709460_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
DQ823094_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
DQ823095_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
DQ823092_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KX264496_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HQ378247_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ709464_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
DQ823093_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843198_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843201_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ657529_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
EU366118_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843206_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
EU670262_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KY476331_FT00000_P-F      gaacatggacagcatcacatcaggactcctaggacccctgctcgtgttac
HM627320_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585200_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585194_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM590474_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM590472_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM585186_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HM590471_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KM233681_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JN792916_FT00000_P-F      gaacatggacagcatcacatcaggactcctaggacccctgctcgtgttac
JN792919_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843178_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843177_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JX079936_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KY476323_FT00000_P-F      gaacatggacagcatcacatcaggactcctaggacccctgctcgtgttac
KY476322_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KY476332_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JN792922_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JN792920_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JN792918_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JN792917_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JN792914_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
X75663_FT00000_P-F        gaacatggagaacatcacatcaggactcctaggacccctgcgcgtgttac
KP995101_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP995111_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP995118_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP718106_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP995105_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
FJ589066_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
FJ589067_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB116550_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP995106_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP718103_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KP995117_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP995119_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
DQ899148_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036908_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036913_FT00000_P-F      gaacatggagaacatcacatcaggactccyaggacccctgctcgtgttac
AB036920_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036906_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036907_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036911_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036905_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036909_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036912_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KX264498_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036915_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036914_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036917_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036916_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036919_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
DQ899150_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP995125_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP995123_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB116549_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KJ638659_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP995124_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP995126_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AY311370_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP718111_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
MH051987_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
MH051986_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
DQ899149_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP995109_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB036910_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
AB116551_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP718112_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
KP718109_FT00000_P-F      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
DQ899147_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
DQ899146_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
DQ899145_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
DQ899144_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KP995114_FT00000_P-F      gaacatggacaacattacatcaggactcctaagacccctgctcgtgttac
KP995097_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KP995115_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KP995113_FT00000_P-F      gaacatggacaacattacatcaaaactcctaggacccctgctcgtgttac
KC494399_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KP995104_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KP995107_FT00000_P-F      gaacatggacaacaccacatcaggactcctaggacccctgctcgtgttac
KC494396_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
DQ899142_FT00000_P-F      gagcatggacaacattacatcaggactcctaggacccctgctcgtgttac
DQ899143_FT00000_P-F      gagcatggacaacattacatcaggactcctaggacccctgctcgtgttac
AY090455_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KT896494_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
AY311369_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KP995110_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KJ843191_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KP995120_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KC494394_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KC494397_FT00000_P-F      gaacatggacaacacttactcaggactcctaagacccctgctcgtgtcac
KC494401_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KC494405_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KC494403_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KC494402_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KX264497_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
X69798_FT00000_P-F        gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
KC494395_FT00000_P-F      gaacatggacaacattacatcaggactcctaggacccctgctcgtgttac
JQ272888_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JN688720_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG098582_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG098579_FT00000_P-F      gaacacggacagcatcacatcagaacacctaccacccctgctcgtgtcat
MG877717_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG877715_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgygttac
MG877716_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG877708_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG877706_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG877707_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK183632_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctactcgtgttac
MG098578_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggaccgctgctcgtgttac
MG098577_FT00000_P-F      gaacatggacagcatcacatcaggactcctaggacccctgctcgtgttac
AB365453_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KY476326_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG098569_FT00000_P-F      gaacatggacagcatcacatcaggactcctaggacccctgctcgtgttac
JN688709_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
X75658_FT00000_C-F        gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AB214516_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG098570_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843225_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
EF576808_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK183636_FT00000_P-F      aaacatagacaacatcacatcaggactcctaaaacccctactcatgttac
AB166850_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG098575_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG098583_FT00000_P-F      gaacatggacagcatcacatcaggactcctaggacccctgctcgtgttac
MG098566_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG098574_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK183631_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK183645_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG877714_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgtyac
MG877712_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
EU366132_FT00000_P-F      gaacatggacaacatcacatcaggactcctaagacccctgctcgtgttac
MG098573_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG098565_FT00000_P-F      gaacatggacagcatcacatcaggactcctaggacccctgctcgtgttac
MG877722_FT00000_P-F      gaacatggacaccatcacatcaggactcctcggacccctgctcgtgttac
MG877721_FT00000_P-F      gaacatggacaccatcacatcaggactcctcggacccctgctcgtgttac
MG098580_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AB365450_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG877704_FT00000_P-F      gaacatggacagcatcacatcaggactcctaggacccctgctcgtgttac
MG877705_FT00000_P-F      gaacatggacagcatcacatcaggactcctaggacccctgctcgtgttac
KJ843185_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AB365449_FT00000_P-F      gaacatggacaacatcacatcaggactccyaggacccctgctcgtgttac
MG877703_FT00000_P-F      gaacatggacagcatcacatcaggactcctaggacccctgctcgtgttac
AB365446_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843226_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK183640_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK183643_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843209_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK183633_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK183638_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK183644_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK183639_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK183630_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JN688701_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
DQ823087_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
DQ823086_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843223_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
DQ823089_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843175_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843189_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
EF576812_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AF223965_FT00000_P-F      gaacatggacagcatcacatcaggactcctaggacccctgctcgtgttac
DQ823088_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG098564_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JN811655_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843211_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK183641_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843212_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ657528_FT00000_P-F      gaccatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MK183647_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843221_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KY382411_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843222_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843219_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843224_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
AF223962_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843207_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JN811656_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
JX079937_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843220_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KX264499_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KC494398_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
HE981181_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
DQ823090_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843213_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ657522_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843208_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
KJ843210_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
FJ657519_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
EU366116_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
DQ776247_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtgttac
MG098584_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtattac
KJ676694_FT00000_P-F      gaacatggacaacatcacatcaggactcctaggacccctgctcgtattac
                           * **  ** * **     **   *  **    **  ** * *   * * 

JN792921_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ638662_FT00000_P-F      aggcggtgtgtttcttgttgataaaaatcctcacaataccacagagtcta
KJ638660_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ638663_FT00000_P-F      agggggtgttttccttgttgacaaaaatcctcacaataccacagagtcta
KJ638664_FT00000_P-F      aggcggtgtctttcttgttgacaaaaatcctcacaataccacagagtcta
KJ638657_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacrgagtcta
KP718107_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB116654_FT00000_P-F      aggcggtgttttccttgttgacaaaaatcctcacaataccacagagtcta
AY090458_FT00000_C-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP718113_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP718104_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AY090461_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AY090459_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ657525_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacggagtcta
MG877700_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY476329_FT00000_P-F      aggcggtgtgtttcttgttaacaaaaatcctcacaataccacggagtcta
KJ638656_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcaaaataccacagaatcta
KP718110_FT00000_P-F      aggcggtgtgtttcttgttgataaaaatcctcacaataccacagagtcta
KY476330_FT00000_P-F      aggcggtgtgtttctcgttgacaaaaatcctcacaataccacagagtcta
AB086397_FT00000_P-F      aggcggcgtttttcttgttgataaaaatcctcacaataccacggagtcta
KY476324_FT00000_P-F      aggcggtgtttttcttgttgacaaaaatcctcacaataccaaagagtcta
KY476325_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY476328_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY476327_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagaatcta
KP995116_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ586807_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY382416_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY382417_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY382415_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KF199901_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ586806_FT00000_P-F      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
KJ586805_FT00000_P-F      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
OK106257_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AF223963_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843202_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KC494400_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacaaagtcta
KJ843193_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB064316_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM622135_FT00000_P-F      aggcggtgtgttccttgttgacaaaaatccgcacaataccacagagtcta
KC494404_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ823091_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843167_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843195_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843200_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843199_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843196_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843197_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AF223964_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
JN688699_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843170_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
JN688703_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
JN688691_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843169_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843168_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
EU366133_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MK058437_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ709462_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843194_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843181_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ709457_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843163_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843205_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995098_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843174_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ586808_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacaaagtcta
FJ709465_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ709459_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ709458_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585198_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585191_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585195_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HE981182_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HE981183_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585187_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843171_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585189_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585196_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585188_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM590473_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585190_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585199_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ709494_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843204_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB116552_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843190_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY458062_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585192_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843164_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AY179735_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585193_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KM998715_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY458061_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843180_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ709463_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585197_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843179_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843203_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843176_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ709460_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ823094_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ823095_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ823092_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KX264496_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HQ378247_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ709464_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ823093_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843198_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843201_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ657529_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
EU366118_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843206_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
EU670262_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY476331_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacggagtctc
HM627320_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585200_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585194_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM590474_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM590472_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM585186_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HM590471_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KM233681_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
JN792916_FT00000_P-F      aggcggtgtttttcttgttgacaaaaatcctcacaataccacagagtcta
JN792919_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843178_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843177_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
JX079936_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY476323_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY476322_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY476332_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
JN792922_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
JN792920_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
JN792918_FT00000_P-F      aggcggtgtgtttcttgttgataaaaatcctcacaataccacagagtcta
JN792917_FT00000_P-F      aggcggtgtgtttcttgttgacaagcttcctcacaataccacagagtcta
JN792914_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
X75663_FT00000_P-F        aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995101_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995111_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccaaagagtcta
KP995118_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP718106_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995105_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ589066_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ589067_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB116550_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995106_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP718103_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995117_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcaaaataccacagagtcta
KP995119_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ899148_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036908_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036913_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036920_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036906_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036907_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036911_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036905_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036909_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036912_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KX264498_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036915_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036914_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036917_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036916_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB036919_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ899150_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995125_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995123_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB116549_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ638659_FT00000_P-F      aggcggtgtgtttcttgttgayaaaaatcctcacaataccacagagtcta
KP995124_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995126_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AY311370_FT00000_P-F      aggcggggggtttcttgttgacaaaaatcctcacaataccacagagtcta
KP718111_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MH051987_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MH051986_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ899149_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995109_FT00000_P-F      aggcggtgtgtttcttgttgataaaaatcctcacaataccacagagtcta
AB036910_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB116551_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP718112_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP718109_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ899147_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ899146_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ899145_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ899144_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995114_FT00000_P-F      aggcggtgtctttcttgttgacaaaaatccgcacaataccacagagtcta
KP995097_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaatgccacagagtcta
KP995115_FT00000_P-F      aggcggtgtgtttcttgttgataaaaatcctcacaataccacagagtcta
KP995113_FT00000_P-F      agggggtgtttttctcgttgacaaaaatcctcacaataccacagagtcta
KC494399_FT00000_P-F      aggcggtgtatttcttgttgataaaaatcctcataatgccacagagtcta
KP995104_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995107_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KC494396_FT00000_P-F      atgcggtgtgtttcttgttgacaaaaatcctcacaatgccacagagtcta
DQ899142_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ899143_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AY090455_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KT896494_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AY311369_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995110_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843191_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KP995120_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KC494394_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KC494397_FT00000_P-F      aggcggtgtgttccttgttgacaaaaatcctcacaataccacagagtcta
KC494401_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KC494405_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KC494403_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KC494402_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KX264497_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
X69798_FT00000_P-F        aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KC494395_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
JQ272888_FT00000_P-F      aggcggtgtgtttcttgttgataaaaatcctcacaataccacagagtcta
JN688720_FT00000_P-F      aggcggtgtttttctcgttgataaaaatccgcacaataccacagagtcta
MG098582_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacggagtcta
MG098579_FT00000_P-F      cggcggtgtcttccttgttgacaagaatccgcacaataccacggagtcta
MG877717_FT00000_P-F      aggcggtgtttttcttgttgacaaaaatcctcacaataccacagagkcta
MG877715_FT00000_P-F      aggcggtgtttttcttgttgacaaaaatcctcacaataccacagagtcta
MG877716_FT00000_P-F      aggcggtgtttttcttgttgacaaaaatcctcacaataccacagagtcta
MG877708_FT00000_P-F      aggcggtgtctttctcgttgataaaaatcctcacaataccacagagtcta
MG877706_FT00000_P-F      aggcggtgtctttctcgttgataaaaatcctcacaataccacagagtcta
MG877707_FT00000_P-F      aggcggtgtctttctcgttgataaaaatcctcacaataccacagagtcta
MK183632_FT00000_P-F      aggcggtgtctttcttgttgataaaaatcctcacaataccacagagtcta
MG098578_FT00000_P-F      aggcggtgtgtatcttgttgataaaaatcctcacaataccacagagtcta
MG098577_FT00000_P-F      aggcggtgtgtttcttgttganaaaaatcctcacaataccacagagtcta
AB365453_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY476326_FT00000_P-F      rggcggtgtgtttctggttgacaaaaatccgcaaaataccacagagtcta
MG098569_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaatrccacagagtcta
JN688709_FT00000_P-F      agggggtgtttttcttgttgacaaaaatcctcacaataccacagagtcta
X75658_FT00000_C-F        aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB214516_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MG098570_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843225_FT00000_P-F      aggcggtgtatttcttgttgataaaaatcctcacaataccacagaatcta
EF576808_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MK183636_FT00000_P-F      aggcggtgtatttcttattaacaaaaatcctcacaataccacagagtcta
AB166850_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatccgcacaataccacagagtcta
MG098575_FT00000_P-F      aggcggtgtttttcttgttgacaaaaatcctcacaataccacagagtcta
MG098583_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MG098566_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MG098574_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MK183631_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MK183645_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacggagtcta
MG877714_FT00000_P-F      aggcggygtttttcttgttgacaaaaatcctcacaataccacagagtcta
MG877712_FT00000_P-F      aggcggcgtttttcttgttgacaaaaatcctcacaatgccacagagtcta
EU366132_FT00000_P-F      aggcggtgtttttctcgttgacaaaaatcctcacaattccacagagtcta
MG098573_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MG098565_FT00000_P-F      aggcggtgtttttcttgttgacaaaaatcctcacaataccacagagtcta
MG877722_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MG877721_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MG098580_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB365450_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MG877704_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MG877705_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843185_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB365449_FT00000_P-F      aggcggtgtgtttcttgtggacaaaaatcctcaaaacaccacagagtcta
MG877703_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AB365446_FT00000_P-F      aggcggtgtttttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843226_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MK183640_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MK183643_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843209_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MK183633_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MK183638_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MK183644_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MK183639_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MK183630_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
JN688701_FT00000_P-F      aggcggtgtktttcttgttgacaaaaatcctcacaataccacagagtcta
DQ823087_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ823086_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843223_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcckcacaataccacagagtcta
DQ823089_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843175_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843189_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
EF576812_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AF223965_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ823088_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MG098564_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
JN811655_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843211_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MK183641_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843212_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ657528_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MK183647_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843221_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KY382411_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843222_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843219_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843224_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
AF223962_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843207_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
JN811656_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
JX079937_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843220_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KX264499_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KC494398_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
HE981181_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ823090_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843213_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ657522_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843208_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
KJ843210_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
FJ657519_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
EU366116_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
DQ776247_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatcctcacaataccacagagtcta
MG098584_FT00000_P-F      aggcggtgtgtttcttgttgacaaaaatccgcacaataccacagagtcta
KJ676694_FT00000_P-F      aggcggtgtctttcttgttgataaaaatcctcacaataccacagagtcta
                            * ** *  *  **  *  * **   *** ** **  **    *  ** 

JN792921_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggamyacccgggtgtcc
KJ638662_FT00000_P-F      gactcgtggtggacttctcgcaattttctaggggaaatacccgggtgtcc
KJ638660_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ638663_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ638664_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaccacccgggtgtcc
KJ638657_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KP718107_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
AB116654_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacaaccgggtgtcc
AY090458_FT00000_C-F      gactcgtggtggacttctctcaattttctagggggaacaccagggtgtcc
KP718113_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacaccagggtgtcc
KP718104_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacaccagggtgtcc
AY090461_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacaccagggtgtcc
AY090459_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacaccagggtgtcc
FJ657525_FT00000_P-F      gactcgtggtggacttctctcagttttctagggggaacacccgggtgtcc
MG877700_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KY476329_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggcacacccgggtgtcc
KJ638656_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KP718110_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KY476330_FT00000_P-F      gactcgtggtggacttctcgcaattttctaggggaaacacccgggtgtcc
AB086397_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggaaacacccgggtgtcc
KY476324_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KY476325_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KY476328_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KY476327_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KP995116_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ586807_FT00000_P-F      aactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KY382416_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KY382417_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KY382415_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KF199901_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ586806_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ586805_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
OK106257_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
AF223963_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843202_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KC494400_FT00000_P-F      gactcgtggtggacttctctcaattttctagggcgaacacccgggtgtcc
KJ843193_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
AB064316_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM622135_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KC494404_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
DQ823091_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843167_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843195_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843200_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843199_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843196_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843197_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
AF223964_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
JN688699_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843170_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
JN688703_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
JN688691_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843169_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843168_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
EU366133_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
MK058437_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
FJ709462_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843194_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843181_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
FJ709457_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843163_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843205_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KP995098_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843174_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ586808_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
FJ709465_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
FJ709459_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
FJ709458_FT00000_P-F      gactcgtggtggacttctctcaattttctagagggaacacccgggtgtcc
HM585198_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM585191_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM585195_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HE981182_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HE981183_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM585187_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843171_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM585189_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM585196_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM585188_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM590473_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM585190_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM585199_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
FJ709494_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843204_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
AB116552_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843190_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KY458062_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM585192_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843164_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
AY179735_FT00000_P-F      gactcgtggtggacttctctcaattttctagagggaacacccgggtgtcc
HM585193_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KM998715_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KY458061_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843180_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
FJ709463_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM585197_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843179_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843203_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843176_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
FJ709460_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
DQ823094_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
DQ823095_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
DQ823092_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KX264496_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HQ378247_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
FJ709464_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
DQ823093_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843198_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843201_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
FJ657529_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
EU366118_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843206_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
EU670262_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacaccagggtgtcc
KY476331_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM627320_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM585200_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM585194_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM590474_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM590472_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM585186_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
HM590471_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KM233681_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
JN792916_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
JN792919_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843178_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KJ843177_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
JX079936_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KY476323_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KY476322_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
KY476332_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
JN792922_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
JN792920_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
JN792918_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
JN792917_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
JN792914_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaacacccgggtgtcc
X75663_FT00000_P-F        gactcgtggtggacttctctcaattttctagggggactacccaggtgtcc
KP995101_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggaactacccgggtgtcc
KP995111_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995118_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP718106_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995105_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggcactacccgggtgtcc
FJ589066_FT00000_P-F      gactcgtggtggacttctctcagttttctagagggactacccgggtgtcc
FJ589067_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB116550_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995106_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtct
KP718103_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995117_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995119_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ899148_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036908_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036913_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036920_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036906_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036907_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036911_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036905_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036909_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036912_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KX264498_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036915_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036914_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036917_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036916_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036919_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ899150_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995125_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995123_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB116549_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ638659_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995124_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995126_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AY311370_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP718111_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MH051987_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MH051986_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ899149_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995109_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB036910_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB116551_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP718112_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP718109_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ899147_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ899146_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ899145_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ899144_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995114_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995097_FT00000_P-F      gacttgtggtggacttctctcagttttctagagggactacccgggtgtcc
KP995115_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgtgtgtcc
KP995113_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KC494399_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995104_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995107_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KC494396_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ899142_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ899143_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AY090455_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KT896494_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AY311369_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995110_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtct
KJ843191_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KP995120_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KC494394_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KC494397_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KC494401_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KC494405_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KC494403_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KC494402_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KX264497_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
X69798_FT00000_P-F        gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KC494395_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
JQ272888_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggaactacccgggtgtcc
JN688720_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggaactacccgggtgtcc
MG098582_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MG098579_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggagtacccgggtgtcc
MG877717_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggraccacccgrgtgtcc
MG877715_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaccacccgrgtgtcc
MG877716_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggraccacccgrgtgtcc
MG877708_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggaactaccagggtgtcc
MG877706_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggaactaccagggtgtcc
MG877707_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggaactaccagggtgtcc
MK183632_FT00000_P-F      gactcgtggtggacttctcgcaattttctaggggaactacccrggtgtcc
MG098578_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggtctacccgggtgtcc
MG098577_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB365453_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KY476326_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggaccacccgggtgtcc
MG098569_FT00000_P-F      gactcgtggtggacttctctcagttttctagagggactacccgggtgtcc
JN688709_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
X75658_FT00000_C-F        gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB214516_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MG098570_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843225_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
EF576808_FT00000_P-F      gactcgtggtggacttctctcaattttctagagggactacccaggtgtcc
MK183636_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB166850_FT00000_P-F      gacttgtggtggacttctctcaattttctagggggactacccgggtgtcc
MG098575_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MG098583_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggcactacccgggtgtcc
MG098566_FT00000_P-F      gactygtkgtggacttctctcarttttctaggggaactacccgggtgtcc
MG098574_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MK183631_FT00000_P-F      gactcgtggtggacttctctcaattttctagagggactacccgggtgtcc
MK183645_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MG877714_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MG877712_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
EU366132_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MG098573_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MG098565_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MG877722_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggcactacccgggtgtcc
MG877721_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MG098580_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB365450_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MG877704_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggractacccgggtgtcc
MG877705_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggractacccgggtgtcc
KJ843185_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB365449_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggcactacccgggtgtcc
MG877703_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AB365446_FT00000_P-F      gactcgtggtggacttctctcaattttctaggggcactacccgggtgtcc
KJ843226_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MK183640_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MK183643_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843209_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MK183633_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MK183638_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MK183644_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MK183639_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MK183630_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
JN688701_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ823087_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ823086_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843223_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ823089_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843175_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843189_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
EF576812_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AF223965_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ823088_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MG098564_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
JN811655_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843211_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MK183641_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843212_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
FJ657528_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MK183647_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843221_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KY382411_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843222_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843219_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843224_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
AF223962_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843207_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
JN811656_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
JX079937_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843220_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KX264499_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KC494398_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
HE981181_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ823090_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843213_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
FJ657522_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843208_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
KJ843210_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
FJ657519_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
EU366116_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
DQ776247_FT00000_P-F      gactcgtggtggacttctctcaattttctagggggactacccgggtgtcc
MG098584_FT00000_P-F      gactcgtggtggacttctctcagttttctagggggactacccgagtgtcc
KJ676694_FT00000_P-F      gactcgtggtggacttctctcaattttctcggggaactacccgggtgtcc
                           *** ** *********** ** ****** * *     * *   ***** 

JN792921_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ638662_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ638660_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ638663_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ638664_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ638657_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP718107_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttacyaacctcctgtc
AB116654_FT00000_P-F      tggccaaaattcgctgtccccaacctccaatcacttaccaacctcttgtc
AY090458_FT00000_C-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP718113_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP718104_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AY090461_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AY090459_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ657525_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877700_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY476329_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ638656_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP718110_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttactaacctcctgtc
KY476330_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB086397_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY476324_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY476325_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaaccttctgtc
KY476328_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY476327_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995116_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ586807_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY382416_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY382417_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY382415_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KF199901_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ586806_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ586805_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
OK106257_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AF223963_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843202_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KC494400_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843193_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB064316_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM622135_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KC494404_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ823091_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843167_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843195_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843200_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843199_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843196_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843197_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AF223964_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JN688699_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843170_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JN688703_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JN688691_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843169_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843168_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
EU366133_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MK058437_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ709462_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843194_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843181_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ709457_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843163_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843205_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995098_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843174_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ586808_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ709465_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ709459_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ709458_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585198_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585191_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585195_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HE981182_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HE981183_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585187_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843171_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585189_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585196_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585188_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM590473_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585190_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585199_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ709494_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843204_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB116552_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843190_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY458062_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585192_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843164_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AY179735_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585193_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KM998715_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY458061_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843180_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ709463_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585197_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843179_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843203_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843176_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ709460_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ823094_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ823095_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ823092_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KX264496_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HQ378247_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ709464_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ823093_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843198_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843201_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ657529_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
EU366118_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843206_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
EU670262_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY476331_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcttgtc
HM627320_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585200_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585194_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM590474_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM590472_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM585186_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HM590471_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KM233681_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JN792916_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JN792919_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843178_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843177_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JX079936_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY476323_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY476322_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY476332_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JN792922_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JN792920_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JN792918_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JN792917_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaaccttctgtc
JN792914_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
X75663_FT00000_P-F        tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995101_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995111_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995118_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP718106_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995105_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ589066_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ589067_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB116550_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995106_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP718103_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995117_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995119_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ899148_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036908_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036913_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036920_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036906_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036907_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036911_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036905_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036909_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036912_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KX264498_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036915_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036914_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036917_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036916_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036919_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ899150_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995125_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995123_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB116549_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ638659_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995124_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995126_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AY311370_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP718111_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MH051987_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MH051986_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ899149_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995109_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB036910_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB116551_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP718112_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP718109_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ899147_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ899146_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ899145_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ899144_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995114_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995097_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995115_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995113_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KC494399_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995104_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995107_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KC494396_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ899142_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ899143_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AY090455_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KT896494_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AY311369_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995110_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843191_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KP995120_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KC494394_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KC494397_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KC494401_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KC494405_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KC494403_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KC494402_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KX264497_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
X69798_FT00000_P-F        tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KC494395_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JQ272888_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcttgtc
JN688720_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098582_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098579_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877717_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877715_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877716_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877708_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877706_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877707_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MK183632_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098578_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098577_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB365453_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY476326_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098569_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JN688709_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
X75658_FT00000_C-F        tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB214516_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098570_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843225_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
EF576808_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MK183636_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB166850_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098575_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098583_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098566_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098574_FT00000_P-F      tggccaaaattcscagtccccaacctccaatcacttaccaacctcctgtc
MK183631_FT00000_P-F      tggccaaaaywcgcagtccccaacctccaatcacttaccaacctcctgtc
MK183645_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877714_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877712_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
EU366132_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098573_FT00000_P-F      tgsccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098565_FT00000_P-F      tgsccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877722_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877721_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098580_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB365450_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877704_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877705_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843185_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB365449_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG877703_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AB365446_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843226_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MK183640_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MK183643_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843209_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MK183633_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MK183638_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MK183644_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MK183639_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MK183630_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JN688701_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ823087_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ823086_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843223_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ823089_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843175_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843189_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
EF576812_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AF223965_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ823088_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098564_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JN811655_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843211_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MK183641_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843212_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ657528_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MK183647_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843221_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KY382411_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843222_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843219_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843224_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
AF223962_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843207_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JN811656_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
JX079937_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843220_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KX264499_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KC494398_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
HE981181_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ823090_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843213_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ657522_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843208_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ843210_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
FJ657519_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
EU366116_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
DQ776247_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
MG098584_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
KJ676694_FT00000_P-F      tggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtc
                          ** ******  * * *********************** *****  ****

JN792921_FT00000_P-F      ctccaacttgtcctggctatcgytggatgtgtctgcggcgttttatcatc
KJ638662_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ638660_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ638663_FT00000_P-F      ctccgacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ638664_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ638657_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP718107_FT00000_P-F      ctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
AB116654_FT00000_P-F      ctccaacttgtcctggctatcgctcgatgtgtctgcggcgttttatcatc
AY090458_FT00000_C-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
KP718113_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KP718104_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
AY090461_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
AY090459_FT00000_P-F      ctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
FJ657525_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
MG877700_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY476329_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ638656_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP718110_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KY476330_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
AB086397_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY476324_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY476325_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY476328_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY476327_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KP995116_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ586807_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY382416_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY382417_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY382415_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KF199901_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ586806_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ586805_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
OK106257_FT00000_P-F      ctccaacttgtcctggctatcgytggatgtgtctgcggcgttttatcatc
AF223963_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843202_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KC494400_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843193_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
AB064316_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM622135_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KC494404_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
DQ823091_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843167_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843195_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843200_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843199_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843196_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843197_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
AF223964_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
JN688699_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843170_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
JN688703_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
JN688691_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843169_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843168_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
EU366133_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
MK058437_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
FJ709462_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843194_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843181_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
FJ709457_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843163_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843205_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KP995098_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843174_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ586808_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
FJ709465_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
FJ709459_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
FJ709458_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585198_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585191_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585195_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HE981182_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HE981183_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585187_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843171_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585189_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585196_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585188_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM590473_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585190_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585199_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
FJ709494_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843204_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
AB116552_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843190_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY458062_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585192_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843164_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
AY179735_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585193_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KM998715_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY458061_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843180_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
FJ709463_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585197_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843179_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843203_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843176_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
FJ709460_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
DQ823094_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
DQ823095_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
DQ823092_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KX264496_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HQ378247_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
FJ709464_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
DQ823093_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843198_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843201_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
FJ657529_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
EU366118_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843206_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
EU670262_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY476331_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM627320_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585200_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585194_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM590474_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM590472_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM585186_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM590471_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KM233681_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
JN792916_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
JN792919_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843178_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KJ843177_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
JX079936_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY476323_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY476322_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KY476332_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
JN792922_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
JN792920_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
JN792918_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
JN792917_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
JN792914_FT00000_P-F      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
X75663_FT00000_P-F        ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995101_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995111_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995118_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP718106_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995105_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
FJ589066_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
FJ589067_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB116550_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995106_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP718103_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995117_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995119_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttctatcatc
DQ899148_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036908_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036913_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036920_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036906_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036907_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036911_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036905_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036909_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036912_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KX264498_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036915_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036914_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036917_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036916_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036919_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
DQ899150_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995125_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995123_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB116549_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ638659_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995124_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995126_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AY311370_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP718111_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MH051987_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MH051986_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
DQ899149_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995109_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB036910_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB116551_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP718112_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP718109_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
DQ899147_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
DQ899146_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgccgcgttttatcatc
DQ899145_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
DQ899144_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995114_FT00000_P-F      ctccaacttgtcctggctatcgttggacgtgtctgcggcgttttatcatc
KP995097_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995115_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995113_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KC494399_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995104_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995107_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KC494396_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
DQ899142_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
DQ899143_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AY090455_FT00000_P-F      ctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
KT896494_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AY311369_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995110_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843191_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KP995120_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KC494394_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KC494397_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtcggcggcgttttatcatc
KC494401_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KC494405_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KC494403_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KC494402_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KX264497_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
X69798_FT00000_P-F        ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KC494395_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
JQ272888_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
JN688720_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG098582_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG098579_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG877717_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG877715_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG877716_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG877708_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG877706_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG877707_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MK183632_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG098578_FT00000_P-F      ctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
MG098577_FT00000_P-F      ctccaamttgtcctgkttatcgttggatgtgtctgcggcgttttatcatc
AB365453_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KY476326_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG098569_FT00000_P-F      ctccaacttgtcctgsctatcgttggatgtgtctgcggcgttttatcatc
JN688709_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
X75658_FT00000_C-F        ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB214516_FT00000_P-F      ctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
MG098570_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843225_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
EF576808_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MK183636_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB166850_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG098575_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG098583_FT00000_P-F      ctccaacttgtcctggctatcgttggrtgtgtctgcggcgttttatcatc
MG098566_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG098574_FT00000_P-F      ctccaacttgtcatggctatcgttggatgtgtctgcggcgttttatcatc
MK183631_FT00000_P-F      ctccgacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MK183645_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG877714_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG877712_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcata
EU366132_FT00000_P-F      ctctaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG098573_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG098565_FT00000_P-F      ctcmaacttgtcctgtctatcgttggatgtgtctgcggcgttttatcatc
MG877722_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG877721_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG098580_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB365450_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG877704_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG877705_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843185_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB365449_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG877703_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB365446_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843226_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MK183640_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MK183643_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843209_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MK183633_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MK183638_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MK183644_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MK183639_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MK183630_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
JN688701_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
DQ823087_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
DQ823086_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843223_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
DQ823089_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843175_FT00000_P-F      ctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
KJ843189_FT00000_P-F      ctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
EF576812_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AF223965_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
DQ823088_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG098564_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
JN811655_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843211_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MK183641_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843212_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
FJ657528_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MK183647_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843221_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KY382411_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843222_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843219_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843224_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AF223962_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843207_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
JN811656_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
JX079937_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843220_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KX264499_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KC494398_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
HE981181_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
DQ823090_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843213_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
FJ657522_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843208_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
KJ843210_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
FJ657519_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
EU366116_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
DQ776247_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
MG098584_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtatctgcggcgttttatcatc
KJ676694_FT00000_P-F      ctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
                          ***  * ***** **  ***** * *  ** ** ** ***** ****** 

JN792921_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ638662_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ638660_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ638663_FT00000_P-F      ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ638664_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
KJ638657_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP718107_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB116654_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AY090458_FT00000_C-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP718113_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP718104_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AY090461_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AY090459_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ657525_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877700_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY476329_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ638656_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
KP718110_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY476330_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB086397_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY476324_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY476325_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY476328_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY476327_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995116_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
KJ586807_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY382416_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY382417_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY382415_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KF199901_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ586806_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ586805_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
OK106257_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AF223963_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
KJ843202_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KC494400_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
KJ843193_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB064316_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM622135_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KC494404_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ823091_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843167_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843195_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843200_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843199_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843196_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843197_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AF223964_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN688699_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843170_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
JN688703_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN688691_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843169_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
KJ843168_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
EU366133_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MK058437_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ709462_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843194_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843181_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ709457_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843163_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843205_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
KP995098_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843174_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ586808_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ709465_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ709459_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ709458_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585198_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585191_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585195_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HE981182_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HE981183_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585187_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843171_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585189_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585196_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585188_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM590473_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585190_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585199_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ709494_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843204_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB116552_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843190_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY458062_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585192_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843164_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AY179735_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585193_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KM998715_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY458061_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843180_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ709463_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585197_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843179_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843203_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843176_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ709460_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ823094_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ823095_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ823092_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KX264496_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HQ378247_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ709464_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ823093_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843198_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843201_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ657529_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
EU366118_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843206_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
EU670262_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY476331_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM627320_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585200_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585194_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM590474_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM590472_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM585186_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HM590471_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KM233681_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN792916_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN792919_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843178_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843177_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JX079936_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY476323_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY476322_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY476332_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN792922_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN792920_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN792918_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN792917_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN792914_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
X75663_FT00000_P-F        ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995101_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995111_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
KP995118_FT00000_P-F      ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctgga
KP718106_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995105_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ589066_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ589067_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB116550_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995106_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP718103_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995117_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995119_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ899148_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
AB036908_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB036913_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
AB036920_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB036906_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB036907_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB036911_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB036905_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB036909_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB036912_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KX264498_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB036915_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB036914_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB036917_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB036916_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB036919_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ899150_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
KP995125_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995123_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB116549_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ638659_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995124_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995126_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AY311370_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP718111_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MH051987_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MH051986_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ899149_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995109_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB036910_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB116551_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP718112_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP718109_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ899147_FT00000_P-F      ttcctcttcatcctgctgcaatgcctcatcttcttgttggttcttctgga
DQ899146_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ899145_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ899144_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995114_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995097_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995115_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995113_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KC494399_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995104_FT00000_P-F      ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995107_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KC494396_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ899142_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ899143_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AY090455_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KT896494_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AY311369_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995110_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843191_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KP995120_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KC494394_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KC494397_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KC494401_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KC494405_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KC494403_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KC494402_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KX264497_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
X69798_FT00000_P-F        ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KC494395_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JQ272888_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN688720_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098582_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
MG098579_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877717_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877715_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877716_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877708_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877706_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877707_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MK183632_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098578_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098577_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB365453_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY476326_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098569_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN688709_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
X75658_FT00000_C-F        ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB214516_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098570_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843225_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
EF576808_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MK183636_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB166850_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098575_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098583_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098566_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098574_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
MK183631_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MK183645_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877714_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877712_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
EU366132_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098573_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098565_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877722_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877721_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098580_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB365450_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877704_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877705_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843185_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtgga
AB365449_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG877703_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB365446_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843226_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MK183640_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MK183643_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843209_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MK183633_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MK183638_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MK183644_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MK183639_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MK183630_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN688701_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ823087_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ823086_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843223_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ823089_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843175_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843189_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
EF576812_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AF223965_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ823088_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098564_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN811655_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843211_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MK183641_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843212_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ657528_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MK183647_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843221_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY382411_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843222_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843219_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843224_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AF223962_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843207_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JN811656_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JX079937_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843220_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KX264499_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KC494398_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HE981181_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ823090_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843213_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ657522_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843208_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ843210_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ657519_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
EU366116_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
DQ776247_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
MG098584_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ676694_FT00000_P-F      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
                          ******* *********** ******** **************** ****

JN792921_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctamttccaggatc--------
KJ638662_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ638660_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ638663_FT00000_P-F      ttatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ638664_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ638657_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KP718107_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
AB116654_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
AY090458_FT00000_C-F      ctatcaaggtatgttgcccgtctgtcctctacttccaggatc--------
KP718113_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KP718104_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
AY090461_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
AY090459_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
FJ657525_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
MG877700_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KY476329_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ638656_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KP718110_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KY476330_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcccctacttccaggatc--------
AB086397_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KY476324_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KY476325_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KY476328_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KY476327_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KP995116_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ586807_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KY382416_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KY382417_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KY382415_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KF199901_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggaac--------
KJ586806_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ586805_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
OK106257_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
AF223963_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctccacttccaggatc--------
KJ843202_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KC494400_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843193_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
AB064316_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
HM622135_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KC494404_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
DQ823091_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843167_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843195_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843200_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843199_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843196_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843197_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
AF223964_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
JN688699_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843170_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
JN688703_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
JN688691_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843169_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843168_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
EU366133_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
MK058437_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
FJ709462_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843194_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843181_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
FJ709457_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843163_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843205_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KP995098_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ843174_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
KJ586808_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
FJ709465_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
FJ709459_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
FJ709458_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
HM585198_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
HM585191_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
HM585195_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
HE981182_FT00000_P-F      ctatcaaggtatgttgcccgtttgtcctctacttccaggatc--------
HE981183_FT00000_P-F  &nbs