HBVdb

Dataset for nucleotide sequence C of genotype F

[Download (right click)] [Edit] [Sequences] [Repertoires]

294 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


JN792921_C_P-F      atggacattgacccttataaagaatttggagcttctgtggarttactctcktttttgcct
KP995115_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttgctctcgtttttgcct
KP995113_C_P-F      atggacattgacccttataaagaattcggagcttctgtggagttactctcgtttttgcct
KP995114_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP995097_C_P-F      atggacattgacccttataaagaatttggcgcttctgtggagttactctcgtttttacct
KC494399_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttacct
DQ899146_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
DQ899144_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
DQ899147_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
DQ899145_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
KC494396_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KT896494_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AY254498_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP995107_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP995104_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
KJ843191_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AY090455_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC494401_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC494395_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KX264497_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC494405_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC494403_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC494402_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
X69798_C_P-F        atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC494394_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC494397_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AY311369_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP995110_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ899142_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ899143_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP995120_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP995101_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
FJ589066_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctcacttttttgcct
AB116550_C_P-F      atggacattgacccttttaaagaatttggagcttctgaggaattactctcttttttgcct
KP995093_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
KP718106_C_P-F      atggacattgaccmttataaagaatttggagcttctgyggaattgctctcttttttgcct
X75663_C_P-F        atggacattgacccttataaagaatttggagcttctgtggaattgttctcttttttggct
KP995111_C_P-F      atggacattgacccgtataaagaatttggagcttctgtggaattgctctcttttttgcct
FJ589067_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KP995095_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcatttttgcct
KP995109_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctgtcatttttgcct
KP995105_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KP995106_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KP995119_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KP995118_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
DQ899148_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AF324143_C_P-F      atggacattgacccttataaagaatttggagcttctatggaattgctctcttttttgcct
KP995117_C_P-F      atggacattgacccttataaagaatttggagcttctgcggaattgctctcttttttgcct
KP718103_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
DQ899149_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AY311370_C_P-F      atggacatcgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
MH051986_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
MH051987_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KP995124_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KP995126_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
JF439884_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcgtttttgcct
JF439885_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcgtttttgcct
AB116551_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctgtcgtttttgcct
KP718109_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KP718112_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036910_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KP718111_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KP995091_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036920_C_P-F      atggacattgacccttataaagaatttggcgcttctgtggaattgctctcttttttgcct
AB036914_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036915_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036916_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036917_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036919_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036911_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036905_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036906_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036907_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036909_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036912_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036913_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KX264498_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB036908_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ638659_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
DQ899150_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB116549_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KP995123_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KP995125_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ638663_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KY476329_C_P-F      atggacattgacccttataaagaattcggagcttctgtggaattactctcttttttgcct
AB116654_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
FJ657525_C_P-F      atggacattgacccttataaagaatttggagcctctgtggaattactctcttttttgcct
KY476328_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KX757665_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgcct
KY476330_C_P-F      atggacattgacccttataaagaatatggagcttccgcggaattactctcttttttgcct
AB086397_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ638664_C_P-F      atggacattgacccttataaagaatttggagcttctgaggaattactctcttttttgcct
KP718110_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KY476325_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ638656_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KP718107_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ638657_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KY476324_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AY090459_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
FJ589065_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgcct
KX757672_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgcct
JX899376_C_P-F      atggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgcct
AY090458_C_C-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
AY090461_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KP718104_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KP718113_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM627320_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
AF223963_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KY476327_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ586805_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
EU185743_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843195_C_P-F      atggacattgacccttataaagaatttggagcttctctggaattactctcttttttgcct
KJ843167_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KC494400_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KY382415_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KY382416_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KY382417_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM622135_C_P-F      atggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgcct
EU185744_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KP995096_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KP995116_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HE981187_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KF779236_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
JN688699_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843199_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843202_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843198_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843194_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843190_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843193_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843181_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843176_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843169_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843168_C_P-F      atggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgcct
KJ843163_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ586808_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ586806_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KC494404_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM585193_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM585188_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM590473_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
FJ709494_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM585190_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
FJ709465_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
MK058437_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
FJ709458_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
FJ709459_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM585191_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM585195_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM585198_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
EU366133_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
EU366118_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
FJ657529_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843201_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843203_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843206_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
DQ823092_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
DQ823093_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
FJ709460_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
FJ709464_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HQ378247_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843164_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843174_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843180_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KM998715_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KP995098_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KY458061_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KY458062_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
AB064316_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
AB116552_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
AF223964_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
AY179735_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
DQ823094_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
DQ823095_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
FJ709457_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
FJ709462_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
FJ709463_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HE981182_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HE981186_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM585187_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM585189_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM585192_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM585196_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM585197_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM585199_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
JN688691_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
JN688703_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KF199901_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ586807_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843170_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843171_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843179_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843196_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843197_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843200_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843204_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843205_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KX264496_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
DQ823091_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
JN792916_C_P-F      atggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgcct
JN792919_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
JN792920_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KY476331_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
JN792917_C_P-F      atggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgcct
JN792918_C_P-F      atggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgcct
EU670261_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
EU670262_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
JX079936_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
JN792914_C_P-F      atggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgcct
HM585194_C_P-F      atggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgcct
KY476332_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KY476323_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
HM585186_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgcct
HM590471_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgcct
HM590472_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgcct
HM590474_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgcct
KM233681_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgcct
HM585200_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
JN792922_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843177_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843178_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KY476322_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
MG098582_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
MG098584_C_P-F      atggacattgacccttataaagaatttggagcttctgtggagttgctctcttttttgcct
KJ638660_C_P-F      atggacatygacccttataaagaatttggmgcttctttagaattgctctcttttttgcct
KJ638662_C_P-F      atggacattgacccttataaagaatttggagcttctgtagaattgctctcttttttgcct
AB365453_C_P-F      atggacattgacccttataaagaatttggagcgtctgtggaattgctctcttttttgcct
MG098569_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
JQ272888_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
MG098575_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
MG098574_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
MG098583_C_P-F      atggacattgacccttataaagaatttggtgcttctgtggaattgctctcttttttgcct
KJ676694_C_P-F      atggacattgacccttataaagaatttggcgcttctctggaattgctctcttttttgcct
EU366132_C_P-F      atggacattgacccttataaagaatttggagcttctagggaattgctctcttttttgcct
JN688709_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgmtctcttttttgcct
MG098579_C_P-F      atggacatygacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
MG098566_C_P-F      atggacatcgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
EF576808_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
MG098570_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB365450_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
MG098577_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
JN688720_C_P-F      atggacatcgacccttataaagaatttggagcttctgtggaattgctctcttttttgccg
X75658_C_C-F        atggacattgacccttataaagaatttggagcttctgtggaattgttctcttttttgcct
MG098580_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
MG098573_C_P-F      atggacattgacccttataaagaatttggcgcttctgtggaattgctctcttttttgcct
KY476326_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
MG098578_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB166850_C_P-F      atggacattgacccttataaagaatttggcgcttctgcggaattgctctcttttttgcct
AB214516_C_P-F      atggacattgacccttataaagaatttggcgcttctgcggaattgctctcttttttgcct
JN688701_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB365446_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
MG098565_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843226_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcct
KJ843225_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AB365449_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
MG098564_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
DQ823087_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843210_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843209_C_P-F      atggacatcgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
JX079937_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
HQ420165_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
HQ420166_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
FJ657519_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
DQ823088_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
FJ657528_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
JN811655_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
JN811656_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843211_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843212_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843219_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843221_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843222_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843224_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KY382411_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AF223965_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
EF576812_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843185_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
AF223962_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
DQ776247_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
DQ823089_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
DQ823090_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
EU366116_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
FJ657522_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
HE981181_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KC494398_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843175_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843189_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843207_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843208_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843213_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843220_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KJ843223_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
KX264499_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
DQ823086_C_P-F      atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcct
                    ******** ****  * ********  ** ** **    **  *  *  * *****  * 

JN792921_C_P-F      kctgatttcttcccrtcrgttcgggacctactcgacaccgcttcagcyctytaccgggat
KP995115_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagccctttaccgggat
KP995113_C_P-F      cctgatttcttcccatcggttcgggacctaatcgacaccgcttcagctctttaccgggat
KP995114_C_P-F      actgatttcttcccatcggttcgggatctactcgacaccgcttcagctcttcaccgggat
KP995097_C_P-F      gctgatttcttcccttcggctcgggacctattcgacaccgcttcagctctttaccgggat
KC494399_C_P-F      tctgatttctacccatcggttcgggacctaatcgacaccgcttcagctctttaccgggat
DQ899146_C_P-F      tccgatttctttccatcggttcgggacctattcgacaccgcttcagccctttaccgggat
DQ899144_C_P-F      tccgatttctttccatcggttcgggacctactcgacaccgcttcagccctttaccgggat
DQ899147_C_P-F      tccgatttctttccatcggttcgggacctactcgacaccgcttcagccctttaccgggat
DQ899145_C_P-F      tccgatttctttccatcggttcgggacctactggacaccgcttcagccctttaccgggat
KC494396_C_P-F      tctgatttctttccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
KT896494_C_P-F      tctgatttcttcccatcggctcgggacctactcgacaccgcttcagctctttaccgggat
AY254498_C_P-F      tctgacttcttcccttcggttcgagacctactagacaccgcttcagctctttaccgggat
KP995107_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
KP995104_C_P-F      tctgatttcttcccatcggttcgggatctactcgacaccgcttcagctctttaccgggat
KJ843191_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
AY090455_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
KC494401_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
KC494395_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
KX264497_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
KC494405_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
KC494403_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
KC494402_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
X69798_C_P-F        tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
KC494394_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
KC494397_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
AY311369_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
KP995110_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
DQ899142_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
DQ899143_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
KP995120_C_P-F      tctgatttcttcccatcggttcgggacctactcgacaccgcttcagctctttaccgggat
KP995101_C_P-F      tctgatttcttcccatctgttcgggacctactcgacaccgctgcagccctttaccgggat
FJ589066_C_P-F      tctgatttcttcccgtctattcgggacctactcgacaccgcttcagccctttaccgggat
AB116550_C_P-F      cttgatttcttcccgaatgttcgggatctactcgacaccgcttcagccctttaccgggat
KP995093_C_P-F      tctgacttctttccatctgttcgggacctactcgacaccgcttcagccctttaccgggat
KP718106_C_P-F      tctgatttcttcccgtctgytcgggacctactcgacaccgcttcagccctttaccgggat
X75663_C_P-F        tctgacttctttccgtctgttcgggacctcctcgacaccgcctcagccctgtaccgggat
KP995111_C_P-F      attgatttcttcccgtctgttcgggacctactcgacaccgctacagccctataccgggat
FJ589067_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
KP995095_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
KP995109_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
KP995105_C_P-F      tctgatttcttcccgtctgctcgggacctactcgacaccgcttcagccctttaccggcaa
KP995106_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
KP995119_C_P-F      actgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
KP995118_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgagat
DQ899148_C_P-F      tctgatttcttcccttctgttcgggacctactcgacaccgcttcagccttgtaccgggat
AF324143_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
KP995117_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcctcagccctgtaccgggat
KP718103_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
DQ899149_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
AY311370_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcctcagccctgtaccgggat
MH051986_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
MH051987_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
KP995124_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcctcagccctgtaccgggat
KP995126_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcctcagccctgtaccgggat
JF439884_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
JF439885_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
AB116551_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
KP718109_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
KP718112_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
AB036910_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
KP718111_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctgtaccgggat
KP995091_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036920_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036914_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036915_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036916_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036917_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036919_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036911_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036905_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036906_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036907_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036909_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036912_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036913_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
KX264498_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB036908_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
KJ638659_C_P-F      tctgatttcttcccgtctgttcgggatctactcgacaccgcttcagccctttaccgggat
DQ899150_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
AB116549_C_P-F      tctgatttcttcccgtctgttcgggatctactcgacaccgcttcagccctttaccgggat
KP995123_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
KP995125_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctttaccgggat
KJ638663_C_P-F      tctgatttcttcccgtcagcwcgggacctactcgamaccgcttcagccctctaccgggat
KY476329_C_P-F      tctgatttcttcccgtcaattcgggacctactcgacaccgcttcagccctctaccgggat
AB116654_C_P-F      actgatttcttcccgtcagttcgggaccttctcgacaccgcttcagccctttaccgggat
FJ657525_C_P-F      tctgatttctacccgtcagttcgggacctactcgacaccgcttcagccctctatcgggat
KY476328_C_P-F      grtgatttcttyccgtcaattcgggacctactcgacaccgctgcagccctctaccgggat
KX757665_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctgtaccgggat
KY476330_C_P-F      actgatttctacccgtcagttcgggacctactcgacaccgctcaagcccttttccgggat
AB086397_C_P-F      ctggatttcttcccgtcagctcgggatctactcgacaccgcttcagccctctaccgggag
KJ638664_C_P-F      cttgatttcttcccgtcagctcgggacctactcgacaccgcttcagccctctaccgggat
KP718110_C_P-F      actgatttcttcccgtcagttcgggacctactcgacaccgcttcagctctcttccgggat
KY476325_C_P-F      tctgatttcttcccgtcaactcgggacctactcgacaccgcttcagccctctaccgggat
KJ638656_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctatcgggat
KP718107_C_P-F      tctgatttcttcccgtctgttcgggacctactcgacaccgcttcagccctctaccgggat
KJ638657_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KY476324_C_P-F      tctgatttctacccgtcagttcgggacttactcgacaccgcttcagccctctaccgggat
AY090459_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctttaccgggat
FJ589065_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctttaccgggat
KX757672_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctttaccgggat
JX899376_C_P-F      cctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctttaccgggat
AY090458_C_C-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctttaccgggat
AY090461_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctttaccgggat
KP718104_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctttaccgggat
KP718113_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctttaccgggat
HM627320_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
AF223963_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagctctgtaccgggat
KY476327_C_P-F      cttgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ586805_C_P-F      tctgactttttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
EU185743_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843195_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843167_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KC494400_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KY382415_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KY382416_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KY382417_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM622135_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
EU185744_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KP995096_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctataccgggat
KP995116_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctataccgggat
HE981187_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KF779236_C_P-F      tctgacttcttcccgtccgttcgggacctactcgacaccgcttcagccctctaccgggat
JN688699_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843199_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843202_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843198_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcacccctctaccgggat
KJ843194_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843190_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843193_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843181_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagctctctaccgggat
KJ843176_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843169_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843168_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843163_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ586808_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ586806_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KC494404_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM585193_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM585188_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgagat
HM590473_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgagat
FJ709494_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM585190_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
FJ709465_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
MK058437_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
FJ709458_C_P-F      tctgacttcttcccgtcagtacgggacctactcgacaccgcttcagccctctaccgggat
FJ709459_C_P-F      tctgacttcttcccgtcagtacgggacctactcgacaccgcttcagccctctaccgggat
HM585191_C_P-F      tctgacttcttcccgtcagtacgggacctactcgacaccgcttcagccctctaccgggat
HM585195_C_P-F      tctgacttcttcccgtcagtacgggacctactcgacaccgcttcagccctctaccgggat
HM585198_C_P-F      tctgacttcttcccgtcagtacgggacctactcgacaccgcttcagccctctaccgggat
EU366133_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
EU366118_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
FJ657529_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843201_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843203_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843206_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
DQ823092_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
DQ823093_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
FJ709460_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
FJ709464_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HQ378247_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843164_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843174_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843180_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KM998715_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KP995098_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KY458061_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KY458062_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
AB064316_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
AB116552_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
AF223964_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
AY179735_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
DQ823094_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
DQ823095_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
FJ709457_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
FJ709462_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
FJ709463_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HE981182_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HE981186_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM585187_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM585189_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM585192_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM585196_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM585197_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM585199_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
JN688691_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
JN688703_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KF199901_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ586807_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843170_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843171_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843179_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843196_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843197_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843200_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843204_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843205_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KX264496_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
DQ823091_C_P-F      tctgacttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
JN792916_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggac
JN792919_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
JN792920_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KY476331_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
JN792917_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
JN792918_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
EU670261_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
EU670262_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
JX079936_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
JN792914_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM585194_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KY476332_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KY476323_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM585186_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM590471_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM590472_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM590474_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KM233681_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
HM585200_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
JN792922_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843177_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KJ843178_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
KY476322_C_P-F      tctgatttcttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggat
MG098582_C_P-F      tctgatttcttcccgtcggttcggaacctactcaaccccgcttcacccctccacagcgat
MG098584_C_P-F      tctgatttctttccttcggttcgggacctactcracaccgcttcasccctcttcagggat
KJ638660_C_P-F      yctgatttctttccgtcgrytcgggacctcatcgacaccgcttcagccctctaccgggat
KJ638662_C_P-F      tctgatttctttccgtcggttcgggacctcctcgacaccgcttcagccctctaccgggat
AB365453_C_P-F      tctgatttcttcccgtcggttagggacctaatcgacaccgctacagctctctacagggat
MG098569_C_P-F      catgatttctacccgtccattcgggacctactcgacaccgctgcagctctcttcagggat
JQ272888_C_P-F      tctgatttctttccgtcggttcgggacctactcgacaccgcttcagctctctacagggat
MG098575_C_P-F      tctgatttctacccgtcagttcgggacctactcgacaccgcttcagctctctacagggat
MG098574_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagctctctacagggat
MG098583_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagctctctacagggat
KJ676694_C_P-F      tctgatttctacccttcggttcgggacctaatcgacaccgcttcagccctctacagggat
EU366132_C_P-F      aatgatttctacccgtcggctcgggacctactcgacaccgctacagccctctacagggat
JN688709_C_P-F      tctgatttcttcccgtcrgttcgggacctactcgacaccgcttcagccctcttcagggat
MG098579_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgctwcagccctcttcaaggat
MG098566_C_P-F      tctgatttctacccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
EF576808_C_P-F      actgatttcttcccgtcagctcgggacctattcgacaccgcttcagctctctacagggat
MG098570_C_P-F      tctgacttcttcccgccggttcgggacctactcgacaccgcttcagccctatacagggat
AB365450_C_P-F      amtgattwctwcccgtcggttcgggacctactcgacaccgcttcagctctctacagggat
MG098577_C_P-F      aatgatttcttcccgtcggctcgggacctactcgacaccgcttcagctctctacagggat
JN688720_C_P-F      tctgatttcttcccgtcggctcgggacctactcgacaccgctkcagccctctacagggat
X75658_C_C-F        tctgacttctttccgtcaatccgagaccttctcgacaccgcctcagctctgtatcgggat
MG098580_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctcttcagggat
MG098573_C_P-F      attgatttcttcccgtcggctcgggacctactcgacaccgcttcagctctctacagggat
KY476326_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
MG098578_C_P-F      wctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
AB166850_C_P-F      tctgatttctttccgtcggttcgggatctactcgacaccgcttcagccctctacagggat
AB214516_C_P-F      tctgatttctttccgtcggttcgggatctactcgacaccgcttcagccctctacagggat
JN688701_C_P-F      tctgatttcttcccgtcgattcgggacctactcgacaccgcttcagccctctacagggaw
AB365446_C_P-F      tctgatttcttcccgaatgttcgggacctactcgacaccgcttcagctctctacagggat
MG098565_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagctctctacagggat
KJ843226_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843225_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
AB365449_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagctctctacagggag
MG098564_C_P-F      tctgatttcttcccgtcggttcgggacctactcnacaccgcttcagccctctacagggat
DQ823087_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843210_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843209_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
JX079937_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
HQ420165_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
HQ420166_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
FJ657519_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
DQ823088_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
FJ657528_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
JN811655_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
JN811656_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843211_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843212_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843219_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843221_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843222_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843224_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KY382411_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
AF223965_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagctctctacagggat
EF576812_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagctctctacagggat
KJ843185_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagctctctacagggat
AF223962_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
DQ776247_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
DQ823089_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
DQ823090_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
EU366116_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
FJ657522_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
HE981181_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KC494398_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843175_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843189_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843207_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843208_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843213_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843220_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KJ843223_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
KX264499_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
DQ823086_C_P-F      tctgatttcttcccgtcggttcgggacctactcgacaccgcttcagccctctacagggat
                       ** *  *  **        *  *  *  *  *  ****   * *  *        * 

JN792921_C_P-F      gctttagartcaccwgaacattgcacwccyaaccatacygctctcaggcaagctatwttg
KP995115_C_P-F      gccttggagtcacctgagcattgctctccccaccatactgctctcaggcaagctattttg
KP995113_C_P-F      gctttagagtcacctgagcattgcactcccaaccatactgctatcaggcaagttcttttg
KP995114_C_P-F      gctttagagtcacctgagcattgctctccccaccatactgctatcaggcaagctgtttcg
KP995097_C_P-F      gctttagagtcacctgaacattgcactccccaccatactgctctcaggcaagctattttg
KC494399_C_P-F      gctttagagtcacctgaacattgctctccccaccatacggctctcaggcaagctgttggg
DQ899146_C_P-F      gctttagagtcacctgaacattgcactcccaatcacactgctctcaggcaagctattttg
DQ899144_C_P-F      gctttagagtcacctgaacattgcactcccaatcacactgctctcaggcaagctattttg
DQ899147_C_P-F      gctttagagtcacctgaacattgcactcccaatcacactgctctcaggcaagctattttg
DQ899145_C_P-F      gctttagagtcacctgaacattgcactcccaatcacactgctctcaggcaagctattttg
KC494396_C_P-F      gctttagagtcacctgaacattgcactccccaccataccgctctcaggcaagctatttta
KT896494_C_P-F      gctttagagtcacctgaacattgcactccccaccatactgctctcaggcaagctattttg
AY254498_C_P-F      gctttagagtctcctgaacattgctctcccaaccatactgctctcaggcaagctattttg
KP995107_C_P-F      gctttagagtcacctgaacattgctctcccaaccatactgctctcaggcaagctattttg
KP995104_C_P-F      gctctagagtcacctgagcattgcactcccaaccatactgctctcaggcaagctattttg
KJ843191_C_P-F      gctttaragtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
AY090455_C_P-F      gctttagagtcacctgagcattgcactcccaaccatactgctctcaggcaagctattttg
KC494401_C_P-F      gctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
KC494395_C_P-F      gctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
KX264497_C_P-F      gctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
KC494405_C_P-F      gctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
KC494403_C_P-F      gctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
KC494402_C_P-F      gctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
X69798_C_P-F        gctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
KC494394_C_P-F      gctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
KC494397_C_P-F      gctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
AY311369_C_P-F      gctttagagtcacctgagcattgcactcccaaccatactgctctcaggcaagctattttg
KP995110_C_P-F      gctttagagtcacctgagcattgcactcccaaccatactgctctcaggcaagctattttg
DQ899142_C_P-F      gctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
DQ899143_C_P-F      gctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
KP995120_C_P-F      gctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
KP995101_C_P-F      gctcttgagtcaccggaacattgctccccccatcacaccgctatcaggcaaattattttg
FJ589066_C_P-F      gctctagagtcaccggaacattgctccccccatcataccgctctcaggcaagctattttg
AB116550_C_P-F      gctcttgagtcatcggaacattgcaccccccatcataccgctctcaggcaagctattttg
KP995093_C_P-F      gctctagagtcacctgaacattgcactcccaatcacactgctctcaggcaagctattttg
KP718106_C_P-F      gctctagagtcaccggaacattgcacccctaatcataccgctctcaggcaagctattttg
X75663_C_P-F        gccttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KP995111_C_P-F      gctctagagtcaccggaacattgcaccccccatcataccgctctcaggcaaactgttttg
FJ589067_C_P-F      gctcttgagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KP995095_C_P-F      gctctggagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattgtg
KP995109_C_P-F      gctctggagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattgtg
KP995105_C_P-F      gctctagagtcaccggaacattgcaccccccatcataccgctctcaggcaagctattttg
KP995106_C_P-F      gctctggagtccccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KP995119_C_P-F      gctctagagtcaccagaacattgcaccccccatcataccgctctcaggcaagctattttg
KP995118_C_P-F      gcgctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
DQ899148_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctatcttg
AF324143_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KP995117_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KP718103_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
DQ899149_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AY311370_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
MH051986_C_P-F      gctctagagtcaccggaacattgcacccccaatcatactgctctcaggcaagctattttg
MH051987_C_P-F      gctctagagtcaccggaacattgcacccccaatcatactgctctcaggcaagctattttg
KP995124_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KP995126_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
JF439884_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
JF439885_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AB116551_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KP718109_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KP718112_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AB036910_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KP718111_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KP995091_C_P-F      gcgctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AB036920_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AB036914_C_P-F      gctctagagtcaccggagcattgcacccccaatcataccgctctcaggcaagctattttg
AB036915_C_P-F      gctctagagtcaccggagcattgcacccccaatcataccgctctcaggcaagctattttg
AB036916_C_P-F      gctctagagtcaccggagcattgcacccccaatcataccgctctcaggcaagctattttg
AB036917_C_P-F      gctctagagtcaccggagcattgcacccccaatcataccgctctcaggcaagctattttg
AB036919_C_P-F      gctctagagtcaccggagcattgcacccccaatcataccgctctcaggcaagctattttg
AB036911_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AB036905_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AB036906_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AB036907_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AB036909_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AB036912_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AB036913_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KX264498_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AB036908_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ638659_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
DQ899150_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AB116549_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KP995123_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KP995125_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ638663_C_P-F      gctttagaatcaccagaacattgcacacctcaccatacagctctcaggcaagctgtattg
KY476329_C_P-F      gctttagagtcacctgaacattgctcacctaaccataccgctctccggcaagctatattg
AB116654_C_P-F      gctttagaatcaccagaacactgcacagctcaccataccgctatcaggcaaattgtattg
FJ657525_C_P-F      gctttggaatcaccagaacattgctcacctcaccataccgctctcaggcaagttagtttg
KY476328_C_P-F      gctttagaatcatcggaacattgcacccatcaccataccgctctcaggcaagctatattg
KX757665_C_P-F      gctctagaatcaccggaacattgcacmccyaatcataccgctctcaggcaagctattttg
KY476330_C_P-F      gctttagaatcaccagaacattgcacacctcaccataccgctctcaggcatgttatattg
AB086397_C_P-F      gctttagaatcaccagaacattgcacagctcaccataccgctctcaggcaagctatattg
KJ638664_C_P-F      gctttagaatcaccagaacattgcacacctcaccataccgctctcaggcaagctatattg
KP718110_C_P-F      gctttagaatcaccagaacattgctcacatcaccataccgccctcaggcaagctatattg
KY476325_C_P-F      gctttagaatcaccggaacattgcacccatcaccataccgctctcaggcaagctatagtg
KJ638656_C_P-F      gctttagaatcaccagaacattgcacacctcaccataccgctatcaggcaagctatattg
KP718107_C_P-F      gctttagaatcaccagaacattgcacacctcaccataccgctctcaggcaagctatattg
KJ638657_C_P-F      gctttagaatcaccagagcattgcacacctmaccataccgctctcaggcaagctatattg
KY476324_C_P-F      gctttagaatcaccagaacattgcacacctcaccataccgctctcaggcaagctatattg
AY090459_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatcttg
FJ589065_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatcttg
KX757672_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgccctcaggcaagctatcttg
JX899376_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatcttg
AY090458_C_C-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatcttg
AY090461_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KP718104_C_P-F      gctttagaatcacctgaacattgcacacctaaccataccgctctcaggcaagctatcttg
KP718113_C_P-F      gctttagaatcacctgaacattgcacacctaaccataccgctctcaggcaagctatcttg
HM627320_C_P-F      gctttagaatcaccagaacattgcacacctcaccataccgctctyaggcaarytatattg
AF223963_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctatattg
KY476327_C_P-F      gctttagaatcaccagaacattgcacacctcaccataccgctctcaggcaagctatattg
KJ586805_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctttcaggcaagctatattg
EU185743_C_P-F      gctttagaatcaccagaacattgcacacctaaccatacagctctcaggcaagctatattg
KJ843195_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843167_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KC494400_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KY382415_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KY382416_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KY382417_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM622135_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
EU185744_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KP995096_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctttcaggcaagctatattg
KP995116_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HE981187_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KF779236_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
JN688699_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843199_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843202_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843198_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843194_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843190_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843193_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843181_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843176_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843169_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843168_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843163_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ586808_C_P-F      gctttaaaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ586806_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KC494404_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585193_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585188_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM590473_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
FJ709494_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585190_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
FJ709465_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
MK058437_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
FJ709458_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
FJ709459_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585191_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585195_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585198_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
EU366133_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
EU366118_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
FJ657529_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843201_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843203_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843206_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
DQ823092_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
DQ823093_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
FJ709460_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
FJ709464_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HQ378247_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843164_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843174_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843180_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KM998715_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KP995098_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KY458061_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KY458062_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
AB064316_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
AB116552_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
AF223964_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
AY179735_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
DQ823094_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
DQ823095_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
FJ709457_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
FJ709462_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
FJ709463_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HE981182_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HE981186_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585187_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585189_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585192_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585196_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585197_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585199_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
JN688691_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
JN688703_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KF199901_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ586807_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843170_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843171_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843179_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843196_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843197_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843200_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843204_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843205_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KX264496_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
DQ823091_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
JN792916_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
JN792919_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
JN792920_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KY476331_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
JN792917_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
JN792918_C_P-F      gctttagaatcaccagaacattgcacacatcaccataccgctctcaggcaagctatattg
EU670261_C_P-F      gctttagaatcaccagaacattgcacacctaatcatactgctctcaggcaagctatattg
EU670262_C_P-F      gctttagaatcaccagaacattgcacacctaatcatactgctctcagacaagctatattg
JX079936_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
JN792914_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585194_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KY476332_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KY476323_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585186_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM590471_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM590472_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM590474_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KM233681_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
HM585200_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
JN792922_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843177_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KJ843178_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
KY476322_C_P-F      gctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
MG098582_C_P-F      gctttaaagtccccggaactttgcccccccaatcataccgctctcaggcaasttatttcg
MG098584_C_P-F      gctttaragtcaccggaacwttgcaccccccatcataccgctctcaggcaagctattgtg
KJ638660_C_P-F      gcattagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattgtg
KJ638662_C_P-F      gctttagagtcaccggaacattgcaccccccatcataccgctctyagrcaarttattttg
AB365453_C_P-F      gacttagagtcaccggaacattgcaccgcccatcataccgctctcaggcaagctattgtg
MG098569_C_P-F      gctttagagtcaccggaacattgcaccccccaccatacagctatcaggcaagctattttg
JQ272888_C_P-F      gctttagagtcacctgaacattgcaccccccatcataccgctatcaggcaagctatattg
MG098575_C_P-F      gctttagagtcaccaaaacattgctccccccatcataccgctatcaggcaagctgttttg
MG098574_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
MG098583_C_P-F      tctttagagtcaccggaacattgctccccccatcataccgctctcaggcaagctatttcg
KJ676694_C_P-F      gcgttagagtcaccggaacattgcaccccccatcataccgctctcaggcaagctattttg
EU366132_C_P-F      gctttagagtcaccggaacattgctccccccatcataccgttatcaggcaagctgttttg
JN688709_C_P-F      gctttagagtcaccggaacattgcaccccccatcataccgctctcaggcaagctattgtg
MG098579_C_P-F      gctttagagtcaccggaacattgcaccccccatcataccgctctcaggcaagctgttttg
MG098566_C_P-F      gctttagagtcaccagaacattgcacccaccatcataccgctctcaggcaagctattttg
EF576808_C_P-F      gctttagagtcaccgcaacattgcaccccccatcataccgctctcaggcaagctattttg
MG098570_C_P-F      gctttagagtcaccggaacattgcactccccatcataccgctctcaggcaagctattttg
AB365450_C_P-F      gctttagagtcaccggaacattkcaccccccatcatamcgctctcaggcaagctattttg
MG098577_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
JN688720_C_P-F      gctttagagtcaccggaacattgcaccccccatcataccgctatcaggcaagctgttttg
X75658_C_C-F        gcgttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
MG098580_C_P-F      gctttagagtcaccggaacattgcaccccccatcataccgctctcaggcaagctattgtg
MG098573_C_P-F      gctttagagtcaccggaacattgctccccccatcataccgctatcaggcaagctattttg
KY476326_C_P-F      gctttagagtcaccggaacattgytccccccatcataccgctctcaggcaagctattttg
MG098578_C_P-F      gctttagagtcaccggaacattgcaccccccatcataccgctctcaggcaagctattttg
AB166850_C_P-F      gctttagagtcaccggaacattgcactcccaatcataccgctctcaggcaagctattttg
AB214516_C_P-F      gctttagagtcaccggaacattgcactcccaatcataccgctctcaggcaagctattttg
JN688701_C_P-F      gctttagagtcaccggaacattgcacccacmatcataccgctctcaggcaagctattttg
AB365446_C_P-F      gctttagagtcaccggaacattgcaccccccatcataccgctctcaggcaagctattttg
MG098565_C_P-F      gctttagagtcaccggaacattgcaccccctctcataccgctctcaggcaagctattttg
KJ843226_C_P-F      gctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843225_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AB365449_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
MG098564_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
DQ823087_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843210_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843209_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
JX079937_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
HQ420165_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
HQ420166_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
FJ657519_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
DQ823088_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
FJ657528_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
JN811655_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
JN811656_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843211_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843212_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843219_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843221_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843222_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843224_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KY382411_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AF223965_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
EF576812_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843185_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
AF223962_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
DQ776247_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
DQ823089_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
DQ823090_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
EU366116_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
FJ657522_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
HE981181_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KC494398_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843175_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843189_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843207_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843208_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843213_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843220_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KJ843223_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
KX264499_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
DQ823086_C_P-F      gctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
                        *  * **  *  * *  *   *       ** *  *   *  * **   *      

JN792921_C_P-F      tgytggggtgagttaatgactttggcttcctgggtgggcaataatttggargaycctgsw
KP995115_C_P-F      tgttgggatgagttaatgattttcgcttcctgggtgggcaataatttggacgaccctgca
KP995113_C_P-F      tgctggaatgagttaatgacttttgcttcctgggtgggcgagaatttggatgaccctgca
KP995114_C_P-F      tgttggggtgaattaataactttggcttcctgggtgggcaataatttggatgaccctgca
KP995097_C_P-F      tgttggggtgagttaacgactttggcttcctgggtgggcaataatttggatgacgctgca
KC494399_C_P-F      tgttggggtgaggtatcgactttggcttcctgggtgggcaataatttggaggaccctgca
DQ899146_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaggaccctgct
DQ899144_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaggaccctgct
DQ899147_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaggaccctgct
DQ899145_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaggaccctgct
KC494396_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggacgaccctgga
KT896494_C_P-F      tgttgggttgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
AY254498_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KP995107_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP995104_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843191_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
AY090455_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KC494401_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KC494395_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KX264497_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KC494405_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KC494403_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KC494402_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
X69798_C_P-F        tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KC494394_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KC494397_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
AY311369_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KP995110_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
DQ899142_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
DQ899143_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KP995120_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KP995101_C_P-F      tgctggggtgagttaatgtctttggcttcctgggtgggtaataatttggaagaccctgca
FJ589066_C_P-F      tgctggggtgagttaatggttttcgcttcctgggtgggcaataatttggaagatcctgca
AB116550_C_P-F      tgctggggtgagttaatgattttcgctgcttgggtgggtaataatttggaagaccctgca
KP995093_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP718106_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtmataatttggaaraccctgcw
X75663_C_P-F        tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP995111_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
FJ589067_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP995095_C_P-F      tgctggggtgaggtaatgactttggcttcctgggtgggtaatcatttggaagaccctgca
KP995109_C_P-F      tgctggggtgaggtaatgactttggcttcctgggtgggtcataatttggaagaccctgca
KP995105_C_P-F      tgctggggtgaattaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP995106_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP995119_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP995118_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagatcctgca
DQ899148_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AF324143_C_P-F      tgctggggtgagttaatgattttcgcttcctgggtgggtaataatttggaagaccctgca
KP995117_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP718103_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
DQ899149_C_P-F      tgctggggtgagttaatgactttggcctcctgggtgggtaataatttggaagaccctgca
AY311370_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
MH051986_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
MH051987_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP995124_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP995126_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
JF439884_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
JF439885_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB116551_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP718109_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP718112_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036910_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP718111_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP995091_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaacaatctggaagaccctgca
AB036920_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036914_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036915_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036916_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036917_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036919_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036911_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036905_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036906_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036907_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036909_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036912_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036913_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KX264498_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB036908_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KJ638659_C_P-F      tgctggactgaggtaatgactttggcttcctgggtgggtaataatttggaagaccctgca
DQ899150_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
AB116549_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP995123_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KP995125_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgca
KJ638663_C_P-F      tgctggactgaggtaatgactttggctacctgggtgggccataatttggacgatcctgca
KY476329_C_P-F      tgctggaatgaggtaacggagtttggtaactgggtgggcaataatttggaagatcctgct
AB116654_C_P-F      tgctggggtgagttgatgactttggcttcctgggtgggcaataatttggacgatcctgct
FJ657525_C_P-F      tgctggagtgagttaatgactttcgctatctgggtgggcaataatttggaagatcctgct
KY476328_C_P-F      tgctggggtgaggtaatgaatttggcttcctgggtgggcaataatttgcaagatcctgct
KX757665_C_P-F      tgctggggtgagttaatgactttggcttcctgggtggggaataatttggaagatcctgca
KY476330_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
AB086397_C_P-F      tgctggggtgagttaacgactttggctacctgggtgggcaataatttggacgatcctgct
KJ638664_C_P-F      tgctggaatgaggtaacgactttggcttcctgggtgggcaataatttggaagatcctgca
KP718110_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgca
KY476325_C_P-F      tgctggttggaggtaacgactttggcttcctgggtgggcaataatttggacgatcctgct
KJ638656_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgca
KP718107_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgca
KJ638657_C_P-F      tgctggggtgagttaatgactttsgcttcctgggtgggcaataatttggaagatcctgsa
KY476324_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
AY090459_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagatcctgca
FJ589065_C_P-F      tgctggggtgagttaatgactttggcttcctgggtggggaataatttggaagatcctgca
KX757672_C_P-F      tgctggggtgagttaatgactttggcttcctgggtggggaataatttggaagatcctgca
JX899376_C_P-F      tgctggggtgagttaatgactttggcttcctgggtggggaataatttggaagatcctgca
AY090458_C_C-F      tgctggggtgagttaatgactttggcttcctgggtggggaataatttggaagatcctgca
AY090461_C_P-F      tgctggggtgagttaatgactttggcttcctgggtggggaataatttggaagatcctgca
KP718104_C_P-F      tgctggggtgagttaatgactttggcttcctgggtggggaataatttggaagatcctgca
KP718113_C_P-F      tgctggggtgagttaatgactttggcttcctgggtggggaataatttggaagatcctgca
HM627320_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggacgatcctgct
AF223963_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KY476327_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
KJ586805_C_P-F      tgctggggggagttaatgactttggcttcctgggggggcaataacttggaagatcctgct
EU185743_C_P-F      tgctggggtgagttaatgactttggcttccttggtgggcaataacttggaagatcctgct
KJ843195_C_P-F      tgctggagtgaggtaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843167_C_P-F      ggctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KC494400_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KY382415_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KY382416_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KY382417_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HM622135_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
EU185744_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KP995096_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KP995116_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HE981187_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KF779236_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
JN688699_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843199_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843202_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843198_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843194_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843190_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843193_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843181_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843176_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843169_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843168_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843163_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ586808_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ586806_C_P-F      tgctggggggagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KC494404_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HM585193_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HM585188_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HM590473_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
FJ709494_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaacaacttggaagatcctgct
HM585190_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaacaacttggaagatcctgct
FJ709465_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
MK058437_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
FJ709458_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
FJ709459_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HM585191_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HM585195_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HM585198_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
EU366133_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
EU366118_C_P-F      tgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaagatcctgct
FJ657529_C_P-F      tgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaagatcctgct
KJ843201_C_P-F      tgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaagatcctgct
KJ843203_C_P-F      tgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaagatcctgct
KJ843206_C_P-F      tgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaagatcctgct
DQ823092_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
DQ823093_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
FJ709460_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
FJ709464_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HQ378247_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843164_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843174_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843180_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KM998715_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KP995098_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KY458061_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KY458062_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
AB064316_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
AB116552_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
AF223964_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
AY179735_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
DQ823094_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
DQ823095_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
FJ709457_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
FJ709462_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
FJ709463_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HE981182_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HE981186_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HM585187_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HM585189_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HM585192_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HM585196_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HM585197_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
HM585199_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
JN688691_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
JN688703_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KF199901_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ586807_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843170_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843171_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843179_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843196_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843197_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843200_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843204_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KJ843205_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
KX264496_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
DQ823091_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgct
JN792916_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
JN792919_C_P-F      tgctggggtgagttaatgattttcgcttcctgggtgggcaataatttggaagatcctgct
JN792920_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctggt
KY476331_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
JN792917_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttgcaagatcctgct
JN792918_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggacgatcctgct
EU670261_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
EU670262_C_P-F      tgctggggtgagttagtgactttggcttcctgggtgggcaataatttggaagatcctgct
JX079936_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
JN792914_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
HM585194_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
KY476332_C_P-F      tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
KY476323_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
HM585186_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
HM590471_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
HM590472_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
HM590474_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
KM233681_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
HM585200_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
JN792922_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
KJ843177_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
KJ843178_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
KY476322_C_P-F      tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgct
MG098582_C_P-F      tgttggggtgaattaataactttggcttccggggtgggcaataatttgaagaaccctgct
MG098584_C_P-F      tgttgaaatgaggtaatagctctagcttcctgggtgggcaataatttgratgaacctgca
KJ638660_C_P-F      tgttggggtgaggtaatgactttggctgcctgggtgggccataatttggaggaccctgca
KJ638662_C_P-F      tgttggggtgagttaacgaatttgggttcctgggtgggcaataatttggaggacmctgca
AB365453_C_P-F      tgttggggtgaagtaatgactttggcttcctgggtgggcaataatttggacgaccctgga
MG098569_C_P-F      tgttggggtgaattaatggttttcgcttcctgggtgggcaacaatttgcaggaccctgca
JQ272888_C_P-F      tgttggggcgaattaatggttttcgcttcctgggtgggcaataatttgcaagacgctgca
MG098575_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggatgaccctgca
MG098574_C_P-F      tgttggggtgaattaatgattttggcttcctgggggggcaatattttggagaaccctgca
MG098583_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ676694_C_P-F      tgttggacagaggtaatgactctggcttcctgggtgggcaataatttggaagaccctgca
EU366132_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
JN688709_C_P-F      tgttggggtgaagtawcgactttkgcttcctgggtgggccataatttrgaggaccctgca
MG098579_C_P-F      tgttggggtgaattaatgaatttggcttcctgggtgggcaataatttggaggaccctgca
MG098566_C_P-F      tgttggaatgaattaatgacttttgcttcctgggtgggcaataatttggatgaccctgca
EF576808_C_P-F      tgttggggtgaattaacgactctggcttcctgggtgggcaataatttggaggaccctgca
MG098570_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
AB365450_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggatgaccctgca
MG098577_C_P-F      tgttgggatgaattaatgacttttgctgcctgggtgggcaataatttggaggaccctgca
JN688720_C_P-F      tgttggaatgaattaatgactttcgcttcctgggtgggcaataatttggaggaccctgca
X75658_C_C-F        tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
MG098580_C_P-F      tgttggaatgaggtaatagctttggcttcctgggtgggcaataatttggatgaccctgca
MG098573_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KY476326_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaagaccctgca
MG098578_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcc
AB166850_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
AB214516_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
JN688701_C_P-F      tgttggggtgaattaatgaatttggcttcctgggtgggcaataatttggaygaccctgca
AB365446_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
MG098565_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843226_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843225_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
AB365449_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttgcaggaccctgca
MG098564_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
DQ823087_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843210_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843209_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
JX079937_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
HQ420165_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
HQ420166_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
FJ657519_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
DQ823088_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
FJ657528_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
JN811655_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
JN811656_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843211_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843212_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843219_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843221_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843222_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843224_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KY382411_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
AF223965_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
EF576812_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843185_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
AF223962_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
DQ776247_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
DQ823089_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
DQ823090_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
EU366116_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
FJ657522_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
HE981181_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KC494398_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843175_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843189_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843207_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843208_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843213_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843220_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KJ843223_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
KX264499_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
DQ823086_C_P-F      tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
                     * **    **  *        * *       ** ***  *     *  *  *  ***  

JN792921_C_P-F      gctagggayytagtrgttaactatgtyaayactaacatgggcctmaaaattagacaaytr
KP995115_C_P-F      tctagggatttagtagttaactatgttaacattaacatgggcctcaaaattagacgactg
KP995113_C_P-F      gctaggaattcagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
KP995114_C_P-F      gctagggatttagtagttaactatgttaacactcacatgggcctaaaaattagacaactg
KP995097_C_P-F      gctagggatttagtagttaactatgttaacactcacatgggcctaaaaattagacaattg
KC494399_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcctaaaacttagacaactg
DQ899146_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaacta
DQ899144_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaacta
DQ899147_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaacta
DQ899145_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaacta
KC494396_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaagttagacaactg
KT896494_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
AY254498_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
KP995107_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
KP995104_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
KJ843191_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
AY090455_C_P-F      gctagggacttagttgttaactatgttaacactaacatgggcctaaaaattagacaactg
KC494401_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
KC494395_C_P-F      gctagggatttagtagttaactatgttaacaccaacatgggcctaaaaattagacaactg
KX264497_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
KC494405_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
KC494403_C_P-F      gctagggatttagtagttaactatgtcaacactaacatgggcctaaaaattagacaactg
KC494402_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
X69798_C_P-F        gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
KC494394_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
KC494397_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
AY311369_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
KP995110_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
DQ899142_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
DQ899143_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
KP995120_C_P-F      gctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactg
KP995101_C_P-F      gctagggatttagtagttaattatgtcaacaataatatgggcctgaaaattagacaaatg
FJ589066_C_P-F      gctagggatttagtagttaattatgtcaacactcatatgggcctgaaaattagacaactg
AB116550_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacgactg
KP995093_C_P-F      gctagggatttagtagttaattatgtcaacactaatacgggcctgaaaattagacaactg
KP718106_C_P-F      gctagggatttartarttaattatgtcaacactaatatgggcctgaaaattagacaactg
X75663_C_P-F        gctagggatttagtagttaattatgtcaacactaatatgggcttaaagattagacaacta
KP995111_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
FJ589067_C_P-F      gctagggatttagtagttaattatgtcaacactcatatgggcctgaaaattagacaactg
KP995095_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KP995109_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KP995105_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KP995106_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctaaaaattagacaaatg
KP995119_C_P-F      gctagggatttagtagttaattatgtcaacaataatatgggcctgaaaattagacaactg
KP995118_C_P-F      gctagggatttagtagttaattatgtcaacacaaatatgggcctgaaaattagacaactg
DQ899148_C_P-F      gctagggatttagtagttaactatgtcaacactaatatgggcctgaaaattagacaactg
AF324143_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggccttaaaattagacaactg
KP995117_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KP718103_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
DQ899149_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacagctg
AY311370_C_P-F      gctagggatttggtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
MH051986_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
MH051987_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KP995124_C_P-F      gctagggatttggtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KP995126_C_P-F      gctagggatttggtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
JF439884_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
JF439885_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB116551_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KP718109_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctaaaaattagacaactg
KP718112_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctaaaaattagacaactg
AB036910_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KP718111_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KP995091_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB036920_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB036914_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB036915_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB036916_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB036917_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB036919_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB036911_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaattg
AB036905_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB036906_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB036907_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB036909_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB036912_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB036913_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KX264498_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB036908_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KJ638659_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
DQ899150_C_P-F      gctagggatctagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
AB116549_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KP995123_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KP995125_C_P-F      gctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactg
KJ638663_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
KY476329_C_P-F      gccagggacttagtggttgactatgtcaatactaacatgggcctaaagattagacaatta
AB116654_C_P-F      gctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaatta
FJ657525_C_P-F      gctagggatctagtggttaactatgtcaatactcacatgggcctaaaaattagacaatta
KY476328_C_P-F      gcaagggacctcgtggttaactatgtcaatactcacatgggcctaaaaattagacaatta
KX757665_C_P-F      gctagggatctagtggttaactatgtcaacactaatatgggcctgaaaattagacaatta
KY476330_C_P-F      gctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaatta
AB086397_C_P-F      gctagggacctagtggttaactatgtcaatactcacatgggcctaaaaaccagacaattg
KJ638664_C_P-F      gctagggaccaagtggttaactatgtcaatactaacatgggcctaaaaattagacaacta
KP718110_C_P-F      gctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaatta
KY476325_C_P-F      gctagggacctcgtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
KJ638656_C_P-F      gctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaatta
KP718107_C_P-F      gctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagrcaatta
KJ638657_C_P-F      gctaggracctagtggttractatgtcaataytaacatgggcctaaaaattagacawtta
KY476324_C_P-F      gctagggacttagtggttaactatgtcaatactcacatgggcctaaagattagacaatta
AY090459_C_P-F      gatagggacytagtggttaactatgttaatactaatatgggcctaaaaattagacaatta
FJ589065_C_P-F      gctagggacctagtggttaactatgttaatactaatatgggcctaaaaattagacaatta
KX757672_C_P-F      gctagggacctagtggttaactatgttaatactaatatgggcctaaaaattagacaatta
JX899376_C_P-F      gctagggacctagtggttaactatgttaatactaatatgggcctaaaaattagacaatta
AY090458_C_C-F      gctagggacctagtggttaactatgttaatactaatatgggcctaaaaattagacaatta
AY090461_C_P-F      gctagggacctagtggttaactatgttaatactaatatgggcctaaaaattagacaatta
KP718104_C_P-F      gctagggacctagtggttaactatgttaatactaatatgggcctaaaaattagacaatta
KP718113_C_P-F      gctagggacctagtggttaactatgttaatactaatatgggcctaaaaattagacaatta
HM627320_C_P-F      gctagggacctagtggttaactatgtcaatactmacatgggcctaaaaattagacaatta
AF223963_C_P-F      gctagggacttagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KY476327_C_P-F      gctagggacttagtggttaactatgtcaatactaacatgggcctaaagattagacaatta
KJ586805_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
EU185743_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843195_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843167_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KC494400_C_P-F      gctagggacctagtggttaaatatgtcaatactaacatgggcctaaaaattagacaattg
KY382415_C_P-F      gccagggacctagyggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KY382416_C_P-F      gccagggacctagyggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KY382417_C_P-F      gccagggacctagyggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM622135_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
EU185744_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KP995096_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KP995116_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HE981187_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaatttgacaattg
KF779236_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
JN688699_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattanacaattg
KJ843199_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattaracaattg
KJ843202_C_P-F      gctagggacctagtggttaactatgtcaacactaacatgggcctaaaaattagacaattg
KJ843198_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843194_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843190_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843193_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843181_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843176_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843169_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843168_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843163_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ586808_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ586806_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KC494404_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM585193_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM585188_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM590473_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
FJ709494_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM585190_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
FJ709465_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
MK058437_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
FJ709458_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
FJ709459_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM585191_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM585195_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM585198_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
EU366133_C_P-F      gctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaattg
EU366118_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
FJ657529_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843201_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843203_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843206_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
DQ823092_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
DQ823093_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
FJ709460_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
FJ709464_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HQ378247_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843164_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843174_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843180_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KM998715_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KP995098_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KY458061_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KY458062_C_P-F      gccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
AB064316_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
AB116552_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
AF223964_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
AY179735_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
DQ823094_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
DQ823095_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
FJ709457_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
FJ709462_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
FJ709463_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HE981182_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HE981186_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM585187_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM585189_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM585192_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM585196_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM585197_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
HM585199_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
JN688691_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
JN688703_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KF199901_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ586807_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843170_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843171_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843179_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843196_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843197_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843200_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843204_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KJ843205_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
KX264496_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
DQ823091_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattg
JN792916_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
JN792919_C_P-F      gctagggacctagtggttaactatgtcaatattaacatgggcctaaaaattagacgatta
JN792920_C_P-F      gctagggacctagtggttaactatgtcaatamtaacatgggcctaaaaattagacaatta
KY476331_C_P-F      gctagggacttagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
JN792917_C_P-F      gctagggaccaagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
JN792918_C_P-F      gctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaatta
EU670261_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
EU670262_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
JX079936_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
JN792914_C_P-F      gctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaatta
HM585194_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
KY476332_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
KY476323_C_P-F      gctagggacctcgtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
HM585186_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
HM590471_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
HM590472_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
HM590474_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
KM233681_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
HM585200_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
JN792922_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
KJ843177_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
KJ843178_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
KY476322_C_P-F      gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaatta
MG098582_C_P-F      gccagggatttattatttaactatgttaacactaatatgggcttaaagataaaacaacta
MG098584_C_P-F      tctagggatttagtagttaactatgttaacactaatatgggcctaaagatcaaacaacta
KJ638660_C_P-F      gctagggatttagtagtgaattatgtcaatactaacatgggcctaaaaattagacaacta
KJ638662_C_P-F      gctagggattyagtagtgaattatgtcaatactaacatgggcctaaaaactagacaacta
AB365453_C_P-F      gccagggatttagtagttaactatgttaacactcacatgggcctaaagattagacaatta
MG098569_C_P-F      tccagggatttagtagttgactatgttaacattaacatgggcttaaagattacacaatta
JQ272888_C_P-F      gccagggatttagtagtcgactatgttaacactcacatgggcttaaagattagacattta
MG098575_C_P-F      gccagggatttagtagttaactatgttaacactcacatgggcttaaagattagacaatta
MG098574_C_P-F      gccggggatttattagttaactctgttaacactcacgtgggcttaaagatgaaacaatta
MG098583_C_P-F      gccagggatttagtagttaactatgttaacactcacatgggcgtaaagatgagacaatat
KJ676694_C_P-F      gctagggatttagtagttaactatgttaacactcacatgggcctaaagatyagacaacta
EU366132_C_P-F      gccagggatttagtagtgaactatgttaacactaccgtgggcctaaagcttagacaacta
JN688709_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
MG098579_C_P-F      gccagggatttagtagttaactatgttaacavtcacatgggattaaagattagacaaata
MG098566_C_P-F      gccagggatttagtagttaactatgttaacattaacatgggcttaaagattagacaacta
EF576808_C_P-F      tccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaatta
MG098570_C_P-F      gccagggatttagtagttaactatgttaacaataacatgggcttaaaaattagacaacta
AB365450_C_P-F      gccagggatttagtagttaactatgttaacactcacatgggcttaaagattagacaatta
MG098577_C_P-F      gccagggatttagtagttaactatgttaacattaacatgggcttaaagattagacaatta
JN688720_C_P-F      gccagggatttagtagttaactatgttaacattaacatgggcttaaagattagacaacta
X75658_C_C-F        gccagggatttagtagttaactatgttaacactaatatgggcttaaagattagacaacta
MG098580_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
MG098573_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaatta
KY476326_C_P-F      gccagggatttagtagttaactatgttaacactcacatgggcttaaagattagacaacta
MG098578_C_P-F      gccagggatttagtagttaactatgttaacactcatatgggcttaaagattagacaacta
AB166850_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaaaattagacaacta
AB214516_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaaaattagacaacta
JN688701_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
AB365446_C_P-F      gccagggatttagtagttaactatgttaacactcacatgggcttaaagattagacaatta
MG098565_C_P-F      gccagggatttagtagttaactatgtcaacaataacatgggcttaaagattagacaatta
KJ843226_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaaaattagacaacta
KJ843225_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaaaattagacaacta
AB365449_C_P-F      gcaagggatttagtagttaactatgttaacactcacatgggcttaaagattagacaatta
MG098564_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
DQ823087_C_P-F      gccagggatttagtagttaactatgttaacactcacatgggcttaaagattagacaacta
KJ843210_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843209_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaatta
JX079937_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
HQ420165_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
HQ420166_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
FJ657519_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
DQ823088_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
FJ657528_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
JN811655_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
JN811656_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843211_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843212_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843219_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843221_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843222_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843224_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KY382411_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
AF223965_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaatta
EF576812_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaatta
KJ843185_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaatta
AF223962_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
DQ776247_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
DQ823089_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
DQ823090_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
EU366116_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
FJ657522_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
HE981181_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KC494398_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843175_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843189_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843207_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843208_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843213_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843220_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KJ843223_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
KX264499_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaacta
DQ823086_C_P-F      gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaatta
                        ** *        *  * * *** ** *       ***  * **       *     

JN792921_C_P-F      ytgtggtttcacatttcctgccttacttttggaagagaaryagttctwgagtatttggtg
KP995115_C_P-F      ttgtggtttcacatttcctgcatcatgtttggaagagacctagttcttgagtatttggtg
KP995113_C_P-F      ttgtggtttcacatttcctgcctcacttttggaacacaaacagttgttgagtatttggtg
KP995114_C_P-F      ttgtggtttcacatttcctgcctcacttttggaagacaagtagttcttgagtatttggtg
KP995097_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttgttcagtatttggtg
KC494399_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttgtagagtatttggtg
DQ899146_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ899144_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ899147_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ899145_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KC494396_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttctcgagtatttggtg
KT896494_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttctagagtatttggtg
AY254498_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KP995107_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtc
KP995104_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843191_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttttagagtatttggtg
AY090455_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KC494401_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttctagagtatttggtg
KC494395_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttctagagtatttggtg
KX264497_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KC494405_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttctagagtatttggtg
KC494403_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttctagagtatttggtg
KC494402_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttctagagtatttggtg
X69798_C_P-F        ttgtggtttcacatttcctgccttacttttggaagagaaacagttctagagtatttggtg
KC494394_C_P-F      ttgtggtttcacatttcctcccttacttttggaagagaaacagttctagagtatttggtg
KC494397_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttctagagtatttggtg
AY311369_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KP995110_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ899142_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ899143_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KP995120_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KP995101_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
FJ589066_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagatacagttattcagtatttggtg
AB116550_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagacaagtagttcttgagtatttggtg
KP995093_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP718106_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgartatttggtg
X75663_C_P-F        ttgtggtttcacatctcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP995111_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
FJ589067_C_P-F      ttgtggtttcacatttcctgtctgacttttggaagagacacagttcttgagtatttggtg
KP995095_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP995109_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP995105_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagacacagttcttgagtatttggtg
KP995106_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP995119_C_P-F      ttatggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP995118_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
DQ899148_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AF324143_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP995117_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP718103_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgaatatttggtg
DQ899149_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AY311370_C_P-F      ttgtggtttcacatttcctgtcttacgtttggaagagaaacagttcttgagtatttggtg
MH051986_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
MH051987_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP995124_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP995126_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
JF439884_C_P-F      ttgtggtttcacatttcctgtcttacgtttggaagagaaacagttcttgagtatttggtg
JF439885_C_P-F      ttgtggtttcacatttcctgtcttacgtttggaagagaaacagttcttgagtatttggtg
AB116551_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP718109_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP718112_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036910_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtc
KP718111_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP995091_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036920_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036914_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036915_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036916_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036917_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036919_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036911_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036905_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036906_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036907_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036909_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036912_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036913_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KX264498_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB036908_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KJ638659_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
DQ899150_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
AB116549_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP995123_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KP995125_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KJ638663_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacggttcttaactatttggtg
KY476329_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaagtagttcttgagtatttggtg
AB116654_C_P-F      ctgtggtttcacatttcctgccttacttttggaagacaaacagttctggagtatttggtg
FJ657525_C_P-F      ctgtggtttcacrtttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KY476328_C_P-F      ctgtggtttcacgtttcctgccttacttttggaagagaagtagttcttgagtatttggtg
KX757665_C_P-F      ctgtggtttcacatctcctgtcttacttttggaagagaaacagttcttgagtatttggtg
KY476330_C_P-F      ctgtggtttcacacttcctgccttacttttggaagagaagtagttcttgaatatttggtg
AB086397_C_P-F      ctgtggtttcacatttcctgccttagttttggaagagaaacagttcttgagtatttggtg
KJ638664_C_P-F      ctgtggtttcacatttcctgccttacttttggaagaactacagttcttgagtatttggtg
KP718110_C_P-F      ctgtggtttcacatttcctgcattatttttggaagagatatagttcttgartatttggtg
KY476325_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ638656_C_P-F      ctgtggtttcacatttcctgccttacttttggaagacaaacagttcttgagtatttggtg
KP718107_C_P-F      ctgtggtttcacatttcctgccttacttttggaagmaacacagttcttgagtatttggtg
KJ638657_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KY476324_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaagtagttattgagtatttggtg
AY090459_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ589065_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KX757672_C_P-F      ctgtggtttcacatttcctgccttacttttgggagagaaacagttcttgagtatttggtg
JX899376_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
AY090458_C_C-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
AY090461_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KP718104_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KP718113_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM627320_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaryagttcttgagtatttggtg
AF223963_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KY476327_C_P-F      ctgtggtttcacatttcctgccttacgtttggaagagaaacagttcttgagtatttggtg
KJ586805_C_P-F      ctggggtttcacatttcctcccttacttttggaagagaaacagttcttgagtatttggtg
EU185743_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843195_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843167_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KC494400_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KY382415_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KY382416_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KY382417_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM622135_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
EU185744_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KP995096_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KP995116_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HE981187_C_P-F      ctgtggtttcacatttcctgccttacttttggaagacaaacagttcttgagtatttggtg
KF779236_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
JN688699_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843199_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843202_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843198_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843194_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843190_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatctggtg
KJ843193_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatctggtg
KJ843181_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843176_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843169_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843168_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843163_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ586808_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ586806_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KC494404_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585193_C_P-F      ctgtggtttcatatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585188_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM590473_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ709494_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585190_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ709465_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
MK058437_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ709458_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ709459_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585191_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585195_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585198_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
EU366133_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
EU366118_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ657529_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843201_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843203_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843206_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ823092_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ823093_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ709460_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ709464_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HQ378247_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843164_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843174_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843180_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KM998715_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KP995098_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KY458061_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KY458062_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
AB064316_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
AB116552_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
AF223964_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
AY179735_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ823094_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ823095_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ709457_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ709462_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ709463_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HE981182_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HE981186_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585187_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585189_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585192_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585196_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585197_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585199_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
JN688691_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
JN688703_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KF199901_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ586807_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843170_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843171_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843179_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843196_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843197_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843200_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843204_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843205_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KX264496_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ823091_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
JN792916_C_P-F      ctgtggtttcacctttcctgcattacttttggaagagaaacagttcttgagtatttggtg
JN792919_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
JN792920_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KY476331_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
JN792917_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
JN792918_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
EU670261_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
EU670262_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
JX079936_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
JN792914_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585194_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KY476332_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KY476323_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585186_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM590471_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM590472_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM590474_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KM233681_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HM585200_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
JN792922_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843177_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843178_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KY476322_C_P-F      ctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
MG098582_C_P-F      tgatggtttcacatttcctgccttagttttgaaagagaaacatttcttgagtatttggtg
MG098584_C_P-F      tngtggtttcacatttcctgccttacttttgggagagaaacagttcttgagtatttggtg
KJ638660_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaagtagttcttgagyatttggtg
KJ638662_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
AB365453_C_P-F      ttgtggtttcacatttcctgtcttatgtttggaagacaaacagttcttgagtatttggtg
MG098569_C_P-F      ttgtggtttcacatttcctgcctaacttttgaaagagaaacagttcttgagtatttggtg
JQ272888_C_P-F      ttgtggtttcacctttcctgccttatgtttggaagagatacagttcttgagtatttggtg
MG098575_C_P-F      ttgtggtttcacatttcctgccttacttttggaagacaaacagttattgagtatttggtg
MG098574_C_P-F      ttgtggtttcacatttcctgcctaatttttgaaagaaaaacagttcttgagtatttggag
MG098583_C_P-F      ttgtggtttcacgtttcctgccttatgtttggaagagatacagttcttgagtatttggtg
KJ676694_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
EU366132_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttgttgagtatttggtg
JN688709_C_P-F      ttgtggtttcacatttcctgcmttayttttggaagagatacagttcttgagtatttggtg
MG098579_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
MG098566_C_P-F      ttgtggtttcacgtttcctgccttacttttggaagagaagtacttcttgagtatttggtg
EF576808_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtttttggtg
MG098570_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaantagttcttgagtatttggtg
AB365450_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
MG098577_C_P-F      ttgtggtttcacatttcctgcctaacttttggaagagaaacagttsttcagtatttggtg
JN688720_C_P-F      ttgtggtttcacatttcctgccttacttttggaagacaaacagttcttgagtatttggtg
X75658_C_C-F        ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
MG098580_C_P-F      ttgtggtttcacatttcctgccttacttttgggagagaaacagttcttgagtatttggtg
MG098573_C_P-F      ttgtggtttcacatttcctgcctaatgtttggaagagaaacagttcttgagtatttggtg
KY476326_C_P-F      ttgtggtttcacatttcctgccttacttttggaagaccaacagttcttgagtatttggtg
MG098578_C_P-F      ttgtggtttcacatttcctgccttacttttggaagaccaacagttcttgagtatttggtg
AB166850_C_P-F      ttgtggtttcacatttcttgccttacttttggaagagaaacagttcttgagtatttggtg
AB214516_C_P-F      ttggggtttcacatttcttgccttacttttggaagagaaacagttcttgagtatttggtg
JN688701_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagatacagttcttgagtatttggtg
AB365446_C_P-F      ttgtggtttcacatttcctgcctttsttttggaagagaaacagttcttgagtatttggtg
MG098565_C_P-F      ttgtggtttcacatttcctgcctaacttttggaagagaaacagttcttgagtatttggtg
KJ843226_C_P-F      ttgtggtttcacatttcctgtcttacttttggaagagaaacagttcttgaatatttggtg
KJ843225_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
AB365449_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
MG098564_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ823087_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843210_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843209_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
JX079937_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HQ420165_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HQ420166_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ657519_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ823088_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ657528_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
JN811655_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
JN811656_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843211_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843212_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843219_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843221_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843222_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843224_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KY382411_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
AF223965_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
EF576812_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843185_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
AF223962_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ776247_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ823089_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ823090_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
EU366116_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
FJ657522_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
HE981181_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KC494398_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843175_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843189_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843207_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843208_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843213_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843220_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KJ843223_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
KX264499_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
DQ823086_C_P-F      ttgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtg
                        *******    ** *   *    ****  *         ** *  *   * ***  

JN792921_C_P-F      tcytttggagtgtggattcgcactcctcctgcttayagaccaccaaatgcccctatcyta
KP995115_C_P-F      tcttttggagtgtggattcgcactcctccaaattatagaccaccaaatgcccctatccta
KP995113_C_P-F      tcttttggagtgtggattcgcactcctcttccttatagaccaccaaatgcccctatccta
KP995114_C_P-F      tcttttggagtgtggattcgcactcctgctccttatagaccaccaaatgcccctatccta
KP995097_C_P-F      tcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
KC494399_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccagtaaatgcccctatccta
DQ899146_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
DQ899144_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
DQ899147_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
DQ899145_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
KC494396_C_P-F      tcctttggagtgtggattcgcactcctccggcttatagaccaccaaatgcccctatccta
KT896494_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatccta
AY254498_C_P-F      tcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
KP995107_C_P-F      tcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
KP995104_C_P-F      tcctttggagtgtggattcgcactcctcttgcttatagaccaccaaatgcccctatccta
KJ843191_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
AY090455_C_P-F      tcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
KC494401_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
KC494395_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
KX264497_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
KC494405_C_P-F      tcctttggagtgtggattcgcacacctcctgcttacagaccaccaaatgcccctatccta
KC494403_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
KC494402_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
X69798_C_P-F        tcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
KC494394_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
KC494397_C_P-F      tcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
AY311369_C_P-F      tcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
KP995110_C_P-F      tcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
DQ899142_C_P-F      tcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
DQ899143_C_P-F      tcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
KP995120_C_P-F      tcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
KP995101_C_P-F      tcttttggagtgtggattcgcactccacctccctatagaccaccaaatgcccctatccta
FJ589066_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB116550_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccagcaaatgcccctatccta
KP995093_C_P-F      tcctttggagggtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KP718106_C_P-F      tcctttggagtgtggattcscactccacctgcttatasaccaccaaatgcccctatccta
X75663_C_P-F        tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KP995111_C_P-F      tcctttggagtgtggattcgcactccacctccttatagaccaccaaatgcccctatccta
FJ589067_C_P-F      tcctttggagtgtggattcgcactccacctccttatagaccaccaaatgcccctatccta
KP995095_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KP995109_C_P-F      tcctttggagtgtggattcgcactccacctgtttatagaccaccaaatgcccctatccta
KP995105_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagacctccaaatgcccctatccta
KP995106_C_P-F      tcctttggagtgtggattcgcactccacaggcttatagaccaccaaatgcccctatccta
KP995119_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KP995118_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
DQ899148_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AF324143_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KP995117_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KP718103_C_P-F      tcctttggggtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
DQ899149_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AY311370_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
MH051986_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatctta
MH051987_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatctta
KP995124_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KP995126_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
JF439884_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
JF439885_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB116551_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KP718109_C_P-F      tcctttggagtgtggattcgcactccacctgcttattgtccaccaaatgcccctatccta
KP718112_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB036910_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KP718111_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KP995091_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB036920_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
AB036914_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
AB036915_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
AB036916_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
AB036917_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
AB036919_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
AB036911_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
AB036905_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
AB036906_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
AB036907_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
AB036909_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
AB036912_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
AB036913_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
KX264498_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
AB036908_C_P-F      tcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
KJ638659_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
DQ899150_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
AB116549_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KP995123_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KP995125_C_P-F      tcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
KJ638663_C_P-F      tcttttggggtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KY476329_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
AB116654_C_P-F      tcttttggagtgtggattcgcactcctattgcttatagaccaccaaatgcccctatctta
FJ657525_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccacaaaatgcccctatctta
KY476328_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KX757665_C_P-F      tcytttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KY476330_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccacaaaatgcccctatctta
AB086397_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ638664_C_P-F      tcttttggggtgtggattcgcactcctcctgcttatagaccagcaaatgcccctatctta
KP718110_C_P-F      tcttttggggtgtggattcgcactcctactgcttatagaccaccaaatgcccctatctta
KY476325_C_P-F      tcttttggagtgtggattcgcactcctattgcttatagaccaccaaatgcccctatctta
KJ638656_C_P-F      tcttttggggtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KP718107_C_P-F      tcttttggggtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ638657_C_P-F      tcttttggggtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KY476324_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
AY090459_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
FJ589065_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KX757672_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
JX899376_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
AY090458_C_C-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
AY090461_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KP718104_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KP718113_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM627320_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccacmaaatgcccctatctta
AF223963_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KY476327_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ586805_C_P-F      ttttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
EU185743_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843195_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843167_C_P-F      tctttgggagtgtggattcgcactcctcctgcttatagaccacaaaatgcccctatctta
KC494400_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KY382415_C_P-F      tcttttggagtgtggattcgcactcctccygcttatagaccaccaaatgcccctatctta
KY382416_C_P-F      tcttttggagtgtggattcgcactcctccygcttatagaccaccaaatgcccctatctta
KY382417_C_P-F      tcttttggagtgtggattcgcactcctccygcttatagaccaccaaatgcccctatctta
HM622135_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
EU185744_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KP995096_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KP995116_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HE981187_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KF779236_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
JN688699_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843199_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843202_C_P-F      tcttttggagtgtggattcgcactcctcttgcttatagaccaccaaatgcccctatctta
KJ843198_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843194_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccacaaaatgcccctatctta
KJ843190_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843193_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843181_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843176_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagacctccaaatgcccctatctta
KJ843169_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843168_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843163_C_P-F      tcttttggagtgtggattcgcactcctcttgcttatagaccaccaaatgcccctatctta
KJ586808_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ586806_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KC494404_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585193_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585188_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM590473_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
FJ709494_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585190_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
FJ709465_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
MK058437_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
FJ709458_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
FJ709459_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585191_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585195_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585198_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
EU366133_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
EU366118_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
FJ657529_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843201_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843203_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843206_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
DQ823092_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
DQ823093_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
FJ709460_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
FJ709464_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HQ378247_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843164_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843174_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843180_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KM998715_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KP995098_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KY458061_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KY458062_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
AB064316_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
AB116552_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
AF223964_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
AY179735_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
DQ823094_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
DQ823095_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
FJ709457_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
FJ709462_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
FJ709463_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HE981182_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HE981186_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585187_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585189_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585192_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585196_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585197_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585199_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
JN688691_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
JN688703_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KF199901_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ586807_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843170_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843171_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843179_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843196_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843197_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843200_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843204_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843205_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KX264496_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
DQ823091_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
JN792916_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
JN792919_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
JN792920_C_P-F      tcttttggagtgtggattcgcactcctcytscttatagaccaccaaatgcccctatctta
KY476331_C_P-F      tcttttggagtgtggattcgcactcctcctgtttatagaccaccaaatgcccctatctta
JN792917_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
JN792918_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
EU670261_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
EU670262_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
JX079936_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
JN792914_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585194_C_P-F      tcttttggagtgtggattcgcactcctcttgcttatagaccaccaaatgcccctatctta
KY476332_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KY476323_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585186_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM590471_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM590472_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM590474_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KM233681_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
HM585200_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
JN792922_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843177_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KJ843178_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
KY476322_C_P-F      tcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
MG098582_C_P-F      tcttttgaagtgtggattcgcactcctccagcttatagaccaccaaatgcccttatccta
MG098584_C_P-F      tcctttggagtgtggattcccactcctcctgcatataaaccacaaaatgcccctatccta
KJ638660_C_P-F      tccttcggagtgtggattcgcactcctcctgcgtataggccaccaaatgcccctatccta
KJ638662_C_P-F      tcttttggagtgtggattcgcactcctcctgcgtataggccaccaaatgcccctatccta
AB365453_C_P-F      tcctttggagtgtggattcgcactcctcctgcttatagaccacaaaatgcccctatccta
MG098569_C_P-F      tcctttggagtgtggcttcgcactcctccagcttatagaccaccaaatgcccctatccta
JQ272888_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
MG098575_C_P-F      tcctttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatccta
MG098574_C_P-F      tactttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
MG098583_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccacaaaatgcccctatccta
KJ676694_C_P-F      tcctttggagtgtggattcgcactcctcctacatatagaccaccaaatgcccctatccta
EU366132_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
JN688709_C_P-F      tcctttggagtgtggattcgcactcctcmagcttatagaccaccaaatgcccctatccta
MG098579_C_P-F      tcctttggagtgtggattcgcactcctgcaccttatagaccaccaaatgcccctatccta
MG098566_C_P-F      tcctttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatccta
EF576808_C_P-F      tcctttggagtgtggattcgcactcctccagcttataggccaccaaatgcccctatccta
MG098570_C_P-F      tcctttggggtgtggatacgcactcctctaccttatagaccaccaaatgcccctatccta
AB365450_C_P-F      tcctytggagtgtggatacgcactcctccascttatagaccaccaaatgcccctatccta
MG098577_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
JN688720_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccacaaaatgcccctatccta
X75658_C_C-F        tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
MG098580_C_P-F      tcctttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatccta
MG098573_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccagcaaatgcccctatccta
KY476326_C_P-F      tcctttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatccta
MG098578_C_P-F      tcttttggagtgtggattcgcactcctgcaccttatagaccaccaaatgcccctatccta
AB166850_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
AB214516_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
JN688701_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
AB365446_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
MG098565_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843226_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843225_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
AB365449_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
MG098564_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccttatccta
DQ823087_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843210_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagacgaccaaatgcccctatccta
KJ843209_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
JX079937_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
HQ420165_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
HQ420166_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
FJ657519_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
DQ823088_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
FJ657528_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
JN811655_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
JN811656_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843211_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843212_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843219_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843221_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843222_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843224_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KY382411_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
AF223965_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
EF576812_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843185_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
AF223962_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
DQ776247_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
DQ823089_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
DQ823090_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
EU366116_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
FJ657522_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
HE981181_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KC494398_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843175_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843189_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843207_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843208_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843213_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843220_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KJ843223_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
KX264499_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
DQ823086_C_P-F      tcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
                    *  *  *  * **** * * *** **       **    *    ******** **** **

JN792921_C_P-F      tccacacttccggaaactactattattagacga------cgaggcaggtcccctcgaaga
KP995115_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995113_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995114_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995097_C_P-F      tcaatgcttccggaagttgctgttgttagacga------cgaggcaggtcccctagaaga
KC494399_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggacccctagaaga
DQ899146_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
DQ899144_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
DQ899147_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
DQ899145_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KC494396_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggacccctagaaga
KT896494_C_P-F      tccacacttccggaaactactattgttagacga------cgaggcaggtcccctagaaga
AY254498_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995107_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995104_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KJ843191_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
AY090455_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KC494401_C_P-F      tccacacttccggaaactactgttgttagacga------ccaggcaggtcccctagaaaa
KC494395_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KX264497_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KC494405_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KC494403_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KC494402_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
X69798_C_P-F        tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KC494394_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KC494397_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
AY311369_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995110_C_P-F      tcaacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
DQ899142_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
DQ899143_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995120_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995101_C_P-F      tccacacttccggaaactactgttgttagagga------cgaggcagggcccctagaaga
FJ589066_C_P-F      tccacacttccggaaactactgttgttagacca------cgaggcaggacccctagaaga
AB116550_C_P-F      tccacacttccggaaactactgttattagacga------cgaggcaggtcccctagaaga
KP995093_C_P-F      tccacacctccggaaactactcttgttagacga------cgaggcaggtcccctagaaga
KP718106_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
X75663_C_P-F        tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995111_C_P-F      tcaacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
FJ589067_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctggaaga
KP995095_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995109_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995105_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
KP995106_C_P-F      tccacacttccggaaactactgttattagacga------cgaggcaggtcccctagaaga
KP995119_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggacccctagaaga
KP995118_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
DQ899148_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
AF324143_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995117_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
KP718103_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
DQ899149_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
AY311370_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
MH051986_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
MH051987_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995124_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995126_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
JF439884_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
JF439885_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
AB116551_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP718109_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP718112_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
AB036910_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP718111_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995091_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
AB036920_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
AB036914_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
AB036915_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
AB036916_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
AB036917_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
AB036919_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
AB036911_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
AB036905_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
AB036906_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
AB036907_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
AB036909_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
AB036912_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
AB036913_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
KX264498_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
AB036908_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctagaaga
KJ638659_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
DQ899150_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
AB116549_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995123_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KP995125_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
KJ638663_C_P-F      tccacacttccggaaactgctgttgttagacga------cgagtcaggtcccctcgaaga
KY476329_C_P-F      tccacacttccggaagctactgttgttagacga------cgaggcaggtcccctcgaaga
AB116654_C_P-F      tccacacttccggagactactgttgttagagga------cgacgcaggtcccctcgaaga
FJ657525_C_P-F      tccacacttccggaaactactgttgttagagga------cgaggcaggtcccctcgaaga
KY476328_C_P-F      tccacacttccggaaactactgttrttagacga------cgaggcaggtcccctcgaaga
KX757665_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctmgaaga
KY476330_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
AB086397_C_P-F      tccacacttccggaaactactgttgttagacgc------cgaggcaggtcccctcgaaga
KJ638664_C_P-F      tccacacttccggaaacaagggttattagacga------cgaggcaggtcccctcgaaga
KP718110_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KY476325_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ638656_C_P-F      tccacacttccggaaacgactgttgttagacga------cgaggcaggtcccctcgaaga
KP718107_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ638657_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KY476324_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctcgaaga
AY090459_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtctcctcgaaga
FJ589065_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KX757672_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
JX899376_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtctcctcgaaga
AY090458_C_C-F      tccacacttccggaaactactgttgttagacga------agaggcaggtctcctcgaaga
AY090461_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtctcctcgaaga
KP718104_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtctcctcgaaga
KP718113_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtctcctcgaaga
HM627320_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
AF223963_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KY476327_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctcgaaga
KJ586805_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
EU185743_C_P-F      tccacacttccggaaactactgttgttagacga------craggcaggtcccctcgaaga
KJ843195_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843167_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KC494400_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtctcctcgaaga
KY382415_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KY382416_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KY382417_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM622135_C_P-F      tccacacttccggaaattactgttgttagacga------cgaggcaggtcccctcgaaga
EU185744_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KP995096_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KP995116_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HE981187_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KF779236_C_P-F      tccacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctcgaaga
JN688699_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctngaaga
KJ843199_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843202_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843198_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843194_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843190_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843193_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843181_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843176_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843169_C_P-F      tccacacttccggaaactgctgttgttagacga------cgaggcaggtcccctcgaaga
KJ843168_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843163_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ586808_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ586806_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KC494404_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585193_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585188_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM590473_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
FJ709494_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585190_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
FJ709465_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
MK058437_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctagaaga
FJ709458_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
FJ709459_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585191_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585195_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585198_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
EU366133_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
EU366118_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
FJ657529_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843201_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843203_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843206_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
DQ823092_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
DQ823093_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
FJ709460_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
FJ709464_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HQ378247_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843164_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843174_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843180_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KM998715_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KP995098_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KY458061_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KY458062_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
AB064316_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
AB116552_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
AF223964_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
AY179735_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
DQ823094_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
DQ823095_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
FJ709457_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
FJ709462_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
FJ709463_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HE981182_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HE981186_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585187_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585189_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585192_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585196_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585197_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585199_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
JN688691_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
JN688703_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KF199901_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ586807_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843170_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843171_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843179_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843196_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843197_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843200_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843204_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KJ843205_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KX264496_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
DQ823091_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
JN792916_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
JN792919_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
JN792920_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KY476331_C_P-F      tccacacttccggaaactactgttgttagacga------agaggcaggtcccctcgaaga
JN792917_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
JN792918_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
EU670261_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
EU670262_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
JX079936_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
JN792914_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585194_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KY476332_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
KY476323_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM585186_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga
HM590471_C_P-F      tccacacttccggaaactactgttgttagacga------cgaggcaggtcccctcgaaga