HBVdb

Dataset for nucleotide sequence SP of genotype E

[Download (right click)] [Edit] [Sequences] [Repertoires]

364 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


GU563552_SP_P-E      -tgcccctatcttatcaacacctccagagaatactgttgttagacgaaga
GQ161775_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KY498770_SP_P-E      atgcccctatcttatcawcacttccggagamtactgttrttagacgaaga
AM494695_SP_P-E      atgcccctatcttatcaacacttccggagactactgttattagacacaga
AB219534_SP_P-E      atgcccctatcttatcaacacttccggagactactgttattagatgcgga
MF772359_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacaacga
MF772357_SP_P-E      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MH580645_SP_P-E      atgcccctatcttatcaacacttccggagactgctgttgttagatcaaga
LT623849_SP_P-E      atgcccctatcttatcaacacttccggagamtactgttgttagacgaaga
GQ161825_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagaccaa--
FN594758_SP_P-E      atgcccctatcttgtcaacgcttccggagaatactgttgttagacgaaga
FN594760_SP_P-E      atgcccctatcttgtcaacgcttccggagaatactgttgttagacgaaga
FN594759_SP_P-E      atgcccctatcttgtcaacgcttccggagaatactgttgttagacgaaga
MF772356_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
LT623842_SP_P-E      atgcccctatcttatcaacwcttccggagamtactgttgttagacgaaga
HM363611_SP_P-E      atgcccctatcttatcaacacttccggagactactgttattagacgacga
HM363565_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
EU239220_SP_P-E      atgcccctatcttatcaacacttccggagattactgttattagacgaaga
AB274984_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
AB219533_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacga
AB205188_SP_P-E      atgcccctatcgtatcaacacttcccgagaatactgttgttagacgaaga
MH580648_SP_P-E      atgcccctatcttatcaacacttcctgagactactgttgttagacgaaga
AB915180_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
EU239224_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacggaga
FN594749_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB106564_SP_C-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363588_SP_P-E      atgcccctatcttatcaacacttcctgagaatactgttgttagacgaaga
HM363589_SP_P-E      atgcccctatcttatcaacacttcctgagaatactgttgttagacgaaga
HM363601_SP_P-E      atgcccctatcttatcaacacttcctgagattactgttgttagacgaaga
MN507840_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
MF772361_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
MF772358_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
LT623851_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgamga
FN594765_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494703_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494691_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB915178_SP_P-E      atgcccctatcttatcaacacttcctgagactactgttgttagacgaaga
KF849718_SP_P-E      atgcccctatcttatcaacacttccggagtgtactgttattagacgaaga
KF849726_SP_P-E      atgcccctatcttatcatcacttccggagtgtactgttgttagacgaaga
KF849720_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF170741_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
FN594761_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363608_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363597_SP_P-E      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
MF772355_SP_P-E      atgcccctatcttatcaacacttcctgaaactactgttgttagacgaaga
KF849723_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363592_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580626_SP_P-E      atgcccctatcttatcaacacttccggagacttctgttgttagacgaaga
KU736913_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KF849728_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF170742_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363607_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
HM363604_SP_P-E      atgcccctatcttatccacacttccggagaatgctgttgttagacgaaga
HM363600_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363590_SP_P-E      atgcccctatcttatcaacacttcctgagaatactgttgttagacgaaga
HM363574_SP_P-E      atgcccctatcttatccacacttccggagaatactgttgttagacgaaga
HM363566_SP_P-E      atgcccctatcttatccacacttccggagactactgttgttagacgaaga
GQ161786_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161778_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161810_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161760_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
FN594766_SP_P-E      atgcccctatcttatcaacacttccggagacttctgttgttagacgaaga
FN594756_SP_P-E      atgcccctatcttatcaacacttccggagattactgttgttagacgaaga
FN545821_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
FJ349239_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
EU239223_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
EU239222_SP_P-E      atgcccctatcttatcaacacttcctgagactactgttgttagacgaaga
AY738144_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AY738145_SP_C-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AY738146_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AY738147_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494714_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
AB915177_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB274982_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
AB274981_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB274973_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB274970_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB205190_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580638_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
FN594753_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363576_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363575_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB194948_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
AM494694_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494700_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363602_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
AM494711_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
AM494712_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF849714_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF849715_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363603_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
AB274985_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
HM363578_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
GQ161757_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
MH580633_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
LT623847_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
LT623843_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KF849724_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagg
GQ161783_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
GQ161824_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
GQ161762_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
FN594762_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FN594750_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
AB274978_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB274977_SP_P-E      atgcccctatcttatcaacacttccggagactactgttcttagacgaaga
FJ349240_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
FN545822_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
FN545842_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
GQ161756_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
GQ161795_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
HM363610_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KU736909_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KU736911_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
AB274980_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AY739675_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
FN545823_SP_P-E      atgcccctatcttatcaacacttccggagamtgctgttgttagacgaaga
HM363569_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB274975_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161807_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161823_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363570_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161759_SP_P-E      atgcccctatcttatcaacacttcctgagaatactgttgttagacgaaga
KU736894_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161833_SP_P-E      atgcccctatcttatcaacaactccggagaatactgttgttagacgaaga
MN507842_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MN507841_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580640_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580641_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MF772362_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
LT623848_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
LT623846_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
LT623845_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgarga
LT623844_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736904_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736901_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacga
KU736893_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KT749841_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KT192626_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KM606739_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KM606738_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF922439_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF849716_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF849713_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
JQ000009_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
JQ000008_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HQ700551_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363605_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363599_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363598_SP_P-E      atgcccctatcttatcaacacttccggagattactgttgttagacgaaga
HM363596_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363582_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736891_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736892_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161834_SP_P-E      atgcccctatcttatcaactcttccggagaatactgttgttagacgaaga
GQ161826_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161814_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161803_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161799_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161818_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161821_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161798_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161797_SP_P-E      atgcccctatcttatcaacacttccggaaattactgttgttagacgaaga
GQ161796_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacga
GQ161791_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161785_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161836_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161782_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161792_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363594_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161780_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161779_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161776_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161784_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161789_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161828_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161771_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacga
KU736897_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacga
KU736898_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacga
MH580617_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacga
MH580628_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacga
MH580644_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacga
GQ161769_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161768_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161765_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161764_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF849721_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161763_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161777_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
FN594751_SP_P-E      atgcccctatcttatcaacacttccggagcatactgttgttagacgaaga
FN594763_SP_P-E      atgcccctatcttatcaacacttccggagcatactgttgttagacgaaga
FN594748_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
FJ349226_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
EU239221_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
EU239219_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
DQ060830_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HQ700550_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HQ700552_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
DQ060826_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494699_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494697_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494706_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494709_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494710_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494692_SP_P-E      atgcccctatcttatcaacacttccggagattactgttgttagacgaaga
AM494689_SP_P-E      atgcccctatcttatctacacttccggagaatactgttgttagacgaaga
AB915175_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB274979_SP_P-E      atgcccctatcttatcaacacttccggagattactgttgttagacgaaga
AB274976_SP_P-E      atgcccctatcttatcaacacttccggagattactgttgttagacgaaga
AB274972_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
EU239218_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MN507843_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MN507844_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB219529_SP_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
AB205189_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB201289_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB194947_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363606_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB091256_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB091255_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB201287_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB201288_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB201290_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB205129_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB205191_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB205192_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB274969_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB274971_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB274974_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AB915176_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494690_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494693_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494696_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494698_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494701_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494702_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494704_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494707_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494708_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494713_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494715_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494717_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AY739674_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AY935700_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
DQ060822_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
DQ060823_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
DQ060824_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
DQ060825_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
DQ060827_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
DQ060828_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
DQ060829_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
EU239217_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
EU239226_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
FJ349237_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
FJ349238_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
FN545827_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
FN545841_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
FN594752_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161755_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161758_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161761_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161766_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161770_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161772_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161773_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161774_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161781_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161787_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161790_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161793_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161794_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161800_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161801_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161802_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161804_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161805_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161808_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161811_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161812_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161815_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161816_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161817_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161819_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161820_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161827_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161829_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161830_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161832_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161835_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363567_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363568_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363571_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363572_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363573_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363577_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363579_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363580_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363581_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363583_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363584_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363585_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363586_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363587_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363591_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363593_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363595_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
HM363609_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF849717_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF849719_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF849722_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF849725_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF849727_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KF922438_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736895_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736896_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736899_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736900_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736902_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736903_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736905_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736906_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736907_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736908_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736910_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KU736912_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
KX186584_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
LT623850_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MF772354_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MF772360_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580614_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580615_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580616_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580618_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580619_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580620_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580621_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580622_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580623_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580624_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580625_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580629_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580630_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580631_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580632_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580634_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580635_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580636_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580637_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580646_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580647_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580649_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580650_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580651_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH580652_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MH918655_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MK321264_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MK720631_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MK720632_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MN507845_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MN507846_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MN507847_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
MN507848_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
X75657_SP_P-E        atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
AM494705_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
GQ161831_SP_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaaga
                      ********** * **  *   *** **   * ***** *****      

GU563552_SP_P-E      ggcagggcccctaaaagaagaactccctcgcctcgcagacgaagatctca
GQ161775_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KY498770_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494695_SP_P-E      ggcaggtccactagaagaagaactccctcgcctcgcagacgaagatctca
AB219534_SP_P-E      ggcaggacctctagaagaagaactccctcgcctcgcagacgaagatctca
MF772359_SP_P-E      ggcaggacccctagaagaagaactccctcgcctcgcagacgaagatctca
MF772357_SP_P-E      gtcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580645_SP_P-E      ggcaggtcctctagaagaagaactccctcgcctcgcagacgaagatctca
LT623849_SP_P-E      ggcaggtcccctagaagaagaactccctcscctcscagacgaagatctca
GQ161825_SP_P-E      -gcaggtcctatagaagaagaactccctcacctcgcagacgaagatctca
FN594758_SP_P-E      ggcaggtcccctagaagaagaactccctcacctcgcagacgcagatctca
FN594760_SP_P-E      ggcaggtcccctagaagaagaactccctcacctcgcagacgcagatctca
FN594759_SP_P-E      ggcaggtcccctagaagaagaactccctcacctcgcagacgcagatctca
MF772356_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
LT623842_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363611_SP_P-E      ggcaggtcccctggaagaagaactccctcgcctcgcagacgaagacctca
HM363565_SP_P-E      ggcaggtcccctagaagacgaactccctcgcctcgcagacgaagatctca
EU239220_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274984_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB219533_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB205188_SP_P-E      agcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580648_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB915180_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
EU239224_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagaactca
FN594749_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB106564_SP_C-E      ggcaggtcccctagaagacgaactccctcgcctcgcagacgaagatctca
HM363588_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363589_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363601_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MN507840_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgtagatctca
MF772361_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MF772358_SP_P-E      ggcaggccccctagaggaagaactccctcgcctcgcagacgaagatctca
LT623851_SP_P-E      ggcaggwcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN594765_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494703_SP_P-E      ggcaggtcccctaaaagaagaactccctcgcctcgcagacgaagatctca
AM494691_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB915178_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849718_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849726_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849720_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF170741_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN594761_SP_P-E      ggcaggtcccctagaagacgaactccctcgcctcgccgacgaagatctca
HM363608_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363597_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MF772355_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849723_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363592_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580626_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736913_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849728_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF170742_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363607_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgccgatctca
HM363604_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363600_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363590_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363574_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363566_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161786_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ161778_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161810_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161760_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN594766_SP_P-E      ggcaggtcccctagaagaagaactccctcacctcgcagacgaagatctca
FN594756_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN545821_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FJ349239_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU239223_SP_P-E      ggcaggtcccctagaagacgaactccctcgcctcgcagacgaagatctca
EU239222_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY738144_SP_P-E      ggcaggtcccctagaagaagaactccctctcctcgcagacgaagatctca
AY738145_SP_C-E      ggcaggtcccctagaagaagaactccctctcctcgcagacgaagatctca
AY738146_SP_P-E      ggcaggtcccctagaagaagaactccctctcctcgcagacgaagatctca
AY738147_SP_P-E      ggcaggtcccctagaagaagaactccctctcctcgcagacgaagatctca
AM494714_SP_P-E      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AB915177_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274982_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274981_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274973_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274970_SP_P-E      ggcaggtcccctagaagaagaactccctcacctcgcagacgaagatctca
AB205190_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580638_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN594753_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363576_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363575_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB194948_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494694_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494700_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363602_SP_P-E      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494711_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494712_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849714_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849715_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363603_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274985_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgcagatctca
HM363578_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161757_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580633_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
LT623847_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
LT623843_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849724_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161783_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161824_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161762_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN594762_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN594750_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274978_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274977_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FJ349240_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN545822_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN545842_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161756_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161795_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363610_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736909_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736911_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274980_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY739675_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN545823_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363569_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctaa
AB274975_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctaa
GQ161807_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161823_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363570_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctaa
GQ161759_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736894_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161833_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MN507842_SP_P-E      ggcaggtcccctagaagacgaactccctcgcctcgcagacgaagatctca
MN507841_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580640_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580641_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MF772362_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
LT623848_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
LT623846_SP_P-E      ggcaggtcacctagaagaagaactccctcgcctcgcagacgaagatctca
LT623845_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
LT623844_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcr
KU736904_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagaactca
KU736901_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736893_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacraagatctca
KT749841_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KT192626_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KM606739_SP_P-E      ggcaggtcccatagaagaagaactccctcgcctcgcagacgaagatctca
KM606738_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF922439_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849716_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849713_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JQ000009_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JQ000008_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HQ700551_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363605_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363599_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363598_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363596_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363582_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736891_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736892_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161834_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161826_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161814_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgccaacgaagatctca
GQ161803_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161799_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161818_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161821_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161798_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161797_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161796_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161791_SP_P-E      ggcaggtcccctagaagaagaactccctcgccttgcagacgaagatctca
GQ161785_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161836_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161782_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
GQ161792_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
HM363594_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctca
GQ161780_SP_P-E      ggcaggtcccctagaagaagatctccctcgcctcgcagacgaagatctca
GQ161779_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161776_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161784_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161789_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161828_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161771_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736897_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736898_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580617_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580628_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580644_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161769_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161768_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161765_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161764_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849721_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161763_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161777_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN594751_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN594763_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN594748_SP_P-E      ggcaggtcccctagaagacgaactccctcgcctcgcagacgaagatctca
FJ349226_SP_P-E      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
EU239221_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU239219_SP_P-E      ggcaggtcccctagaagacgaactccctcgcctcgcagacgaagatctca
DQ060830_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgacgatctca
HQ700550_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgacgatctca
HQ700552_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgacgatctca
DQ060826_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494699_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494697_SP_P-E      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AM494706_SP_P-E      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AM494709_SP_P-E      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AM494710_SP_P-E      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AM494692_SP_P-E      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctca
AM494689_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB915175_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274979_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274976_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274972_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU239218_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MN507843_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MN507844_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB219529_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB205189_SP_P-E      ggcaggtcccctagaagaaggactccctcgcctcgcagacgaagatctca
AB201289_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB194947_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363606_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB091256_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB091255_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB201287_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB201288_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB201290_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB205129_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB205191_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB205192_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274969_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274971_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB274974_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB915176_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494690_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494693_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494696_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494698_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494701_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494702_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494704_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494707_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494708_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494713_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494715_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494717_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY739674_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY935700_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ060822_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ060823_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ060824_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ060825_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ060827_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ060828_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
DQ060829_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU239217_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU239226_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FJ349237_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FJ349238_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN545827_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN545841_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FN594752_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161755_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161758_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161761_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161766_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161770_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161772_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161773_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161774_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161781_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161787_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161790_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161793_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161794_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161800_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161801_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161802_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161804_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161805_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161808_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161811_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161812_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161815_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161816_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161817_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161819_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161820_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161827_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161829_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161830_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161832_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161835_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363567_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363568_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363571_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363572_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363573_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363577_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363579_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363580_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363581_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363583_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363584_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363585_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363586_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363587_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363591_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363593_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363595_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HM363609_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849717_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849719_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849722_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849725_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF849727_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF922438_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736895_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736896_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736899_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736900_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736902_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736903_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736905_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736906_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736907_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736908_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736910_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736912_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KX186584_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
LT623850_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MF772354_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MF772360_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580614_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580615_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580616_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580618_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580619_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580620_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580621_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580622_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580623_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580624_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580625_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580629_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580630_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580631_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580632_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580634_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580635_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580636_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580637_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580646_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580647_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580649_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580650_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580651_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH580652_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH918655_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK321264_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK720631_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK720632_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MN507845_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MN507846_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MN507847_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MN507848_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
X75657_SP_P-E        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AM494705_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ161831_SP_P-E      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
                       **** *   *  * ** *  ******* ***  *  **   *  **  

GU563552_SP_P-E      atcgccgcgtcgcagaagatctcaatttccagcttcccaatgatcatcaa
GQ161775_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcatcaa
KY498770_SP_P-E      atcgccgcgtcgcagaagatctmaatctccagcttcccaatgatcatcaa
AM494695_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaacaa
AB219534_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcatcaa
MF772359_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccactgatcatcaa
MF772357_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcatcaa
MH580645_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagctccccgatgatcatcaa
LT623849_SP_P-E      atcgccgcgtcscagaagatctcaatctccascttcccaatgatcatcaa
GQ161825_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594758_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594760_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594759_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MF772356_SP_P-E      atcgccgcgtcgcagaagatctcaatctccatcttcccaatgatcctcaa
LT623842_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttccaaatgatcatcaa
HM363611_SP_P-E      atcgccgcgtcgcagaagatctcaatctccatcttcccaatgatcatcaa
HM363565_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccattgatcatcaa
EU239220_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcga
AB274984_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcatcaa
AB219533_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB205188_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580648_SP_P-E      atcgccgcgtcgcagacgatctcaatctccatcttcccaatgatcatcaa
AB915180_SP_P-E      atcgccgcgtcgcaaaagatctcaatctcgaggtgcccaatgatcatcaa
EU239224_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594749_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB106564_SP_C-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363588_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363589_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363601_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MN507840_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcatcaa
MF772361_SP_P-E      atcgccgcgtcgcaaaagatctcaatctccagcttccaaatgatcctcaa
MF772358_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
LT623851_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594765_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcatcaa
AM494703_SP_P-E      atcgccgcgtcgcagaagatctcaatctccatcttcccaatgatcatcaa
AM494691_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttccaaatgatcatcaa
AB915178_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849718_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849726_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849720_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF170741_SP_P-E      atcgccgcgtcgcagaagatctcaatcccaaccccccccctgatcatcaa
FN594761_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363608_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363597_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MF772355_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849723_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363592_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580626_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736913_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccamtgatcatcaa
KF849728_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccactgatcatcaa
KF170742_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcacaatgatcatcaa
HM363607_SP_P-E      atcgccgcgtcgcagaagatctcaatctccatcttcccactgatcatcaa
HM363604_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363600_SP_P-E      atcgccacgtcgcagaagatctcaatctccagcttcccgatgatcatcaa
HM363590_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363574_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363566_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161786_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161778_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttccaaatgatcatcaa
GQ161810_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttccaaatgatcatcaa
GQ161760_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594766_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594756_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN545821_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FJ349239_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
EU239223_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
EU239222_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AY738144_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaccaa
AY738145_SP_C-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaccaa
AY738146_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaccaa
AY738147_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaccaa
AM494714_SP_P-E      atcgccgcgtcgcagaagatctcaatctccatcttcccaatgatcatcaa
AB915177_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB274982_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcacaatgatcatcaa
AB274981_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcacaatgatcatcaa
AB274973_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB274970_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB205190_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcagcaa
MH580638_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594753_SP_P-E      atcgccgcgtcgcagaagatctcaatctccaggttcccaatgatcatcaa
HM363576_SP_P-E      atcgccgcgtcgcagaagatctcaatctccaggttcccaatgatcatcaa
HM363575_SP_P-E      atcgccgcgtcgcagaagatctcaatctccaggttcccaatgatcatcaa
AB194948_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494694_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494700_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363602_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494711_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494712_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849714_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849715_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363603_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccactgatcatcaa
AB274985_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccactgatcatcaa
HM363578_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccactgatcatcaa
GQ161757_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580633_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
LT623847_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
LT623843_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849724_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161783_SP_P-E      atcgccgcgtcgcagaaaatctcaatctccagcttcccaatgatcatcaa
GQ161824_SP_P-E      atcgccgcgtcgcagaaaatctcaatctccagcttcccaatgatcatcaa
GQ161762_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594762_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594750_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB274978_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB274977_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FJ349240_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN545822_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN545842_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161756_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161795_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363610_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736909_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736911_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB274980_SP_P-E      atcgccgcgtcgccgaagatctcaatctccagcttcccaatgatcatcaa
AY739675_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN545823_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagctgcccaatgatcatcaa
HM363569_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB274975_SP_P-E      atcgccgagtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161807_SP_P-E      atcgccgcgtcgcagaagatctaaatctccagcttcccaatgatcatcaa
GQ161823_SP_P-E      atcgccgcgtcgcagaagatctaaatctccagcttcccaatgatcatcaa
HM363570_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161759_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736894_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161833_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MN507842_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MN507841_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580640_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagctgcccaatgatcatcaa
MH580641_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagctgcccaatgatcatcaa
MF772362_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcctcga
LT623848_SP_P-E      atcgccgcgtcgcagacgatctcaatctccagcttcccaatgatcatcaa
LT623846_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
LT623845_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
LT623844_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736904_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736901_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736893_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KT749841_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KT192626_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttccccatgatcatcaa
KM606739_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KM606738_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF922439_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttccccatgatcatcaa
KF849716_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849713_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
JQ000009_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
JQ000008_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HQ700551_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363605_SP_P-E      atcgccgcgtcgcagaagatctcaatctccaggttcccaatgatcctcaa
HM363599_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363598_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363596_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363582_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736891_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736892_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161834_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161826_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161814_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161803_SP_P-E      atcgccacgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161799_SP_P-E      atcgccgcgtcgcagaagatctcaatttccagcttcccaatgatcatcaa
GQ161818_SP_P-E      atcgccgcgtcgcagaagatctcaatttccagcttcccaatgatcatcaa
GQ161821_SP_P-E      atcgccgcgtcgcagaagatctcaatttccagcttcccaatgatcatcaa
GQ161798_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161797_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161796_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttccaaatgatcatcaa
GQ161791_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161785_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcctcaa
GQ161836_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcctcaa
GQ161782_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161792_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363594_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161780_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161779_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161776_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161784_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161789_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161828_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161771_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736897_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736898_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580617_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580628_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580644_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161769_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161768_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttccaaatgatcatcaa
GQ161765_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161764_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849721_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161763_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161777_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594751_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594763_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594748_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FJ349226_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
EU239221_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcga
EU239219_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
DQ060830_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HQ700550_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HQ700552_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
DQ060826_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494699_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494697_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494706_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494709_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494710_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494692_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494689_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB915175_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB274979_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB274976_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB274972_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
EU239218_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MN507843_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MN507844_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB219529_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB205189_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB201289_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB194947_SP_P-E      atctccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363606_SP_P-E      atctccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB091256_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB091255_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB201287_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB201288_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB201290_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB205129_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB205191_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB205192_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB274969_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB274971_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB274974_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AB915176_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494690_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494693_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494696_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494698_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494701_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494702_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494704_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494707_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494708_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494713_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494715_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494717_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AY739674_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AY935700_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
DQ060822_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
DQ060823_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
DQ060824_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
DQ060825_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
DQ060827_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
DQ060828_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
DQ060829_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
EU239217_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
EU239226_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FJ349237_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FJ349238_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN545827_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN545841_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
FN594752_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161755_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161758_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161761_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161766_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161770_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161772_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161773_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161774_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161781_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161787_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161790_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161793_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161794_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161800_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161801_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161802_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161804_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161805_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161808_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161811_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161812_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161815_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161816_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161817_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161819_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161820_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161827_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161829_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161830_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161832_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161835_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363567_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363568_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363571_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363572_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363573_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363577_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363579_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363580_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363581_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363583_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363584_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363585_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363586_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363587_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363591_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363593_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363595_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
HM363609_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849717_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849719_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849722_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849725_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF849727_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KF922438_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736895_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736896_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736899_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736900_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736902_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736903_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736905_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736906_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736907_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736908_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736910_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KU736912_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
KX186584_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
LT623850_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MF772354_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MF772360_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580614_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580615_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580616_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580618_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580619_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580620_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580621_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580622_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580623_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580624_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580625_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580629_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580630_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580631_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580632_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580634_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580635_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580636_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580637_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580646_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580647_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580649_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580650_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580651_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH580652_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MH918655_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MK321264_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MK720631_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MK720632_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MN507845_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MN507846_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MN507847_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
MN507848_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
X75657_SP_P-E        atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
AM494705_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
GQ161831_SP_P-E      atcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaa
                     *** **  *** *  *  **** ***  * *    *    *****  * *

GU563552_SP_P-E      ccaccagtacaggaccctgcagaacctgcacgactcttgctcaagcaacc
GQ161775_SP_P-E      ccaccagtacgggaccctgcmgaacctgcacgactcytgctcaaggmamc
KY498770_SP_P-E      ccaccagyacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494695_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB219534_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MF772359_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcacggaacc
MF772357_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacc
MH580645_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
LT623849_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161825_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN594758_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN594760_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN594759_SP_P-E      ccaccagtgcgggaccctgccgaacctgcacgactcttgctcaaggaacc
MF772356_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
LT623842_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363611_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363565_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
EU239220_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB274984_SP_P-E      acaccagtacaggaccctgccgaacctgcacgactcttgctcaaggaacc
AB219533_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacc
AB205188_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacc
MH580648_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB915180_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
EU239224_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN594749_SP_P-E      ccaccagtactggcctcaccagagcctgcacgactcttgctcaaggaacc
AB106564_SP_C-E      ccaccagtacgggaccctgccgaacctgcacgactctggctcaaggaacc
HM363588_SP_P-E      ccaccagtacgggaccttgccgcacctgcacgactcttgctcaaggaacc
HM363589_SP_P-E      ccaccagtacgggaccttgccgcacctgcacgactcttgctcaaggaacc
HM363601_SP_P-E      ccaccagtacgggaccttgccgcacctgcacgactcttgctcaaggaacc
MN507840_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MF772361_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MF772358_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
LT623851_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN594765_SP_P-E      ccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494703_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494691_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacc
AB915178_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849718_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849726_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849720_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcacggaacc
KF170741_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN594761_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363608_SP_P-E      caaacagaacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363597_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcacggaacc
MF772355_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849723_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363592_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgacacttgctcaaggaacc
MH580626_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736913_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849728_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF170742_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363607_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363604_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363600_SP_P-E      ccaccagtacgggaccctgccgaacatgcacgactcttgctcaaggaacc
HM363590_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363574_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363566_SP_P-E      ccaccagtacgggaccatgccgaacctgcacgactcttgctcaaggaacc
GQ161786_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161778_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161810_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161760_SP_P-E      ccaccagtacgggaccatgccgaacctgcacgactcttgctcaaggaacc
FN594766_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN594756_SP_P-E      ccaccagtacaggaccctgccgaacctgcacgactcttgctcaaggaacc
FN545821_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacc
FJ349239_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
EU239223_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
EU239222_SP_P-E      ccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacc
AY738144_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AY738145_SP_C-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AY738146_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AY738147_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494714_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB915177_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB274982_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB274981_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgacccttgctcaaggaacc
AB274973_SP_P-E      ccaccagtacgggaccatgcagaacctgcacgactcttgctcaaggaacc
AB274970_SP_P-E      ccacaagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB205190_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580638_SP_P-E      ccaccagtacgggaccctgccgaacctgcacaactcctgctcaaggaacc
FN594753_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363576_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363575_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacc
AB194948_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacc
AM494694_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacc
AM494700_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacc
HM363602_SP_P-E      ccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494711_SP_P-E      ccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494712_SP_P-E      ccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849714_SP_P-E      ccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849715_SP_P-E      ccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363603_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB274985_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363578_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161757_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactattgctcaaggaacc
MH580633_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactattgctcaaggaacc
LT623847_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
LT623843_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactyttgctcaaggaacc
KF849724_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161783_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161824_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161762_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN594762_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgttcaaggaacc
FN594750_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgttcaaggaacc
AB274978_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB274977_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FJ349240_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN545822_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN545842_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161756_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161795_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363610_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736909_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736911_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB274980_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AY739675_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN545823_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363569_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB274975_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161807_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161823_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363570_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161759_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736894_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161833_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MN507842_SP_P-E      ccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacc
MN507841_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580640_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580641_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MF772362_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
LT623848_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
LT623846_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
LT623845_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
LT623844_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736904_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736901_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgacacttgctcaaggaacc
KU736893_SP_P-E      ccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacc
KT749841_SP_P-E      ccaccagtatgggaccctgccgaacctgcacgactcttgctcaaggaacc
KT192626_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KM606739_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KM606738_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcgaggaacc
KF922439_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849716_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849713_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
JQ000009_SP_P-E      ccaccagtacgggaccctgccgaacttgcacgactcttgctcaaggaacc
JQ000008_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HQ700551_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363605_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363599_SP_P-E      ccaccagtacgggatcctgccgaacctgcacgactcttgctcaaggaacc
HM363598_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaagaacc
HM363596_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaagaaacc
HM363582_SP_P-E      ccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacc
KU736891_SP_P-E      ccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacc
KU736892_SP_P-E      ccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacc
GQ161834_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161826_SP_P-E      ccaccagaacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161814_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161803_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161799_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161818_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161821_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161798_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161797_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161796_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161791_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161785_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161836_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161782_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161792_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363594_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161780_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161779_SP_P-E      ccaccagtacgggaccctgccggacctgcacgactcttgctcaaggaacc
GQ161776_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161784_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161789_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161828_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161771_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736897_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736898_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580617_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580628_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580644_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161769_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161768_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161765_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161764_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849721_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161763_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161777_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN594751_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN594763_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN594748_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FJ349226_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
EU239221_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
EU239219_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
DQ060830_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HQ700550_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HQ700552_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
DQ060826_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494699_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494697_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494706_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494709_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494710_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494692_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494689_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB915175_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcytgctcaaggaacc
AB274979_SP_P-E      ccaccagtacgggaccctgccgaacatgcacgactcttgctcaaggaacc
AB274976_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB274972_SP_P-E      ccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacc
EU239218_SP_P-E      ccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacc
MN507843_SP_P-E      ccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacc
MN507844_SP_P-E      ccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacc
AB219529_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB205189_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB201289_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB194947_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363606_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB091256_SP_P-E      ccaccattacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB091255_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB201287_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB201288_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB201290_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB205129_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB205191_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB205192_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB274969_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB274971_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB274974_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AB915176_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494690_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494693_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494696_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494698_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494701_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494702_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494704_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494707_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494708_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494713_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494715_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494717_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AY739674_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AY935700_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
DQ060822_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
DQ060823_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
DQ060824_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
DQ060825_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
DQ060827_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
DQ060828_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
DQ060829_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
EU239217_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
EU239226_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FJ349237_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FJ349238_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN545827_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN545841_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
FN594752_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161755_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161758_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161761_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161766_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161770_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161772_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161773_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161774_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161781_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161787_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161790_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161793_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161794_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161800_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161801_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161802_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161804_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161805_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161808_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161811_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161812_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161815_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161816_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161817_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161819_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161820_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161827_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161829_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161830_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161832_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161835_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363567_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363568_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363571_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363572_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363573_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363577_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363579_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363580_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363581_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363583_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363584_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363585_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363586_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363587_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363591_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363593_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363595_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
HM363609_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849717_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849719_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849722_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849725_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF849727_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KF922438_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736895_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736896_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736899_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736900_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736902_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736903_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736905_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736906_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736907_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736908_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736910_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KU736912_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
KX186584_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
LT623850_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MF772354_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MF772360_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580614_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580615_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580616_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580618_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580619_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580620_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580621_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580622_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580623_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580624_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580625_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580629_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580630_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580631_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580632_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580634_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580635_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580636_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580637_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580646_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580647_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580649_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580650_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580651_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH580652_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MH918655_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MK321264_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MK720631_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MK720632_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MN507845_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MN507846_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MN507847_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
MN507848_SP_P-E      ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
X75657_SP_P-E        ccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
AM494705_SP_P-E      caaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
GQ161831_SP_P-E      ctaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacc
                       *  *     **        *  * ***** **    * **     * *

GU563552_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcagacagaaattgcac
GQ161775_SP_P-E      tctatgtttccctcatgttgytgttcaaaaccttcggacggaaattgcac
KY498770_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494695_SP_P-E      tctatgtttccctcatgttgctgttcaaaacctacggacggaaattgcac
AB219534_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MF772359_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MF772357_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580645_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
LT623849_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161825_SP_P-E      tctatgtttccctcatgttgctgttcaaaacctacggacggaaattgcac
FN594758_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN594760_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN594759_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MF772356_SP_P-E      tctatgttnccctcatgttgctgttcaaaaccttcggaaggaaattgcac
LT623842_SP_P-E      tctatgttwccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363611_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363565_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggccggaaattgcac
EU239220_SP_P-E      tctatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcac
AB274984_SP_P-E      tctatgtttccctcatgttgctgttcaaaacctttggacggaaattgcac
AB219533_SP_P-E      tctatgtttccctcatgttgctgtttaaaaccttcggacggaaattgcac
AB205188_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580648_SP_P-E      tctatgtttccctcatgttgttgttcaaaaccttcggacggaaattgcac
AB915180_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
EU239224_SP_P-E      tctatgtttccctcatgttgctgtttaaagccttcggacggaaattgcac
FN594749_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB106564_SP_C-E      tctatgtttccctcatgttgctgttcaaaacctgcggacggaaattgcac
HM363588_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363589_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363601_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MN507840_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MF772361_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MF772358_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
LT623851_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN594765_SP_P-E      tctatgtgtccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494703_SP_P-E      tctatgtttccctcatgttgctgtttaaaaccttcggacggaaattgcac
AM494691_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB915178_SP_P-E      tctatgtgtccctcatgttgctgtttaaaaccttcggacggaaattgcac
KF849718_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF849726_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF849720_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF170741_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN594761_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363608_SP_P-E      tctatgattccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363597_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MF772355_SP_P-E      tctatgtttccctcatgttgttgttcaaaaccttcggacggaaattgcac
KF849723_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363592_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacataaattgcac
MH580626_SP_P-E      tctatgtttccctcatgttgctgtttaaaaccttcggacggaaattgcac
KU736913_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF849728_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF170742_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363607_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363604_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363600_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363590_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggaaggaaattgcac
HM363574_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcagacggaaattgcac
HM363566_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161786_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161778_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161810_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161760_SP_P-E      tctatgtttcccttatgttgctgttcaaaaccttcggacggaaattgcac
FN594766_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN594756_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggaaggaaattgcac
FN545821_SP_P-E      tctwtgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FJ349239_SP_P-E      tctacgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
EU239223_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
EU239222_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AY738144_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AY738145_SP_C-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AY738146_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AY738147_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494714_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB915177_SP_P-E      tctttgtttccctcatgttgctgctcaaaaccttcggacggaaattgcac
AB274982_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB274981_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB274973_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcgggcggaaattgcac
AB274970_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB205190_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580638_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN594753_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363576_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363575_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB194948_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494694_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494700_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363602_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494711_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494712_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF849714_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF849715_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363603_SP_P-E      tctacgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB274985_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363578_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161757_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580633_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
LT623847_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacgcaaattgcac
LT623843_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF849724_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161783_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161824_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161762_SP_P-E      tctatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcac
FN594762_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN594750_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB274978_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB274977_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FJ349240_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN545822_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN545842_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161756_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161795_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363610_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736909_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736911_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB274980_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AY739675_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN545823_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363569_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcagacggaaattgcac
AB274975_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161807_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161823_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363570_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161759_SP_P-E      tctatatttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736894_SP_P-E      tctatatttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161833_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MN507842_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MN507841_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgccc
MH580640_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580641_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MF772362_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
LT623848_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
LT623846_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
LT623845_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
LT623844_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736904_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736901_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736893_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KT749841_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KT192626_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KM606739_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KM606738_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF922439_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF849716_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttccgacggaaattgcac
KF849713_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
JQ000009_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
JQ000008_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggmcggaaattgcac
HQ700551_SP_P-E      tctatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcac
HM363605_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363599_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363598_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363596_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363582_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736891_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736892_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161834_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161826_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161814_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161803_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161799_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161818_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161821_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161798_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161797_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161796_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161791_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161785_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161836_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161782_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161792_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363594_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161780_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161779_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161776_SP_P-E      tctatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcac
GQ161784_SP_P-E      tctatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcac
GQ161789_SP_P-E      tctatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcac
GQ161828_SP_P-E      tctatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcac
GQ161771_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736897_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736898_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580617_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580628_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580644_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161769_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161768_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161765_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161764_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaactgcac
KF849721_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaactgcac
GQ161763_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161777_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN594751_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN594763_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN594748_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FJ349226_SP_P-E      tctatatttccctcatgttgctgttcaaaaccttcggacggaaattgcac
EU239221_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
EU239219_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
DQ060830_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HQ700550_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HQ700552_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
DQ060826_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccctcggacggaaattgcac
AM494699_SP_P-E      tctatgtttccctcatgttgctgttcaaagccttcggacggaaattgcac
AM494697_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494706_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494709_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494710_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494692_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494689_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB915175_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB274979_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB274976_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB274972_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
EU239218_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MN507843_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MN507844_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB219529_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB205189_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB201289_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB194947_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363606_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB091256_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB091255_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB201287_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB201288_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB201290_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB205129_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB205191_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB205192_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB274969_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB274971_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB274974_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AB915176_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494690_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494693_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494696_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494698_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494701_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494702_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494704_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494707_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494708_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494713_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494715_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494717_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AY739674_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AY935700_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
DQ060822_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
DQ060823_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
DQ060824_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
DQ060825_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
DQ060827_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
DQ060828_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
DQ060829_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
EU239217_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
EU239226_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FJ349237_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FJ349238_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN545827_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN545841_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
FN594752_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161755_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161758_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161761_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161766_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161770_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161772_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161773_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161774_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161781_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161787_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161790_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161793_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161794_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161800_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161801_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161802_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161804_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161805_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161808_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161811_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161812_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161815_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161816_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161817_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161819_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161820_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161827_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161829_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161830_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161832_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161835_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363567_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363568_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363571_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363572_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363573_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363577_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363579_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363580_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363581_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363583_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363584_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363585_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363586_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363587_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363591_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363593_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363595_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
HM363609_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF849717_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF849719_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF849722_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF849725_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF849727_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KF922438_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736895_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736896_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736899_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736900_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736902_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736903_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736905_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736906_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736907_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736908_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736910_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KU736912_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
KX186584_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
LT623850_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MF772354_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MF772360_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580614_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580615_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580616_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580618_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580619_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580620_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580621_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580622_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580623_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580624_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580625_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580629_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580630_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580631_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580632_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580634_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580635_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580636_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580637_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580646_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580647_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580649_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580650_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580651_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH580652_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MH918655_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MK321264_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MK720631_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MK720632_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MN507845_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MN507846_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MN507847_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
MN507848_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
X75657_SP_P-E        tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
AM494705_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
GQ161831_SP_P-E      tctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcac
                     ***      **** *** ** **   *** **    *    *** *** *

GU563552_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggggt
GQ161775_SP_P-E      ytgtattcccatcccatcatcatgggctttcgsaaaattcctatgggagt
KY498770_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494695_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggtgt
AB219534_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MF772359_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MF772357_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580645_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
LT623849_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161825_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN594758_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN594760_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN594759_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MF772356_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
LT623842_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363611_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363565_SP_P-E      ttgtactcccatcccatcatcatgggctttcggaaaatacctatgggagt
EU239220_SP_P-E      ttgtactcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274984_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB219533_SP_P-E      ttgtattcccatcccatcatcatgggctttcgcaaaattcctatgggagt
AB205188_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580648_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB915180_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
EU239224_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN594749_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB106564_SP_C-E      ttgtacccccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363588_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363589_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363601_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MN507840_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MF772361_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MF772358_SP_P-E      ttgtattcccatcccgtcatcatgggctttcggaaaattcctatgggagt
LT623851_SP_P-E      ttgtattcccatcccatcatcwtgggctttcggaaaattcctatgggagt
FN594765_SP_P-E      ttgtattcccatcccatcatcatgggctttmggaaaattcctatgggagt
AM494703_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494691_SP_P-E      ttgtattcccatcccatcatcatgggctttaggaaaattcctatgggagt
AB915178_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849718_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849726_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849720_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF170741_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN594761_SP_P-E      ttgtattcccatcccatcatcatgggctttcgaaaaattcctatgggagt
HM363608_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363597_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MF772355_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849723_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatggggtt
HM363592_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580626_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736913_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849728_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF170742_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363607_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363604_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363600_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363590_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363574_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363566_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161786_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161778_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggggt
GQ161810_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggggt
GQ161760_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN594766_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN594756_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN545821_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FJ349239_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggtgt
EU239223_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggggt
EU239222_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AY738144_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AY738145_SP_C-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AY738146_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AY738147_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494714_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB915177_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274982_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggggt
AB274981_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274973_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274970_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB205190_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggggt
MH580638_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN594753_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363576_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363575_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB194948_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494694_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494700_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363602_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494711_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494712_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849714_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849715_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363603_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274985_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363578_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161757_SP_P-E      ttgtattcccatcccgtcatcatgggctttcggaaaattcctatgggagt
MH580633_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
LT623847_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
LT623843_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849724_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161783_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161824_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161762_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN594762_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN594750_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274978_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274977_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FJ349240_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN545822_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN545842_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161756_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161795_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363610_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736909_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736911_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274980_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggcgt
AY739675_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggcgt
FN545823_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363569_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274975_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161807_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161823_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363570_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161759_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736894_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161833_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MN507842_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MN507841_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580640_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580641_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MF772362_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
LT623848_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
LT623846_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
LT623845_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
LT623844_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736904_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736901_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736893_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KT749841_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KT192626_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KM606739_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KM606738_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF922439_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849716_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849713_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
JQ000009_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
JQ000008_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HQ700551_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363605_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363599_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363598_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363596_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363582_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736891_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736892_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161834_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161826_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161814_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161803_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161799_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161818_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161821_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161798_SP_P-E      ttgtattcccatcccatcatcatgggctttcgtaaaattcctatgggagt
GQ161797_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161796_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161791_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161785_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161836_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161782_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161792_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363594_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161780_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161779_SP_P-E      ctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161776_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161784_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161789_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161828_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161771_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736897_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736898_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580617_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580628_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580644_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161769_SP_P-E      ctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161768_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161765_SP_P-E      ytgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161764_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849721_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161763_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaatacctatgggagt
GQ161777_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaatacctatgggagt
FN594751_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN594763_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN594748_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FJ349226_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
EU239221_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
EU239219_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
DQ060830_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HQ700550_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HQ700552_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
DQ060826_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494699_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494697_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494706_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494709_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494710_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494692_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494689_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB915175_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274979_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274976_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274972_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
EU239218_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MN507843_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MN507844_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB219529_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB205189_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB201289_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB194947_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363606_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB091256_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB091255_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB201287_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB201288_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB201290_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB205129_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB205191_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB205192_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274969_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274971_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB274974_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AB915176_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494690_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494693_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494696_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494698_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494701_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494702_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494704_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494707_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494708_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494713_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494715_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494717_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AY739674_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AY935700_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
DQ060822_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
DQ060823_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
DQ060824_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
DQ060825_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
DQ060827_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
DQ060828_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
DQ060829_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
EU239217_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
EU239226_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FJ349237_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FJ349238_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN545827_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN545841_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
FN594752_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161755_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161758_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161761_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161766_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161770_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161772_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161773_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161774_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161781_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161787_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161790_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161793_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161794_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161800_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161801_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161802_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161804_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161805_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161808_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161811_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161812_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161815_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161816_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161817_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161819_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161820_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161827_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161829_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161830_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161832_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161835_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363567_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363568_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363571_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363572_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363573_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363577_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363579_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363580_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363581_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363583_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363584_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363585_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363586_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363587_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363591_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363593_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363595_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
HM363609_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849717_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849719_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849722_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849725_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF849727_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KF922438_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736895_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736896_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736899_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736900_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736902_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736903_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736905_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736906_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736907_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736908_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736910_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KU736912_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
KX186584_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
LT623850_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MF772354_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MF772360_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580614_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580615_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580616_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580618_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580619_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580620_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580621_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580622_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580623_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580624_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580625_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580629_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580630_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580631_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580632_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580634_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580635_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580636_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580637_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580646_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580647_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580649_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580650_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580651_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH580652_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MH918655_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MK321264_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MK720631_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MK720632_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MN507845_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MN507846_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MN507847_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
MN507848_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
X75657_SP_P-E        ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
AM494705_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
GQ161831_SP_P-E      ttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagt
                      ****  ******** ***** ******** * ***** ********  *

GU563552_SP_P-E      gggcctcagcccgtttctcatggctcagtttactagt
GQ161775_SP_P-E      gggcctcagyccgtttctcctggctcagtttactag-
KY498770_SP_P-E      gggccttagcccgtttctcctggctcagtttactag-
AM494695_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB219534_SP_P-E      gggcctcagcccgtttctcctagctcagtttactag-
MF772359_SP_P-E      gggcctcagcccgtttctcctggctcagttcactag-
MF772357_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580645_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
LT623849_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161825_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN594758_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN594760_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN594759_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MF772356_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
LT623842_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363611_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363565_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
EU239220_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274984_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB219533_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
AB205188_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580648_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB915180_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
EU239224_SP_P-E      gggcctcagcccgttcctcctggctcagtttactag-
FN594749_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB106564_SP_C-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363588_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363589_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363601_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MN507840_SP_P-E      gggcctcagcccgtttctcctggctctgtttactag-
MF772361_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MF772358_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
LT623851_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN594765_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494703_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
AM494691_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB915178_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849718_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849726_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849720_SP_P-E      gggcctcagcccgtttcttatggttcagtttactag-
KF170741_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
FN594761_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
HM363608_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363597_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MF772355_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
KF849723_SP_P-E      gggcctcagcccgtttctcatggctcagtttactag-
HM363592_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580626_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736913_SP_P-E      gggcctyagcccgtttctcctggctcagtttactag-
KF849728_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF170742_SP_P-E      gggcctcagcccgtttctcckggctcagtttactag-
HM363607_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363604_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363600_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363590_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363574_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363566_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161786_SP_P-E      gggcctcagcccgtttctcctggctcagttcactag-
GQ161778_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161810_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161760_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN594766_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN594756_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN545821_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FJ349239_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
EU239223_SP_P-E      gggcctcagcccgtttctcctggctcaatttactag-
EU239222_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
AY738144_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AY738145_SP_C-E      gggcctcagcccgtttctcctggctcagtttactag-
AY738146_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AY738147_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494714_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB915177_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274982_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274981_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274973_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274970_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB205190_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580638_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
FN594753_SP_P-E      gggcctcagcccgtttctcctggctcagttyactag-
HM363576_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363575_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB194948_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494694_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494700_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363602_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494711_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494712_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849714_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849715_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363603_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274985_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363578_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161757_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580633_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
LT623847_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
LT623843_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849724_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161783_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161824_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161762_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN594762_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN594750_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274978_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274977_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FJ349240_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN545822_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN545842_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161756_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161795_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363610_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736909_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736911_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274980_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AY739675_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN545823_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363569_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274975_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161807_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161823_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363570_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161759_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736894_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161833_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MN507842_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MN507841_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580640_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580641_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MF772362_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
LT623848_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
LT623846_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
LT623845_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
LT623844_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736904_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736901_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736893_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KT749841_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KT192626_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
KM606739_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KM606738_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF922439_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849716_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849713_SP_P-E      gggcctcagcccgtttctcctggctcaatttactag-
JQ000009_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
JQ000008_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HQ700551_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363605_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363599_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363598_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363596_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363582_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736891_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736892_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161834_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161826_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
GQ161814_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161803_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161799_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161818_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161821_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161798_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161797_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161796_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
GQ161791_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161785_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161836_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161782_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161792_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363594_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161780_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161779_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161776_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161784_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161789_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161828_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161771_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736897_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736898_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580617_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580628_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580644_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161769_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161768_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
GQ161765_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161764_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849721_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161763_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161777_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN594751_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN594763_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN594748_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FJ349226_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
EU239221_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
EU239219_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
DQ060830_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HQ700550_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HQ700552_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
DQ060826_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494699_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494697_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494706_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494709_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494710_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494692_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494689_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB915175_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
AB274979_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274976_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274972_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
EU239218_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MN507843_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MN507844_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB219529_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
AB205189_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB201289_SP_P-E      gggcctcagcccgtttctcttggctcagtttactag-
AB194947_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363606_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB091256_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB091255_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB201287_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB201288_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB201290_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB205129_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB205191_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB205192_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274969_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274971_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB274974_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AB915176_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494690_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494693_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494696_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494698_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494701_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494702_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494704_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494707_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494708_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494713_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494715_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AM494717_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AY739674_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
AY935700_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
DQ060822_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
DQ060823_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
DQ060824_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
DQ060825_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
DQ060827_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
DQ060828_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
DQ060829_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
EU239217_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
EU239226_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FJ349237_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FJ349238_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN545827_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN545841_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
FN594752_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161755_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161758_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161761_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161766_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161770_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161772_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161773_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161774_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161781_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161787_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161790_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161793_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161794_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161800_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161801_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161802_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161804_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161805_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161808_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161811_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161812_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161815_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161816_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161817_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161819_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161820_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161827_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161829_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161830_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161832_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161835_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363567_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363568_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363571_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363572_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363573_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363577_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363579_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363580_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363581_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363583_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363584_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363585_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363586_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363587_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363591_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363593_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363595_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
HM363609_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849717_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849719_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849722_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849725_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF849727_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KF922438_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736895_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736896_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736899_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736900_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736902_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736903_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736905_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736906_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736907_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736908_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736910_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KU736912_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
KX186584_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
LT623850_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MF772354_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MF772360_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580614_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580615_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580616_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580618_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580619_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580620_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580621_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580622_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580623_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580624_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580625_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580629_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580630_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580631_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580632_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580634_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580635_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580636_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580637_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580646_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580647_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580649_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580650_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580651_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH580652_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MH918655_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MK321264_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MK720631_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MK720632_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MN507845_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MN507846_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MN507847_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
MN507848_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
X75657_SP_P-E        gggcctcagcccgtttctcctggctcagtttactag-
AM494705_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
GQ161831_SP_P-E      gggcctcagcccgtttctcctggctcagtttactag-
                     ****** ** ***** **    * **  ** ***** 

© 1998-2020Legal notice