HBVdb

Dataset for nucleotide sequence S of genotype E

[Download (right click)] [Edit] [Sequences] [Repertoires]

915 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


GU563552_S_P-E      -tagaaggcatcacatcaggattcctaagacccctgctcgtgttacaggcgaggtttttc
MF772356_S_P-E      atggaaagcatcacatcaggattcccagaacccctgcgcgtgttacaggcggggttttcc
KY494047_S_P-E      atggaamgcatcacatcargactcctaggacccctgctcgtgttacaggcggggtttttc
KY271386_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711631_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtatttc
AY303901_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttt
GQ161775_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711628_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN226074_S_P-E      atggaaagcattacatcaggattcccaggacccctgctcgtgttacaggcggggttttcc
JX849596_S_P-E      atggaaagcattacatcaggattcccaggacccctgctcgtgttacaggcggggttttcc
KM983582_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711638_S_P-E      atggaacgcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
KF771939_S_P-E      atggaagacatcacatcaggattcctagaacccctgcgcgtgttacaggcggggttttcc
EU239220_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623876_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623866_S_P-E      atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
KY494096_S_P-E      atggaaagcatcacatcaggaytcctaggacccctgctcgkgttacaggcggggtttttc
FN547280_S_P-E      atggaaggcatcacatcaggattcctaggacccctgcgcgtgttacaggcggggtttttc
AB091266_S_P-E      atggaaagcatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
MK840524_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
LT623856_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN594765_S_P-E      atggaaagcatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
FN547254_S_P-E      atggaaagcatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547294_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623862_S_P-E      atggaaggcatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
KU711629_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547223_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
FN547224_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttyc
EU239221_S_P-E      atggcaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623874_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623859_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623843_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggaggggtttttc
KM983584_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486451_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggmggggtttttc
JX849619_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggmggggtttttc
AB205324_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
KY493921_S_P-E      atggraagcatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttc
KM108623_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
FN547295_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB205323_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB205190_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711661_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412151_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170787_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggaggggttttcc
MF772358_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295520_S_P-E      atggaaagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
DQ412175_S_P-E      ctggaaagcatcacatcaggattcctaggacccctgcccgtgttacaggcggggtttttc
AY303925_S_P-E      atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547260_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
FN547281_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
MK840527_S_P-E      atggaaagcatcacatcaggattccaaggacccctgcacgtgttacaggcggggtttttc
MH464856_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
LT623854_S_P-E      atggaaagcatctcatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711634_S_P-E      atggaaagcattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF170751_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
JX849630_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttyc
FN547289_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547277_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547175_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547165_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692540_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
DQ412148_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486240_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849622_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494691_S_P-E      atggagagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
AM494728_S_P-E      atggagagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FN547189_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547199_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgkgttacaggcggggtttttc
FN547195_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547237_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547232_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623867_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547206_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547200_S_P-E      atggaaggcatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
DQ412144_S_P-E      atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580645_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363572_S_P-E      atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486707_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN594761_S_P-E      atggaaagcatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
FN547198_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU239224_S_P-E      atggaaagcattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
LT623855_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711612_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547278_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
GQ486079_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849626_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692543_S_P-E      atggararcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
AB205327_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF772357_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711659_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983583_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983590_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN594749_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412147_S_P-E      atggaagccatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547258_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
FN547262_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
FN545821_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547220_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF772359_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623844_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggmggggtttttc
KX372216_S_P-E      atggaargcatcacatcaggattcctaggacccctgcwcgtgttacaggcggggtttttc
KU711646_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttac
KU711643_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggttttttc
KF771927_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ972827_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604168_S_P-E      atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363603_S_P-E      atggaaaccatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486692_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486131_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849623_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161831_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161825_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547246_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547219_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412165_S_P-E      atggagagcatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttc
DQ412156_S_P-E      atggaaagcataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412143_S_P-E      atggaagccatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB915178_S_P-E      atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB219534_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtgtttc
AB194954_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY271381_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY271383_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161760_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606738_S_P-E      atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
FN547233_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgygttacaggcggggtttttc
FN295510_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB205325_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
LT623849_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547284_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623848_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN507846_S_P-E      atggaaagcatcacatcaggattcctacaacccctgctcgtgttacaggcggggtttttc
FN547299_S_P-E      atggaaagcatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547296_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547857_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
AY303910_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547285_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ000007_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG383615_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623873_S_P-E      atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623842_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY498770_S_P-E      atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
KY494038_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711656_S_P-E      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711648_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
KU711635_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711620_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ972820_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363609_S_P-E      atggaaagcaccacatccggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363602_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
HM363600_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486765_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486701_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486295_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849621_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161820_S_P-E      atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161757_S_P-E      atggaaagcatcacatcaagattcctaggacccctgctcgggttacaggcggggtttttc
FN594750_S_P-E      atggaaagcatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547362_S_P-E      atggaaagcatcacatccggattcctaagacccctgctcgtgttacaggcggggttttyc
FN547212_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547204_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547179_S_P-E      atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295509_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
FJ349227_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412161_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttc
DQ412146_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303908_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303895_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303889_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274980_S_P-E      atggaaagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
AB091262_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN507841_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711639_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170790_S_P-E      atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692542_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412162_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412158_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299402_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299403_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363565_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547158_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303913_S_P-E      atggaaagcatcacatcaggattcctaagacccctgcccgtgttacaggcggggtttttc
AY738919_S_P-E      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623870_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412133_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363588_S_P-E      atggaaagcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363589_S_P-E      atggaaagcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363601_S_P-E      atggaaagcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547303_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711608_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB106564_S_C-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB091255_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB091256_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738918_S_P-E      atgaaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ060822_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738923_S_P-E      atggaaagcatcacatcaggatttctaggacccctgctcgtgttacaggcggggtttttc
MH580633_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623883_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623879_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggmggggtttttc
L24071_S_P-E        atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372217_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttc
KU711658_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711657_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749841_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983588_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771930_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771926_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
JX849631_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ000009_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HQ700551_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363598_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363595_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363566_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486665_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN594756_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547293_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547274_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547268_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547231_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547227_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttyc
FN547168_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
FN547155_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692546_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412164_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412145_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
DQ412141_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412140_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303897_S_P-E      atggaaagcatcacatcaggattccyaggacccctgctcgtgttacaggcggggtttttc
AY303896_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303894_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
AY303881_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494738_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494726_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB915180_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB194948_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738147_S_P-E      atggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738146_S_P-E      atggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738144_S_P-E      atggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738145_S_C-E      atggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738922_S_P-E      atgggaagcatcacatcaggattcctaggacccctgcgcgtgttacaggcggggtttttc
HM363606_S_P-E      atggaaagcatcacatccggattcctaggacccctgctcgtattacaggcggggtttttc
FN547347_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412155_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412139_S_P-E      atgaaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623881_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
GQ486093_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849625_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547248_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN507840_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547163_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303878_S_P-E      atggaangcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623877_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711641_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692552_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623845_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623857_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983585_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983587_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983586_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY739674_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY739675_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412135_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412153_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ349239_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738921_S_P-E      atggaaagcatcacatcaggattcctagaccccctgctcgtgttacaggcggggtttttc
LT623871_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623865_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623864_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623861_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711611_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849725_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849716_S_P-E      atggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849713_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771933_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ000008_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363599_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363597_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363590_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486728_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486656_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849617_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161823_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161779_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161776_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161784_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161789_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161828_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN594762_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN594748_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547276_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547240_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547214_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547213_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547207_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547194_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547188_S_P-E      atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547167_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547154_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttt
FN295553_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692551_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
FJ349226_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU239223_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412173_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412166_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412149_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412142_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299410_S_P-E      atggaaagcatcatatcaggattcctaggaccccttctcgtgttacaggcggggtttttc
DQ299407_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggaggggtttttc
AY303931_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303924_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303914_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494719_S_P-E      atggaaagcatcacatcargattcctaggacccctgctcgtgttacaggcggggtttttc
AM494697_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494689_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF208871_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB915177_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274979_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB205129_S_P-E      atggaaggcatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttc
AB274982_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623853_S_P-E      atggmaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711617_S_P-E      atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
FN295552_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547288_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303886_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303893_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
L29017_S_P-E        atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB091259_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274975_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736899_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412169_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB205326_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604235_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547259_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711664_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161834_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161822_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161803_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545823_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547226_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161833_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN507847_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547266_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161811_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547221_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF772360_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547287_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547267_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547264_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547203_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547159_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494751_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494753_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB915176_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494707_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB091257_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274977_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692550_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547187_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547251_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547272_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547283_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161773_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161802_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363610_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849629_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170785_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK840530_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547176_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547261_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547263_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161801_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363586_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363585_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604192_S_P-E      atgaaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363573_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR139749_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
MH464855_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
DQ060827_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
DQ060826_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
DQ060828_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
DQ060829_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
FJ692545_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
FJ692548_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
GQ161761_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
GQ161807_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
GQ161764_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412172_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547282_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738924_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295507_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849718_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412170_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412174_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547310_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161804_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161808_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363594_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161778_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161810_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN507845_S_P-E      atggaaggcatcacatcaggattcctaggacccctgcacgtgttacaggcggggtttttc
KU711610_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849715_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849714_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486664_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547234_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547190_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547172_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295551_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ060824_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ060825_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692547_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692553_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849724_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB205328_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB091260_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB205191_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771921_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB205189_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299405_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547160_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547181_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547236_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486548_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HQ700552_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711609_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711640_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623850_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623863_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN507848_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HQ700550_S_P-E      atcgaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494741_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494692_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494709_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494710_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN594758_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494706_S_P-E      atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ972821_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ972823_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ972828_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170788_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580630_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580650_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
X75657_S_P-E        atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170784_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580631_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580632_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580652_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB091264_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274981_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB201290_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849727_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922438_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922439_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN594763_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
EU159673_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412137_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849717_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ060823_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY935700_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN594752_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412134_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412157_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412160_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547170_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547180_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486411_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849620_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885607_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849719_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849722_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849726_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849728_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF772354_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH918655_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303928_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161794_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295554_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299413_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303905_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ349237_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ349238_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623846_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547358_S_P-E      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303888_S_P-E      atggaaagcatcacatcaggattcctaagaccccttctcgtgttacaggcggggtttttc
MF772362_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161836_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547275_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161785_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363605_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF772361_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736896_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
AB201287_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgcattacaggcggggtttttc
KU736895_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
DQ412150_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494694_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494700_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363575_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494722_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK840528_S_P-E      atggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161769_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303890_S_P-E      atggaaagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
HM363607_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623878_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB205192_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB205329_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161815_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303898_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547286_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547252_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161786_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161770_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB194947_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363583_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161759_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736894_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN507842_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN507844_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161763_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161777_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161756_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161795_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ000003_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738925_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303919_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ000004_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ000005_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299411_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
EU239217_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
AY303930_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299420_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN507843_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580648_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580634_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580635_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580636_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY271380_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711663_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711662_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711647_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711637_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363596_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363591_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363584_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363582_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363577_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363576_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363574_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363568_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161832_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161816_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161812_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161798_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161771_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161765_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161762_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547257_S_P-E      atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547197_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547156_S_P-E      atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295550_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU239226_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299417_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303922_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303909_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303907_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303903_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303887_S_P-E      atggaaagcatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttc
AY303883_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274976_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299418_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB091258_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB091261_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB091263_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB091265_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274969_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274971_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274974_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274978_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494696_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303884_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303885_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303891_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303892_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303899_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303906_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303921_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303923_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303929_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ060830_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299406_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299412_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299414_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299419_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412167_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412168_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU239219_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547270_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547271_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161772_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161781_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161782_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161783_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161787_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161791_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161792_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161793_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161797_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161800_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161814_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161817_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161819_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161824_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161827_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161830_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486756_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363567_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363578_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363587_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363593_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363604_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ000002_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ000006_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ972819_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771944_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736897_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736898_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX186584_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY697839_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK840522_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547192_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547333_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547339_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY494098_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580621_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580622_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580624_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580625_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580629_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580637_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580646_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580647_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580649_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547300_S_P-E      atggaaagcagcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623882_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgyattacaggcggggtttttc
KU711632_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB219533_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
KP997699_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN594753_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711654_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623884_S_P-E      atggaaaacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttc
KU711630_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
GQ486116_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttyc
JX849624_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttyc
LT623875_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849723_S_P-E      atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412163_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
LT623852_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711665_S_P-E      atggaaaacatcatatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623872_S_P-E      atggaaamcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711636_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274984_S_P-E      atggaaaacatcacatcaggattcctaggacccctgcgcgtgttacaggcggggtttttc
DQ412154_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF772355_S_P-E      atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412138_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711633_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547169_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547164_S_P-E      atggaaagcatcacatcaggattcmtaggacccctgctcgtgttacaggcggggtttttc
DQ412171_S_P-E      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623885_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623886_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547184_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983589_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161826_S_P-E      atggaaagcatcacatcaggattcctaggacccctgcacgtgttacaggcggggtttttc
GQ161768_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547301_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547255_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547210_S_P-E      atggaaaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttc
AB274973_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580638_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983581_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738920_S_P-E      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggaggggtttttc
LT623847_S_P-E      atggaaaacatyacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711651_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547182_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547178_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692544_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
DQ412159_S_P-E      atggaaaccatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB205188_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
KF849720_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547297_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU239222_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363592_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711652_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711653_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606739_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF849721_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161758_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161766_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161774_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547205_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547186_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547171_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547162_S_P-E      atggaaarcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274970_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170741_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU239218_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274972_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363579_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363581_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547253_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547256_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363580_S_P-E      atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547230_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547229_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttyc
FN547202_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547217_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547218_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303902_S_P-E      atggaaarcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303904_S_P-E      atggaaarcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547304_S_P-E      atggaaarcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623860_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363611_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486579_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849618_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547177_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547185_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545822_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547225_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303915_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303912_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303911_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303916_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303917_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303918_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299416_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161755_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161780_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161835_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623858_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623868_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB201288_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547209_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB274985_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412152_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547174_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623869_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604166_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547193_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295555_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB915175_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB201289_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547173_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT192626_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB219529_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623880_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161796_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547183_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711655_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ972815_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT623851_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN594751_S_P-E      atggaaagcatcacatcaggactcctaggacccctgcccgtgttacaggcggggtttttc
AB194955_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363608_S_P-E      atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170779_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttgcaggcggggtttttc
FN547250_S_P-E      atggaaagcatcacatcaggattcctaggacccctgcacgtgttacaggcggggttttcc
FN594766_S_P-E      atggaaagcaccacatcaggattcctaggacccctgcacgtgttacaggcggggtttttc
FN547311_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494735_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494747_S_P-E      atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
AM494714_S_P-E      atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
AM494743_S_P-E      atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
AM494748_S_P-E      atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
AM494832_S_P-E      atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
AM494746_S_P-E      atggaaaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
KM108626_S_P-E      atggacagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
FN547201_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170752_S_P-E      atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ972818_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547222_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486258_S_P-E      atggaaaacatcacatcaggattcctaggacccctgckcgtgttacaggcggggtttttc
FN547298_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ972826_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547318_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494712_S_P-E      atggaaagcatcacatcarrattcctaggacccctgctcgtgttacaggcggggtttttc
GQ491107_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY697849_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN420455_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY494018_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736913_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170781_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170753_S_P-E      atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486778_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN594760_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547302_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547211_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412136_S_P-E      atggaaagcatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494736_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
AM494711_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170750_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170782_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170780_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494720_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494727_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM108590_S_P-E      atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
FN547290_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494703_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547319_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM108622_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM108610_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547359_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547215_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494744_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494732_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494730_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494724_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494705_S_P-E      atggaaagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FN547239_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580626_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736901_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM108625_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170789_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170783_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN594759_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547292_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547269_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545827_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ349240_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494740_S_P-E      atggaaagcattacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
AM494752_S_P-E      atggaaagcattacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
AM494729_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494699_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM108624_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494695_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494698_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494704_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547191_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH165306_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ972822_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494721_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494745_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736912_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736911_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736902_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736891_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736892_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736893_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170742_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ972812_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
JQ972813_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
JQ972814_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
JQ972816_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
JQ972817_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
JQ972829_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
HM363569_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161790_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161799_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161805_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161818_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161821_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161829_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547279_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547265_S_P-E      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547196_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547161_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545842_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303926_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303882_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303927_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494733_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494725_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494693_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494715_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736903_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494690_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494723_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494701_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494702_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494708_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494713_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494717_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494731_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494734_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494737_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM494739_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303920_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299415_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545841_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547356_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363570_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363571_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ972824_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ972825_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170786_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736900_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736904_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736905_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736906_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736907_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736908_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736909_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736910_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580614_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580615_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580616_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580617_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580618_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580619_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580620_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580623_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580628_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580640_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580641_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580644_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580651_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK321264_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK720631_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK720632_S_P-E      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
                     *      **     **   *         ***** * **   * **** *   * **  

GU563552_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtagtagacttctctcagt
MF772356_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY494047_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY271386_S_P-E      ttgttgacaaaaatcctcgcaatcccgcctggtctagactcgtggtggacttctctcaat
KU711631_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303901_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161775_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttcyctcaat
KU711628_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN226074_S_P-E      tcgttgacaaaaatcctcacaataccgcggartmtagactcgtggtggacttctctcaat
JX849596_S_P-E      tcgttgacaaaaatcctcacaataccgcggartmtagactcgtggtggacttctctcaat
KM983582_S_P-E      ttgttgacaaaaatcctcacaataccgcaaagtctagactcgtggtggacttctctcagt
KU711638_S_P-E      ttgttgacaaaaatcctcacaataccgcagaatctagactcgtggtggacttctctcaat
KF771939_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
EU239220_S_P-E      ttgttgacaaaaatcctcacaataccgcagaatctagactcgtggtggacttctctcagt
LT623876_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623866_S_P-E      ttgttgacaaaaatcctcacaataccgcagartctagactcgtggtggacttctctcaat
KY494096_S_P-E      ttgttgacaaaaatcctcacaataccgaagagtctagactcgtggtggacttctctcaat
FN547280_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB091266_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK840524_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623856_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN594765_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547254_S_P-E      ttgttgacaaaaatcctcacaataccgcagaatctagactcgtggtggacttctctcaat
FN547294_S_P-E      tcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623862_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711629_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547223_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547224_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU239221_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623874_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623859_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623843_S_P-E      tygttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM983584_S_P-E      ttgttgataaaaatcctcacaataccgcaaagtctaggctcgtggtggacttctctcaat
GQ486451_S_P-E      ttgttgacaaaaatcctmacaataccgcagagtctagactcgtggtggacttctctcaat
JX849619_S_P-E      ttgttgacaaaaatcctmacaataccgcagagtctagactcgtggtggacttctctcaat
AB205324_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY493921_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM108623_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547295_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AB205323_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB205190_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711661_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412151_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170787_S_P-E      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
MF772358_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295520_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412175_S_P-E      ttgttgacaaaaatcctcacaataccgaagagtctagactcgtggtggacttctctcaat
AY303925_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547260_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547281_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK840527_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH464856_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623854_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KU711634_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170751_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849630_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547289_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547277_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547175_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
FN547165_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
FJ692540_S_P-E      ttgttgacaaaaatcctcayaataccgcagartctagactcgtggtggacttctctcaat
DQ412148_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctttcaat
GQ486240_S_P-E      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849622_S_P-E      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494691_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494728_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547189_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547199_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547195_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547237_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547232_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623867_S_P-E      tkgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547206_S_P-E      ttgttgacaaaaatcctcataataccgcagagtctagactcgtggtggacttctctcaat
FN547200_S_P-E      ttgttgacaaaaatcctcacaatacctcagagtctagactcgtggtggacttctctcaat
DQ412144_S_P-E      ttgttgacaaaaatcctcacaataccgaagagtctagactcgtggtggacttctctcaat
MH580645_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363572_S_P-E      tcgttgacaaaaaccctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486707_S_P-E      ttgttgacaaaaatcctcacaataccscagagtctagactcgtggtggacttctctcaat
FN594761_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547198_S_P-E      ttgttgacaaaaatcctcacaataccgaagaatctagactcgtggtggacttctctcaat
EU239224_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623855_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711612_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547278_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486079_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849626_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ692543_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB205327_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MF772357_S_P-E      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU711659_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM983583_S_P-E      ttgttgacaaaaatcctcacaataccgcaaagtctagactcgtggtggacttctctcaat
KM983590_S_P-E      ttgttgacaaaaatcctcacaataccgcaaagtctagactcgtggtggacttctctcaat
FN594749_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412147_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtgggggacttctctcaat
FN547258_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547262_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN545821_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547220_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MF772359_S_P-E      ttgttgataaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623844_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KX372216_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711646_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KU711643_S_P-E      ttgttgataaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771927_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972827_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604168_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363603_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486692_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486131_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849623_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161831_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161825_S_P-E      ttgttgacaaaaatcctcaaaataccgcagagtctagactcgtggtggacttctctcaat
FN547246_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547219_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412165_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412156_S_P-E      ttgttgacaaaaatcctcacaataccgaagagtctagactcgtggtggacttctctcaat
DQ412143_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB915178_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB219534_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB194954_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY271381_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY271383_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161760_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606738_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547233_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295510_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB205325_S_P-E      tggttgataaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623849_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547284_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623848_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN507846_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547299_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547296_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF547857_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303910_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547285_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ000007_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MG383615_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623873_S_P-E      ttgttgacaaaaatcctcacaatacckcagagtctagactcgtggtggacttctctcaat
LT623842_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
KY498770_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY494038_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711656_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711648_S_P-E      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU711635_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711620_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972820_S_P-E      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HM363609_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363602_S_P-E      tcgttgataaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363600_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ486765_S_P-E      tygttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486701_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctmgactcgtggtggacttctctcaat
GQ486295_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849621_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161820_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161757_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN594750_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547362_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547212_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547204_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547179_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295509_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ349227_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412161_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
DQ412146_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AY303908_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303895_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303889_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274980_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB091262_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN507841_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KU711639_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170790_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ692542_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412162_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412158_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctcgactcgtggtggacttctctcaat
DQ299402_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299403_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363565_S_P-E      ttgttgacaaaaatcctcacaattccgaagagtctagactcgtggtggacttctctcaat
FN547158_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303913_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738919_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623870_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412133_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363588_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363589_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363601_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547303_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711608_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB106564_S_C-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB091255_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB091256_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738918_S_P-E      ttgttacaaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ060822_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738923_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580633_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623883_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623879_S_P-E      tcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
L24071_S_P-E        ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372217_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711658_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711657_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749841_S_P-E      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KM983588_S_P-E      ttgttgacaaaaatcctcacaataccgcaaagtctagactcgtggtggacttctctcaat
KF771930_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771926_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849631_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ000009_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HQ700551_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363598_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363595_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363566_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486665_S_P-E      tygttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN594756_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547293_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547274_S_P-E      ttgttaacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547268_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547231_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547227_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547168_S_P-E      ttgttgacaaaaatcctcacaataccgaagagtctagactcgtggtggacttctctcaat
FN547155_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ692546_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412164_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412145_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412141_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412140_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303897_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303896_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303894_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303881_S_P-E      ttgttgacaaaaatcctcacaatwccgcagagtctagactcgtggtgsacttctctcaat
AM494738_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494726_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB915180_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB194948_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738147_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738146_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738144_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738145_S_C-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738922_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363606_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547347_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
DQ412155_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412139_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623881_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486093_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849625_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547248_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
MN507840_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547163_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303878_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623877_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711641_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ692552_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623845_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
LT623857_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
KM983585_S_P-E      ttgttgacaaaaatcctcacaataccgcaaagtctagactcgtggtggacttctctcaat
KM983587_S_P-E      ttgttgacaaaaatcctcacaataccgcaaagtctagactcgtggtggacttctctcaat
KM983586_S_P-E      ttgttgacaaaaatcctcacaataccgcaaagtctaaactcgtggtggacttctctcaat
AY739674_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY739675_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412135_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412153_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ349239_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738921_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623871_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623865_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623864_S_P-E      ttgttgacaaaaatcctcamaataccgcagagtctagactcgtggtggacttctctcaat
LT623861_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711611_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849725_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849716_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849713_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771933_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ000008_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363599_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363597_S_P-E      ttgttgacaaaaatcctcacaattccgcagagtctagactcgtggtggacttctctcaat
HM363590_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486728_S_P-E      tcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486656_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849617_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161823_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161779_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161776_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161784_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161789_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161828_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN594762_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN594748_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547276_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547240_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547214_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547213_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547207_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547194_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547188_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547167_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547154_S_P-E      ttgttgacaaaaatcctcacaataccgcagagcctagactcgtggtggacttctctcaat
FN295553_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ692551_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ349226_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU239223_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412173_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412166_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412149_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412142_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299410_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299407_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303931_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303924_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303914_S_P-E      ttgttgacaaaaatcctcacaataccgcakagtctagactcgtggtgsacttctctcaat
AM494719_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494697_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494689_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF208871_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB915177_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274979_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB205129_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274982_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623853_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711617_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295552_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547288_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303886_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303893_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
L29017_S_P-E        ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB091259_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274975_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736899_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412169_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB205326_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604235_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547259_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711664_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161834_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161822_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161803_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN545823_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547226_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161833_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN507847_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547266_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161811_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547221_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MF772360_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547287_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547267_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547264_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547203_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547159_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494751_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494753_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB915176_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494707_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB091257_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274977_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ692550_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547187_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547251_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547272_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547283_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161773_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161802_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363610_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849629_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170785_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK840530_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547176_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547261_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547263_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161801_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363586_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363585_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604192_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggwggacttctctcaat
HM363573_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KR139749_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH464855_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ060827_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ060826_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ060828_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ060829_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ692545_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ692548_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161761_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161807_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161764_S_P-E      ttgttgacaaaaatcctcacaataccgcagaatctagactcgtggtggacttctctcaat
DQ412172_S_P-E      ttgttgayaaaaatcctcacaataccgcagaatctagactcgtggtggacttctctcaat
FN547282_S_P-E      ttgttgacaaaaatcctcacaataccgcagaatctagactcgtggtggacttctctcaat
AY738924_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295507_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849718_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412170_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412174_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547310_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161804_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161808_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363594_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161778_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161810_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN507845_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711610_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849715_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849714_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486664_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547234_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547190_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547172_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295551_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ060824_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ060825_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ692547_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ692553_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849724_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB205328_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB091260_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB205191_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771921_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB205189_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299405_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547160_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547181_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547236_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486548_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HQ700552_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711609_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711640_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623850_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623863_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN507848_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HQ700550_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494741_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494692_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494709_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494710_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN594758_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494706_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972821_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972823_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972828_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170788_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580630_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580650_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
X75657_S_P-E        ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170784_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580631_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580632_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580652_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB091264_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274981_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB201290_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849727_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF922438_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF922439_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN594763_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU159673_S_P-E      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ412137_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849717_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ060823_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY935700_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN594752_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412134_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412157_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412160_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547170_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547180_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486411_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849620_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC885607_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849719_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849722_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849726_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849728_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MF772354_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH918655_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303928_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161794_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295554_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299413_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303905_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ349237_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ349238_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623846_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547358_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303888_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MF772362_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161836_S_P-E      ttgttgataaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547275_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161785_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363605_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MF772361_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736896_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB201287_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736895_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412150_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494694_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494700_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363575_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494722_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK840528_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161769_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303890_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363607_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623878_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB205192_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB205329_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161815_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303898_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547286_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547252_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161786_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161770_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB194947_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363583_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161759_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736894_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN507842_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN507844_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161763_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161777_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161756_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161795_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ000003_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738925_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303919_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ000004_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ000005_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299411_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU239217_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303930_S_P-E      ttgttgacaaaaatcctcacaataccgcaaagtctagactcgtggtggacttctctcaat
DQ299420_S_P-E      ttgttgacaaaaatcctcacaataccgcaaagtctagactcgtggtggacttctctcaat
MN507843_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580648_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580634_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580635_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580636_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY271380_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711663_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711662_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711647_S_P-E      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU711637_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363596_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363591_S_P-E      ttgttgacaaaaatcctcacaattccgcagagtctagactcgtggtggacttctctcaat
HM363584_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363582_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363577_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363576_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363574_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363568_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161832_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161816_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161812_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161798_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161771_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161765_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161762_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547257_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547197_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547156_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295550_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU239226_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299417_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303922_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303909_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303907_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303903_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303887_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303883_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274976_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299418_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB091258_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB091261_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB091263_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB091265_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274969_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274971_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274974_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274978_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494696_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303884_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303885_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303891_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303892_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303899_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303906_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303921_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303923_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303929_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ060830_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299406_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299412_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299414_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299419_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412167_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412168_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU239219_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547270_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547271_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161772_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161781_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161782_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161783_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161787_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161791_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161792_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161793_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161797_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161800_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161814_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161817_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161819_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161824_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161827_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161830_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486756_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363567_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363578_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363587_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363593_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363604_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ000002_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ000006_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972819_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771944_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736897_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736898_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX186584_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY697839_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK840522_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547192_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547333_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547339_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY494098_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580621_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580622_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580624_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580625_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580629_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580637_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580646_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580647_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580649_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547300_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623882_S_P-E      ttgttgacaaaaatcctcacaataccgcggagtctagactcgtggtggacttctctcagt
KU711632_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB219533_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP997699_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN594753_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711654_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623884_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KU711630_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486116_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849624_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623875_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849723_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412163_S_P-E      tcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623852_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711665_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623872_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711636_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274984_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412154_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MF772355_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412138_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711633_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547169_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtagacttctctcaat
FN547164_S_P-E      ttgttgacaaaaatcctcacaattccgcagagtctagactcgtggtggacttctctcaat
DQ412171_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623885_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623886_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547184_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM983589_S_P-E      ttgttgacaaaaatcctcacaataccgcaaagtctagactcgtggtggacttctctcaat
GQ161826_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161768_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547301_S_P-E      tcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547255_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547210_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274973_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580638_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM983581_S_P-E      ttgttgacaaaaatcctcacaataccgcaaagtctagactcgtggtggacttctctcaat
AY738920_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623847_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711651_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547182_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547178_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ692544_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412159_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB205188_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849720_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547297_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU239222_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363592_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711652_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711653_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606739_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF849721_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161758_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161766_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161774_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547205_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547186_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547171_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547162_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274970_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170741_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU239218_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274972_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363579_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363581_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547253_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547256_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363580_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547230_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547229_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547202_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547217_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547218_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303902_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303904_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547304_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623860_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363611_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486579_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849618_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547177_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547185_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN545822_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547225_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303915_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303912_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303911_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303916_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303917_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303918_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299416_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161755_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161780_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161835_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623858_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623868_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB201288_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547209_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB274985_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412152_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547174_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623869_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604166_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547193_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295555_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB915175_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB201289_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547173_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT192626_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB219529_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623880_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161796_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547183_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU711655_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972815_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LT623851_S_P-E      ttgttgacaaaaatcctcacaataccgcagaatctagactcgtggtggacttctctcagt
FN594751_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB194955_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
HM363608_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170779_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagacacgtggtggacttctctcaat
FN547250_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN594766_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547311_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494735_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494747_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494714_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494743_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494748_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494832_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494746_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM108626_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547201_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KF170752_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972818_S_P-E      tcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
FN547222_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486258_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547298_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972826_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547318_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494712_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ491107_S_P-E      ttgttgacaaaaatcctcacaataccgaagagtctagactcgtggtggacttctctcaat
KY697849_S_P-E      ttgttgacaaaaatcctcacaataccgaagagtctagactcgtggtggacttctctcaat
MN420455_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY494018_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736913_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170781_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170753_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486778_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN594760_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547302_S_P-E      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547211_S_P-E      ttgttgacaaraatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412136_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494736_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494711_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170750_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170782_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170780_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494720_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AM494727_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KM108590_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547290_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494703_S_P-E      ttgttgacaaaaatcctcacaataccgcagaatctagactcgtggtggacttctctcaat
FN547319_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM108622_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM108610_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
FN547359_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547215_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494744_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494732_S_P-E      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AM494730_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494724_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494705_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547239_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580626_S_P-E      ttgttgacaaaaatcctcacaataccgaagagtctagactcgtggtggacttctctcaat
KU736901_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM108625_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170789_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170783_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN594759_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547292_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547269_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN545827_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ349240_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AM494740_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494752_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494729_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494699_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM108624_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494695_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494698_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494704_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547191_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH165306_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972822_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494721_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494745_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736912_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736911_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736902_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736891_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736892_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736893_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170742_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972812_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972813_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972814_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972816_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972817_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972829_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363569_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161790_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161799_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161805_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161818_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161821_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ161829_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547279_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547265_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547196_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547161_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN545842_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303926_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303882_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303927_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494733_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494725_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494693_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494715_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736903_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494690_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494723_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494701_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494702_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494708_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494713_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494717_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494731_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494734_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494737_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM494739_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY303920_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ299415_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN545841_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN547356_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363570_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM363571_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972824_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ972825_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF170786_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736900_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736904_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736905_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736906_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736907_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736908_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736909_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU736910_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580614_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580615_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580616_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580617_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580618_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580619_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580620_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580623_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580628_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580640_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580641_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580644_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH580651_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK321264_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK720631_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK720632_S_P-E      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
                    * ***   ** ** ***   *** **        *   * *** *   *****  *** *

GU563552_S_P-E      tttctaaaaagagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
MF772356_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagttcccaatctccaatcac
KY494047_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KY271386_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711631_S_P-E      tttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AY303901_S_P-E      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161775_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
KU711628_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
JN226074_S_P-E      tttctagggggaactcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
JX849596_S_P-E      tttctagggggaactcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
KM983582_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
KU711638_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KF771939_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
EU239220_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623876_S_P-E      tttctagggggagytcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
LT623866_S_P-E      tttctagggggagctcccgkgtgtcttggccaaaattcgcagtcccmaatctccaatcac
KY494096_S_P-E      tttctagggggagctcccgtgtgtcytggccaaaattcgcagtccccaacctccaatcac
FN547280_S_P-E      tttctagggggagctcacgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AB091266_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
MK840524_S_P-E      tctctagaggaagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623856_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtcccaaatctccaatcac
FN594765_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547254_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaatctccaatcac
FN547294_S_P-E      tttctaggggaagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
LT623862_S_P-E      tttctagggggagytcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711629_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
FN547223_S_P-E      tttctagggggagttcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
FN547224_S_P-E      tttctagggggagttcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
EU239221_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623874_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623859_S_P-E      tttctagggggagctcccgtgtgtcatggccaaaattcgcagtccccaacctccaatcac
LT623843_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaatctccaatcac
KM983584_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagccac
GQ486451_S_P-E      tttctagggggagctcccgtgtgtcktggccaaaattcgcagtccccaacctccaatcac
JX849619_S_P-E      tttctagggggagctcccgtgtgtcktggccaaaattcgcagtccccaacctccaatcac
AB205324_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaatttgcagtccccaacctccaatcac
KY493921_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KM108623_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
FN547295_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB205323_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB205190_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711661_S_P-E      tttctaggggaagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412151_S_P-E      tttccagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KF170787_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
MF772358_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN295520_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412175_S_P-E      tttctaggggaagttcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
AY303925_S_P-E      tttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547260_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547281_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
MK840527_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
MH464856_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
LT623854_S_P-E      tttctaggggaagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711634_S_P-E      tttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KF170751_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
JX849630_S_P-E      tttctaggggragctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
FN547289_S_P-E      tttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
FN547277_S_P-E      tttctaggggragctcccgtgtgtcktggccaaaattcgcagtccccaacctccaatcac
FN547175_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547165_S_P-E      tttctagggggagctcccgtgtgtcttggccgaaattcgcagtccccaatctccaatcac
FJ692540_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412148_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaatctccaatcac
GQ486240_S_P-E      tytctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
JX849622_S_P-E      tytctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
AM494691_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AM494728_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547189_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
FN547199_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
FN547195_S_P-E      tttctagggaragctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
FN547237_S_P-E      tttctagggggagctcccgtgtgtcktggccaaaattcgcagtccccaacctccaatcac
FN547232_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623867_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547206_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
FN547200_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
DQ412144_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaatctccaatcac
MH580645_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctgcaatcac
HM363572_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
GQ486707_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN594761_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547198_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaatctccaatcac
EU239224_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623855_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711612_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
FN547278_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ486079_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
JX849626_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
FJ692543_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB205327_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
MF772357_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagttcccaacctccaatcac
KU711659_S_P-E      tttctagggggagctcccgtgtgttttggccaaaattcgcagtccccaacctccaatcac
KM983583_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KM983590_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN594749_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
DQ412147_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547258_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
FN547262_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
FN545821_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547220_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
MF772359_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623844_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KX372216_S_P-E      tttctaggggragctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
KU711646_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711643_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
KF771927_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
JQ972827_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccartcac
JN604168_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
HM363603_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ486692_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ486131_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
JX849623_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161831_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161825_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547246_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
FN547219_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412165_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412156_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
DQ412143_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
AB915178_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccagtcac
AB219534_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB194954_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KY271381_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KY271383_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161760_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
KM606738_S_P-E      tttctaggggaagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
FN547233_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN295510_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB205325_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623849_S_P-E      tttctagggggagctcccgtgtgtcktggccaaaattcgcagtccccaacctccaatcac
FN547284_S_P-E      tttctagggggagctcccgtgtgtcktggccaaaattcgcagtccccaacctccaatcac
LT623848_S_P-E      tttctagggggagctcccgtgtgtcktggccaaaattcgcagtccccaacctccaatcac
MN507846_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547299_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
FN547296_S_P-E      tttctagggggagctcmcgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
EF547857_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
AY303910_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctgcagtcac
FN547285_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
JQ000007_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
MG383615_S_P-E      tttctagggggagctcccgtgtgtcktggccaaaattcgcagtccccaacctccaatcac
LT623873_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623842_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KY498770_S_P-E      tttctagggggagytcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KY494038_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711656_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711648_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711635_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711620_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccagtcac
JQ972820_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
HM363609_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaatttgcagtccccaatctccaatcac
HM363602_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
HM363600_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ486765_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ486701_S_P-E      tttctaggggragctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ486295_S_P-E      tttctaggggragctcccgtgtgtcstggccaaaattcgcagtycccaacctccaatcac
JX849621_S_P-E      tttctaggggragctcccgtgtgtcstggccaaaattcgcagtycccaacctccaatcac
GQ161820_S_P-E      tttctagggggagctcccgtgtgtcytggccaaaattcgcagtccccaacctccaatcac
GQ161757_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
FN594750_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaatctccaatcac
FN547362_S_P-E      tttctagggggagctcccgtgtgtcktggccaaaattcgcagtccccaatctccaatcac
FN547212_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547204_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547179_S_P-E      tttctagggggagctcccgtgtgtcktggccaaaattcgcagtccccaacctccaatcac
FN295509_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ349227_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412161_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
DQ412146_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AY303908_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AY303895_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagttcccaacctccaatcac
AY303889_S_P-E      tttctagggggaactcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB274980_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB091262_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
MN507841_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711639_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KF170790_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
FJ692542_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
DQ412162_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412158_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ299402_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
DQ299403_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
HM363565_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547158_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
AY303913_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AY738919_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
LT623870_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
DQ412133_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
HM363588_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaatttgcagtccccaacctccaatcac
HM363589_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
HM363601_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547303_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711608_S_P-E      tttctaggggaacatcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
AB106564_S_C-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB091255_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB091256_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AY738918_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ060822_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AY738923_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
MH580633_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
LT623883_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623879_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
L24071_S_P-E        tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KX372217_S_P-E      tttctagggggagctcccgtgtgycttggccaaaattcgcagtccccaacctccaatcac
KU711658_S_P-E      tttctaggggggactcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711657_S_P-E      tttctagggggagctcccgtgtgtcttggcccaaattcgcagtccccaacctccaatcac
KT749841_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
KM983588_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
KF771930_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KF771926_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
JX849631_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
JQ000009_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
HQ700551_S_P-E      tttctagggggaactcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
HM363598_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
HM363595_S_P-E      tttctagggggagctcccgggtgtcttggccaaaattcgcagtcccaaatctccaatcac
HM363566_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
GQ486665_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN594756_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547293_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtcccaaatctccaatcac
FN547274_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547268_S_P-E      tttctaggggragctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547231_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547227_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
FN547168_S_P-E      tttctaggggaagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
FN547155_S_P-E      tttctagggggagctcccgtgtrtcttggccaaaattcgcagtccccaacctccaatcac
FJ692546_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
DQ412164_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ412145_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
DQ412141_S_P-E      tttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412140_S_P-E      tttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AY303897_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AY303896_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
AY303894_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
AY303881_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattygcagtccccaacctccaatcac
AM494738_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AM494726_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AB915180_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AB194948_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
AY738147_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
AY738146_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
AY738144_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcggtccccaatctccaatcac
AY738145_S_C-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
AY738922_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
HM363606_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
FN547347_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412155_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412139_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623881_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
GQ486093_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
JX849625_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547248_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
MN507840_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547163_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
AY303878_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623877_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711641_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ692552_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
LT623845_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623857_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KM983585_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
KM983587_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
KM983586_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AY739674_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AY739675_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412135_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412153_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ349239_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AY738921_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
LT623871_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623865_S_P-E      tttctaggggaagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623864_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623861_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711611_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KF849725_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
KF849716_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
KF849713_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
KF771933_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
JQ000008_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
HM363599_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
HM363597_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
HM363590_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ486728_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ486656_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
JX849617_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
GQ161823_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161779_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161776_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ161784_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ161789_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
GQ161828_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
FN594762_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
FN594748_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
FN547276_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547240_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547214_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
FN547213_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
FN547207_S_P-E      tttctagggggagttcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547194_S_P-E      tttctagggggagctcccgtgtgtcktggccaaaattcgcagtccccaacctccaatcac
FN547188_S_P-E      tttctagggggakctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547167_S_P-E      tttctagggggagctcccgtgtgtcktggccaaaattcgcagtccccaacctccaatcac
FN547154_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN295553_S_P-E      tttctagggggagctcccgtatgtcttggccaaaattcgcagtccccaacctccaatcac
FJ692551_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ349226_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
EU239223_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412173_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412166_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
DQ412149_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ412142_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtcccaaatctccaatcac
DQ299410_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ299407_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AY303931_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AY303924_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtcccaaacctccaatcac
AY303914_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AM494719_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AM494697_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AM494689_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AF208871_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AB915177_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AB274979_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
AB205129_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB274982_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623853_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
KU711617_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN295552_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
FN547288_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
AY303886_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
AY303893_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
L29017_S_P-E        tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
AB091259_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
AB274975_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
KU736899_S_P-E      tttctagggggagctcccgtgtgtcctggccaaaattcgcagtccccaacctccaatcac
DQ412169_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
AB205326_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
JN604235_S_P-E      tttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
FN547259_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711664_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161834_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
GQ161822_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
GQ161803_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
FN545823_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
FN547226_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
GQ161833_S_P-E      tttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcac
MN507847_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547266_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161811_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547221_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
MF772360_S_P-E      tttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547287_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547267_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547264_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547203_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547159_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AM494751_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AM494753_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB915176_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AM494707_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AB091257_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB274977_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ692550_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547187_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547251_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547272_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547283_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161773_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161802_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
HM363610_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
JX849629_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KF170785_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
MK840530_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547176_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547261_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547263_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161801_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
HM363586_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
HM363585_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
JN604192_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
HM363573_S_P-E      attctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KR139749_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
MH464855_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
DQ060827_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
DQ060826_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
DQ060828_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
DQ060829_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
FJ692545_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ692548_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161761_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161807_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161764_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ412172_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547282_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AY738924_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
FN295507_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
KF849718_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
DQ412170_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
DQ412174_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
FN547310_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161804_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161808_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
HM363594_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161778_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ161810_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
MN507845_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711610_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KF849715_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
KF849714_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
GQ486664_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547234_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547190_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547172_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN295551_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
DQ060824_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
DQ060825_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
FJ692547_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
FJ692553_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
KF849724_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcac
AB205328_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB091260_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB205191_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KF771921_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AB205189_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
DQ299405_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547160_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547181_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FN547236_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ486548_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
HQ700552_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711609_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KU711640_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623850_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
LT623863_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
MN507848_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
HQ700550_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
AM494741_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AM494692_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AM494709_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AM494710_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
FN594758_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
AM494706_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
JQ972821_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
JQ972823_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
JQ972828_S_P-E      tttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcac
KF170788_S_P-E      ttt<