HBVdb

Dataset for nucleotide sequence PreS2 of genotype E

[Download (right click)] [Edit] [Sequences] [Repertoires]

367 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


KF170787_PreS2_P-E      atgcaatggaattctacaacattccaccaagctctacaggatcccagagt
GQ161775_PreS2_P-E      atgcagtggaattccacaacattccaccaacctctgcagaatcccagagt
EU239220_PreS2_P-E      gttcagtggaattccacaacattccaccaaaatctgcaggatcccagagt
FN594751_PreS2_P-E      atacagtggaattccaaaacattccaccaagctctgcaggatcccagagt
LT623843_PreS2_P-E      atgcartggaattccacaacattccgccaagctctgcaggatcccagagt
LT623851_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB274984_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363608_PreS2_P-E      atgcagtggaattccagaacatttcaccaagctctgcaggatcccagagt
KF170779_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB219533_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494711_PreS2_P-E      atgcagtggaattccacaacattccaccaaactctgcaggatcccagagt
AM494712_PreS2_P-E      gtgcagtggaattccaaaacattccaccaagctctgcaggatcccagagt
FN594765_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF170751_PreS2_P-E      atgcagtggaattccaaaacattccatcaagctctgcaggatcccagagt
AB205190_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB274973_PreS2_P-E      atgcagtggaattccacaacattccaccaagttcagcaggatcacagagt
MF772355_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccaaagt
KM606738_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
FN594766_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494691_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363600_PreS2_P-E      atgcagtggaattcaacaacattccaccaaactctgcagaatcccagagt
AB915178_PreS2_P-E      atgcagtggaattccaagacattccaccaagctctgcaggatmccagagt
LT623844_PreS2_P-E      atgcagtggaattccacaacattccacaaagctctgcaggatcccagagt
KF849723_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161825_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KY498770_PreS2_P-E      atgcwgtggaattccacaacattccaccaagctctgcaggatcccagart
HM363572_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363603_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
EU239221_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363593_PreS2_P-E      atgcagtggaattccaaaacattccaccaagctctacaggaccccagagt
HM363611_PreS2_P-E      atgcagtggaattccaaaacattccaccaagctctacaggaccccagagt
MF772357_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
JN604168_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363602_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccaaagt
KF170750_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF170782_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494714_PreS2_P-E      gtgcagtggaattccaaaacattccaccaagctctgcaggatcccagagt
MN507844_PreS2_P-E      atgcagtggcattacaaaacattccaccaagatctgcagaatcccagagt
KM108626_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KM108623_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161760_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
FN594749_PreS2_P-E      atgaagtggaattccacaacattccaccaagctctgcaggatcccagagt
FN545821_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccaaagt
FN594762_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgctggatcccacagt
FN594761_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
LT623847_PreS2_P-E      atgcartggaattccacaacattccaccaagctctgcaggatcccagagt
HM363565_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggaccccagagt
HM363588_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363589_PreS2_P-E      atgcaatggaattccacaacattccaccaagctctgcaggatcccagagt
HM363601_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH464856_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736913_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KT749841_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KM108610_PreS2_P-E      atgcagtggaattcaacaacattccaccaaactctgcaagatcccagagt
GQ161820_PreS2_P-E      atgcagtggaattccacaacattccaccaagmtctgcaggatcccagagt
FN594760_PreS2_P-E      atgcagtggaattccaaaacattccaccaagctctgcaggatcccagagt
FN594750_PreS2_P-E      atgcagtggaattccaaaacattccaccaagctctgcaggatcccagagt
MH580645_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF170790_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF170783_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccaaagt
JN604235_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcagamtcccacagt
EU239222_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcagaatcccagagt
EU239224_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363595_PreS2_P-E      atgcagtggaattccacaacatttcaccaagctctgcaggatcccagagt
AM494703_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MN507841_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MN507846_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB194948_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
LT623845_PreS2_P-E      atgcartggaattccacaacattccaccaagctctgcaggatcccagagt
LT623842_PreS2_P-E      atgcagtggaattccayaacattccaccaagctctgcaggatcccagagt
KM108622_PreS2_P-E      atgcaatggaattccacaacattccaccaagctctgcaggatcccagagt
KF170753_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363599_PreS2_P-E      atgcagtggaattccacaacatttcaccaagctctgcaggatcccagagt
HM363566_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161768_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161757_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB274980_PreS2_P-E      atgcagtggaattccacaacattccaccaggctctgcaggatcccagagt
AB106564_PreS2_C-E      atgcagcggaactccacaacattccaccaagctctgcaggatcccagagt
AB205129_PreS2_P-E      atgcagtggaattccacagcattccaccaagctctgcaggatcccaaagt
AB205192_PreS2_P-E      atgcagtggaattccacagcattccaccaagctctgcaggatcccaaagt
KM606739_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363606_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
FN545822_PreS2_P-E      atgaagtggaattccacaacattccaccaagctctgcaggatcccagaat
AM494695_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB274975_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161823_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KM108625_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF849720_PreS2_P-E      atgcagyggaattccacaacattccaccaagctctgcaggatcccagagt
MN507847_PreS2_P-E      atgcagtggaattccacaacattccaacaagctctgcaggatcccagagt
MH580638_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MN507845_PreS2_P-E      atgcagtggaattccaaaacattccaccaagctctgcaggatcccagagt
LT623849_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF849725_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF849717_PreS2_P-E      atgcagtggaattccacaacattccaccaaactctgcaggatcccagagt
KF849715_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363609_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363607_PreS2_P-E      atacagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161776_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctacaggatcccagagt
GQ161784_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctacaggatcccagagt
GQ161789_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctacaggatcccagagt
GQ161828_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctacaggatcccagagt
GQ161758_PreS2_P-E      atgcagtggaattacacaacattccaccaagctctgcaggatcccagagt
GQ161766_PreS2_P-E      atgcagtggaattacacaacattccaccaagctctgcaggatcccagagt
GQ161774_PreS2_P-E      atgcagtggaattacacaacattccaccaagctctgcaggatcccagagt
FN594756_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494692_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB274970_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB091256_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AY738147_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagggt
AY738146_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagggt
AY738144_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagggt
AY738145_PreS2_C-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagggt
KM108624_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaagatcccagagt
HM363610_PreS2_P-E      atgcagtggaattccacaacattccacaaagctctgcaggatcccagagt
FN545842_PreS2_P-E      atacagtggaattccacagcattccaccaagctctgcaggatcccagagt
FN545823_PreS2_P-E      atgcagtggaattctacaacattccaccaagctctgcaggatcccagagt
AB274979_PreS2_P-E      attcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB274985_PreS2_P-E      attcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363590_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363592_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AY739674_PreS2_P-E      atgcagtggaactccacaacattccaccaagctctgcaggatcccagagt
AY739675_PreS2_P-E      atgcagtggaactccacaacattccaccaagctctgcaggatcccagagt
MN507840_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580630_PreS2_P-E      atgcagtggaattccacaacattccaccaaactctgcaagatcccagagt
MF772360_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF170789_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
JQ000009_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
JN604166_PreS2_P-E      atgcaktggaattccacaacattccaccaagctctgcaggatcccagagt
HM363598_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363594_PreS2_P-E      atgcagtggaattccacaacatttcaccaagctctgcaggatcccagagt
GQ161836_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161834_PreS2_P-E      atgcagtggaattccacaacattccaccaagctcttcaggatcccagagt
GQ161773_PreS2_P-E      atgcaatggaattccacaacattccaccaaactctgcaggatcccagagt
GQ161802_PreS2_P-E      atgcaatggaattccacaacattccaccaaactctgcaggatcccagagt
FN594748_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
FJ349226_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
EU239223_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctacaggatcccagagt
EU239219_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctacaggatcccagagt
AM494697_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB915177_PreS2_P-E      atgcagtggaattccacgacattccaccaagctctgcaggatcccagagt
AB274981_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB274977_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccaaagt
EU239226_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctacaggatcccagagt
AM494709_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494705_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161797_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccaaaat
EU159673_PreS2_P-E      atgcagtggaattccacaacattccaccaaactctgcaggatcccagagt
GQ161803_PreS2_P-E      gtgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494704_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
FJ349239_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB915175_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161761_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161807_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363579_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363581_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363580_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736896_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB201287_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736895_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MN507842_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580634_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580635_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580636_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
LT623848_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736901_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736899_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF849721_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF849716_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF849714_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF849713_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF170785_PreS2_P-E      atgcagtggaattccacaacattccacaaaactctgcaggatcccagagt
KF170742_PreS2_P-E      atgcagtggaattccacaacattccaccaaactctgcaggatcccagagt
JQ000008_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363597_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363584_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363574_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363573_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161822_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161811_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161798_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161785_PreS2_P-E      atgcaatggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161783_PreS2_P-E      atgcaatggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161824_PreS2_P-E      atgcaatggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161779_PreS2_P-E      atgcagtggaattccacaacattccatcaagctctgcaggatcccagagt
GQ161769_PreS2_P-E      atgcagtggaattccacaacattccatcaagctctgcaggatcccagagt
GQ161765_PreS2_P-E      atgcagtggaattccacaacattccatcaagctctgcaggatcccagagt
GQ161764_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161762_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
FN594759_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
FN594758_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
EU239218_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
EU239217_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
DQ060822_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494710_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494706_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494699_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB274982_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB091255_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580650_PreS2_P-E      atgcggtggaattccccaacattccaccaagctctgcaggatcccagagt
KF170741_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363585_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF170784_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736891_PreS2_P-E      atgcagtggaattccacaacatttcaccaagctctgcaggatcccagagt
KU736892_PreS2_P-E      atgcagtggaattccacaacatttcaccaagctctgcaggatcccagagt
AB915176_PreS2_P-E      atgcagtggaattccacgacattccaccaagctctgcaggatcccagagt
AM494707_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB205191_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
FJ349237_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
FJ349238_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
LT623846_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
FN545841_PreS2_P-E      atgcagtggaattccacagcattccaccaagctctgcaggatcccagagt
MH580614_PreS2_P-E      atgcagtggaattccacagcattccaccaagctctgcaggatcccagagt
MH580615_PreS2_P-E      atgcagtggaattccacagcattccaccaagctctgcaggatcccagagt
MH580616_PreS2_P-E      atgcagtggaattccacagcattccaccaagctctgcaggatcccagagt
MH580618_PreS2_P-E      atgcagtggaattccacagcattccaccaagctctgcaggatcccagagt
MH580619_PreS2_P-E      atgcagtggaattccacagcattccaccaagctctgcaggatcccagagt
MH580620_PreS2_P-E      atgcagtggaattccacagcattccaccaagctctgcaggatcccagagt
MH580623_PreS2_P-E      atgcagtggaattccacagcattccaccaagctctgcaggatcccagagt
MH580651_PreS2_P-E      atgcagtggaattccacagcattccaccaagctctgcaggatcccagagt
MH580644_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580617_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580628_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736912_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736911_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736909_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736902_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736893_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF170788_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
X75657_PreS2_P-E        atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF170786_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363569_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494693_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494715_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736903_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494690_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494701_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494702_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494708_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494713_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494717_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363570_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363571_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736900_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736904_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736905_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736906_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736907_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736908_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736910_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580640_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580641_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MK321264_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MK720631_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MK720632_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161755_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161835_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB201288_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161780_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KR139749_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH464855_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MN507848_PreS2_P-E      atgcagtggaattctacaacattccaccaagctctgcaggatcccagagt
LT623850_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagaat
HQ700550_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
DQ060824_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
DQ060825_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF849724_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB205189_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HQ700552_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF849718_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363583_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363582_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161770_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MF772362_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161778_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161810_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161804_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161808_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494694_PreS2_P-E      atacagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494700_PreS2_P-E      atacagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363575_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161833_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580648_PreS2_P-E      gtgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB201290_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF849727_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161759_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736894_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MN507843_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH918655_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580631_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580632_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580652_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580629_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KU736897_PreS2_P-E      atgcagtggaattccacaacattccaccaaactctgcaggatcccagagt
KU736898_PreS2_P-E      atgcagtggaattccacaacattccaccaaactctgcaggatcccagagt
KF922438_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF922439_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363605_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363604_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363596_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363591_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363587_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363586_PreS2_P-E      atgcagtggaattccacaaaattccaccaagctctgcaggatcccagagt
HM363578_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363577_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363576_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363568_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
HM363567_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161832_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161817_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161816_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161815_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161812_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161801_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161794_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161790_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161799_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161805_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161818_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161821_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161829_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161786_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161782_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161792_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161814_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161771_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161763_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161777_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
DQ060830_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaagatcccagagt
AB274978_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB274976_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB274974_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB274969_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB194947_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580621_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580622_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580624_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580625_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580637_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580646_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580647_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MH580649_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB274971_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161772_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161781_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161787_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161791_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161793_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161800_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161819_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161827_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
GQ161830_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KX186584_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AM494696_PreS2_P-E      atacagtggaattccacaacattccaccaagctctgcaggatcccagagt
DQ060827_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
DQ060826_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
DQ060828_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
DQ060829_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
FN594763_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
DQ060823_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AB201289_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KT192626_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF849719_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF849722_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
MF772354_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KF849726_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
AY935700_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
FN594752_PreS2_P-E      atgcagtggaattccacaacattccaccaagctctgcaggatcccaaagt
                         *     ** * *       *** *   *   **  *       **   *

KF170787_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttcaggaacagtgaacc
GQ161775_PreS2_P-E      aagaggtcaggattttcctgctggtggctccagttccggaacagtgaacc
EU239220_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccgggacagtgaacc
FN594751_PreS2_P-E      aagaggccttcattyttccgctggtggctccagttccggaacagtgaacc
LT623843_PreS2_P-E      aagarrcctgwatcytcytgctggtggctccagttccggaacagtgaacc
LT623851_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB274984_PreS2_P-E      aaggggcctgcaattccctgctggtggctccagttccggaacagtgagcc
HM363608_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
KF170779_PreS2_P-E      aagag---------tccctgctggtggctccagttccggaacagtgaacc
AB219533_PreS2_P-E      aaaaaacctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494711_PreS2_P-E      aaggggcctgtat---cctgctggtggctccagttccggaacagtgaacc
AM494712_PreS2_P-E      aaggggcctgtat---cctgctggtggctccagttccggaacagtgaacc
FN594765_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF170751_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
AB205190_PreS2_P-E      aaggggcctgtttcttcctgctggtggctccagttccggaacagtgaacc
AB274973_PreS2_P-E      aagaggcctg------cctgctggtggctccagttccggaacagtgaacc
MF772355_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaamc
KM606738_PreS2_P-E      aagaggcctgaattttcctgctggtggctccagttccggaacagtgaacc
FN594766_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494691_PreS2_P-E      aaggggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
HM363600_PreS2_P-E      aacaggcctgtatcctcctgctggtggctccagttccggaacagtgaacc
AB915178_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
LT623844_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
KF849723_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161825_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KY498770_PreS2_P-E      aaraggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363572_PreS2_P-E      aagatgcctgtatcttcctgctggtggctccagttccggaacagtgaacc
HM363603_PreS2_P-E      acgaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
EU239221_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363593_PreS2_P-E      aagaggcctgtatcttcctgctggtggctctcattccggaacagtgaacc
HM363611_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
MF772357_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
JN604168_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtaaacc
HM363602_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF170750_PreS2_P-E      aagaggcctgtatctccctgctggtggctccagttccggaacagtgaacc
KF170782_PreS2_P-E      aagaggcctgtatctccctgctggtggctccagttccggaacagtgaacc
AM494714_PreS2_P-E      aagaggcctgtatcctcctgctggtggctccagttccggaacagtgaacc
MN507844_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KM108626_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KM108623_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161760_PreS2_P-E      aagaggcctgaattttcctgctggtggctccagttccggaacagtgaacc
FN594749_PreS2_P-E      aagaggcctgtattctcctgctggtggctccagttccggaacagtgaacc
FN545821_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
FN594762_PreS2_P-E      aggaggcctgtcttctcctgctggtggctccagttccggaacagtgaacc
FN594761_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
LT623847_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
HM363565_PreS2_P-E      aaggggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363588_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363589_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363601_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtaaacc
MH464856_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736913_PreS2_P-E      aagaggcctgtatattcctgctggtggctccagttccggaacagtgaacc
KT749841_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
KM108610_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161820_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
FN594760_PreS2_P-E      aagaggcctgtmttttcctgctggtggctccagttccggaacagtgaacc
FN594750_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580645_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF170790_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccgaaacagtgaacc
KF170783_PreS2_P-E      gagcgccctgtatctccctgctggtggctccagttccggaacagtgaacc
JN604235_PreS2_P-E      cagaggcctgtattttcctgctggtggctgcagttccggaacagtaaacc
EU239222_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
EU239224_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363595_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494703_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
MN507841_PreS2_P-E      aaaaaacctgtattttcctgctggtggctccagttccggaacagtgaacc
MN507846_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB194948_PreS2_P-E      aagaggcctgtatcgtcctgctggtggctccagttccggaacagtgaacc
LT623845_PreS2_P-E      aagaggcctgtattatcctgctggtggctccagttccggaacagtgaacc
LT623842_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
KM108622_PreS2_P-E      aagaggcctctatcttcctgctggtggctccagttccggaacagtgaacc
KF170753_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
HM363599_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
HM363566_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161768_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
GQ161757_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
AB274980_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB106564_PreS2_C-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB205129_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgagcc
AB205192_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgagcc
KM606739_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
HM363606_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
FN545822_PreS2_P-E      aaaaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
AM494695_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
AB274975_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtaaacc
GQ161823_PreS2_P-E      aaaaggc---------cctgctggtggctccagttccggaacagtgaacc
KM108625_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
KF849720_PreS2_P-E      aagaggcctgtat---cctgctggtggctccagttccggaacagtgaacc
MN507847_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580638_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MN507845_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
LT623849_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KF849725_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttcaggaacagtgaacc
KF849717_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccgggacagtaaacc
KF849715_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363609_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363607_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161776_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161784_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161789_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161828_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161758_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161766_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161774_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
FN594756_PreS2_P-E      aacaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494692_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
AB274970_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgagcc
AB091256_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AY738147_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AY738146_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AY738144_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AY738145_PreS2_C-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KM108624_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363610_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttcaggaaaagtgaacc
FN545842_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
FN545823_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
AB274979_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
AB274985_PreS2_P-E      aagaggcctg------cctgctggtggctccagttccggaacagtgaacc
HM363590_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363592_PreS2_P-E      aagaggcctatattttcctgctggtggctccagttccggaacagtgaacc
AY739674_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AY739675_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MN507840_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580630_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MF772360_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
KF170789_PreS2_P-E      aagaggcctgtatttccctgctggtggctccagttccggaacagtgaacc
JQ000009_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
JN604166_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363598_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363594_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtaaacc
GQ161836_PreS2_P-E      aaaaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
GQ161834_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
GQ161773_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161802_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
FN594748_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
FJ349226_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
EU239223_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
EU239219_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccgaaacagtgaacc
AM494697_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB915177_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB274981_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtaaacc
AB274977_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtaaacc
EU239226_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtaaacc
AM494709_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494705_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161797_PreS2_P-E      cagaggcccgtatcttcctgctggtggctccagttccggaacagtgaacc
EU159673_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161803_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494704_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
FJ349239_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB915175_PreS2_P-E      aagaaacctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161761_PreS2_P-E      gagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161807_PreS2_P-E      gagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363579_PreS2_P-E      aagaggcctgtatttccctgctggtggctccagttccggaacagtgaacc
HM363581_PreS2_P-E      aagaggcctgtatttccctgctggtggctccagttccggaacagtgaacc
HM363580_PreS2_P-E      aagaggcctgtatttccctgctggtggctccagttccggaacagtgaacc
KU736896_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB201287_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736895_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MN507842_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580634_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580635_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580636_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
LT623848_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736901_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736899_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagtttcggaacagtgaacc
KF849721_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF849716_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF849714_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF849713_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF170785_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF170742_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
JQ000008_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363597_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363584_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363574_PreS2_P-E      aagaggtctgtattttcctgctggtggctccagttccggaacagtaaacc
HM363573_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161822_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
GQ161811_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
GQ161798_PreS2_P-E      acgaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161785_PreS2_P-E      aagaggcctgtatcctcctgctggtggctccagttccggaacagtgaacc
GQ161783_PreS2_P-E      aaaaggtctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161824_PreS2_P-E      aaaaggtctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161779_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161769_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161765_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161764_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161762_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
FN594759_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
FN594758_PreS2_P-E      aagaggcctgtmttttcctgctggtggctccagttccggaacagtgaacc
EU239218_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
EU239217_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtaaacc
DQ060822_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494710_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494706_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494699_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB274982_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB091255_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580650_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF170741_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363585_PreS2_P-E      aagaggcctgtcttttcctgctggtggctccagttccggaacagtgaacc
KF170784_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagtttcggaacagtgaacc
KU736891_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736892_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB915176_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494707_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB205191_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
FJ349237_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
FJ349238_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
LT623846_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
FN545841_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580614_PreS2_P-E      aagaggcctgta---tcctgctggtggctccagttccggaacagtgaacc
MH580615_PreS2_P-E      aagaggcctgta---tcctgctggtggctccagttccggaacagtgaacc
MH580616_PreS2_P-E      aagaggcctgta---tcctgctggtggctccagttccggaacagtgaacc
MH580618_PreS2_P-E      aagaggcctgta---tcctgctggtggctccagttccggaacagtgaacc
MH580619_PreS2_P-E      aagaggcctgta---tcctgctggtggctccagttccggaacagtgaacc
MH580620_PreS2_P-E      aagaggcctgta---tcctgctggtggctccagttccggaacagtgaacc
MH580623_PreS2_P-E      aagaggcctgta---tcctgctggtggctccagttccggaacagtgaacc
MH580651_PreS2_P-E      aagaggcctgta---tcctgctggtggctccagttccggaacagtgaacc
MH580644_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagcgaacc
MH580617_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580628_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736912_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736911_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736909_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736902_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736893_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF170788_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
X75657_PreS2_P-E        aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF170786_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363569_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494693_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494715_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736903_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494690_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494701_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494702_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494708_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494713_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494717_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363570_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363571_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736900_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736904_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736905_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736906_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736907_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736908_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736910_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580640_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580641_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MK321264_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MK720631_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MK720632_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161755_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagtttcggaacagtgaacc
GQ161835_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagtttcggaacagtgaacc
AB201288_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161780_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KR139749_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH464855_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MN507848_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
LT623850_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HQ700550_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
DQ060824_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
DQ060825_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF849724_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB205189_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HQ700552_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF849718_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363583_PreS2_P-E      aaaaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363582_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161770_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MF772362_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161778_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161810_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161804_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161808_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494694_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494700_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363575_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161833_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580648_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB201290_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF849727_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161759_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736894_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MN507843_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH918655_PreS2_P-E      aagaggtctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580631_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580632_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580652_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580629_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736897_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KU736898_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF922438_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF922439_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363605_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
HM363604_PreS2_P-E      aagaggtctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363596_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
HM363591_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363587_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363586_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363578_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
HM363577_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363576_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363568_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
HM363567_PreS2_P-E      aagaggcctggattttcctgctggtggctccagttccggaacagtgaacc
GQ161832_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161817_PreS2_P-E      aagaggcctgtattttcctgttggtggctccagttccggaacagtgaacc
GQ161816_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161815_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161812_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgagcc
GQ161801_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161794_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161790_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161799_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161805_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161818_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161821_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161829_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161786_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161782_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgagcc
GQ161792_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgagcc
GQ161814_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgagcc
GQ161771_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161763_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161777_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
DQ060830_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB274978_PreS2_P-E      aacaggcctgtattttcctgctggtggctccagttccggaacagtaaacc
AB274976_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB274974_PreS2_P-E      aagaggcctgtattttcctgctggtggcttcagttccggaacagtgaacc
AB274969_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtaaacc
AB194947_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580621_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580622_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580624_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580625_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580637_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580646_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580647_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MH580649_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB274971_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161772_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161781_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161787_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161791_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161793_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161800_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161819_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161827_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
GQ161830_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KX186584_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AM494696_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
DQ060827_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
DQ060826_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
DQ060828_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
DQ060829_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
FN594763_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
DQ060823_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
AB201289_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KT192626_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF849719_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF849722_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
MF772354_PreS2_P-E      aagaggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KF849726_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
AY935700_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
FN594752_PreS2_P-E      aagaggcctgtatcttcctgctggtggctccagttccggaacagtgaacc
                                           * ********    **  *  * **  *  *

KF170787_PreS2_P-E      ctgttccgactactgcctcactcacctcgtcaatcttctcgacgattggg
GQ161775_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
EU239220_PreS2_P-E      ctgttccgactactgcctcactcacctcgtcaatcttctcgaggattggg
FN594751_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
LT623843_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
LT623851_PreS2_P-E      ctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggg
AB274984_PreS2_P-E      ctgttccgactactgtctcacgcatctcgtcaatcttctcgaggattggg
HM363608_PreS2_P-E      ctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggg
KF170779_PreS2_P-E      ctgttccgactgctgcctcactcgtctcgtcaatcttctcgaggattggg
AB219533_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494711_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494712_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN594765_PreS2_P-E      ctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggg
KF170751_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB205190_PreS2_P-E      ctgttccgactactgcctcactcatctcatcaatcttctcgaggattggg
AB274973_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MF772355_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KM606738_PreS2_P-E      atgttccgactactgtctcactcatctcgtcaatcttctcgaggattggg
FN594766_PreS2_P-E      ctgttcggactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494691_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363600_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB915178_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
LT623844_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849723_PreS2_P-E      ctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggg
GQ161825_PreS2_P-E      ctgttccgactactgcatcactcatctcgtcaatcttctcgaggattggg
KY498770_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363572_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363603_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
EU239221_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363593_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363611_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MF772357_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
JN604168_PreS2_P-E      ctgttccgactactgyctcactcatctcgtcaatcttctcgaggattggg
HM363602_PreS2_P-E      ctgttccgactactgcctcacgcatctcgtcaatcttctcgaggattggg
KF170750_PreS2_P-E      ctgttccgactaccgcctcactcatctcgtcaatcttctcgaggattggg
KF170782_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494714_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MN507844_PreS2_P-E      ctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggg
KM108626_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KM108623_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161760_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN594749_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN545821_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN594762_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN594761_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
LT623847_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363565_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363588_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363589_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363601_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH464856_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736913_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KT749841_PreS2_P-E      ctgttccgaatactgcctctctcatctcgtcaatcttctcgaggattggg
KM108610_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgacgattggg
GQ161820_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN594760_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN594750_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580645_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF170790_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF170783_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
JN604235_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
EU239222_PreS2_P-E      ctgttccgaccactgcctcactcatctcgtcaatcttctcgaggattggg
EU239224_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363595_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494703_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MN507841_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MN507846_PreS2_P-E      ctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggg
AB194948_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
LT623845_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
LT623842_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KM108622_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF170753_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363599_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363566_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161768_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161757_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB274980_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB106564_PreS2_C-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB205129_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB205192_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KM606739_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcgtctcgaggattggg
HM363606_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN545822_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494695_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB274975_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatctcctcgaggattggg
GQ161823_PreS2_P-E      ctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggg
KM108625_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849720_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MN507847_PreS2_P-E      ctgttccgactactgcctcactcgtatcgtcaatcttctcgaggattggg
MH580638_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MN507845_PreS2_P-E      ctgttccgactactgcctcactcacctcgtcaaccttctcgaggattggg
LT623849_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849725_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849717_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849715_PreS2_P-E      ctgttccgactactgcctcactcatctcctcaatcttctcgaggactggg
HM363609_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363607_PreS2_P-E      ctgttccgactactgcatcactcatatcgtcaatcttctcgaggattggg
GQ161776_PreS2_P-E      ctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggg
GQ161784_PreS2_P-E      ctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggg
GQ161789_PreS2_P-E      ctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggg
GQ161828_PreS2_P-E      ctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggg
GQ161758_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161766_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161774_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN594756_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494692_PreS2_P-E      ctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggg
AB274970_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB091256_PreS2_P-E      ctgttccgactactgtctctctcatctcgtcaatcttctcgaggactggg
AY738147_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AY738146_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AY738144_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AY738145_PreS2_C-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KM108624_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatattctcgaggattggg
HM363610_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN545842_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN545823_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB274979_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB274985_PreS2_P-E      ctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggg
HM363590_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363592_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AY739674_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AY739675_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MN507840_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580630_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MF772360_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF170789_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
JQ000009_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
JN604166_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363598_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363594_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161836_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgacgattggg
GQ161834_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161773_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161802_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN594748_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FJ349226_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctccaggattggg
EU239223_PreS2_P-E      ctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggg
EU239219_PreS2_P-E      ctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggg
AM494697_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB915177_PreS2_P-E      ctgttccgaatactgcctcactcatctcgtcaatcttctcgaggattggg
AB274981_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB274977_PreS2_P-E      ctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggg
EU239226_PreS2_P-E      ctgttccgactactgcctcactcatctcgccaatcttctcgaggattggg
AM494709_PreS2_P-E      ctgttccgaccactgcctcactcatctcgtcaatcttctcgaggattggg
AM494705_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161797_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
EU159673_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161803_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaaccttctcgaggattggg
AM494704_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FJ349239_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB915175_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161761_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161807_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363579_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363581_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363580_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736896_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB201287_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736895_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MN507842_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580634_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580635_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580636_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
LT623848_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736901_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736899_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849721_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849716_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849714_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849713_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF170785_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF170742_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
JQ000008_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363597_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363584_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363574_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363573_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161822_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161811_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161798_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161785_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161783_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161824_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161779_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161769_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161765_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161764_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161762_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN594759_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN594758_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
EU239218_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
EU239217_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
DQ060822_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494710_PreS2_P-E      ctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggg
AM494706_PreS2_P-E      ctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggg
AM494699_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB274982_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB091255_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580650_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF170741_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363585_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF170784_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736891_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736892_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB915176_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494707_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB205191_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FJ349237_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FJ349238_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
LT623846_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN545841_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580614_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580615_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580616_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580618_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580619_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580620_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580623_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580651_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580644_PreS2_P-E      ctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggg
MH580617_PreS2_P-E      ctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggg
MH580628_PreS2_P-E      ctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggg
KU736912_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736911_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736909_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736902_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736893_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF170788_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
X75657_PreS2_P-E        ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF170786_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363569_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494693_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494715_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736903_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494690_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494701_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494702_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494708_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494713_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494717_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363570_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363571_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736900_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736904_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736905_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736906_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736907_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736908_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736910_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580640_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580641_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MK321264_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MK720631_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MK720632_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161755_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161835_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB201288_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161780_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KR139749_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH464855_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MN507848_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
LT623850_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HQ700550_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
DQ060824_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
DQ060825_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849724_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB205189_PreS2_P-E      ctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggg
HQ700552_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849718_PreS2_P-E      ctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggg
HM363583_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363582_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161770_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MF772362_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161778_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161810_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161804_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161808_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494694_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggawtggg
AM494700_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363575_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161833_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580648_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB201290_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849727_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161759_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736894_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MN507843_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH918655_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580631_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580632_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580652_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580629_PreS2_P-E      ctgttccgacttctgcctcactcatctcgtcaatcttctcgaggattggg
KU736897_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KU736898_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF922438_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF922439_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363605_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363604_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363596_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363591_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363587_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaagattggg
HM363586_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363578_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363577_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363576_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363568_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
HM363567_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161832_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161817_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161816_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161815_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161812_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161801_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161794_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161790_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161799_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161805_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161818_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161821_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161829_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161786_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161782_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161792_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161814_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161771_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161763_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161777_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
DQ060830_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB274978_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB274976_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB274974_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB274969_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB194947_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580621_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580622_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580624_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580625_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580637_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580646_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580647_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MH580649_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB274971_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161772_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161781_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161787_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161791_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161793_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161800_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161819_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161827_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
GQ161830_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KX186584_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AM494696_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
DQ060827_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
DQ060826_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
DQ060828_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
DQ060829_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN594763_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
DQ060823_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AB201289_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KT192626_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849719_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849722_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
MF772354_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
KF849726_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
AY935700_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN594752_PreS2_P-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
                         ***** **   * *  ** * *   **  ***    *** * ** ****

KF170787_PreS2_P-E      gaccttgtaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161775_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
EU239220_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FN594751_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggactcctaggacccct
LT623843_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccct
LT623851_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB274984_PreS2_P-E      gaccttgcaccgaacatggaaaacatcacatcaggattcctaggacccct
HM363608_PreS2_P-E      gaccctgcaccgaacatggaaagcattacatcaggattcctaggacccct
KF170779_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB219533_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494711_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494712_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcarrattcctaggacccct
FN594765_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggactcctaggacccct
KF170751_PreS2_P-E      gaccctgcaccsaacatggaaagcatcacatcaggattcctaggacccct
AB205190_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB274973_PreS2_P-E      gaccatgcaccgaacatggaaaacatcacatcaggattcctaggacccct
MF772355_PreS2_P-E      gaccttgtaccgaacatggagagcatcacatcaggattcctaggacccct
KM606738_PreS2_P-E      gaccttgcaccgaacatggaaagcattacatcaggattcctaggacccct
FN594766_PreS2_P-E      gaccctgcaccgaacatggaaagcaccacatcaggattcctaggacccct
AM494691_PreS2_P-E      gaccctgcaccgaacatggagagcatcacatcaggattcctcggacccct
HM363600_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB915178_PreS2_P-E      gaccttgcaccgaacatggagagcatcacatcaggattcctaggacccct
LT623844_PreS2_P-E      gaccytgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF849723_PreS2_P-E      gaccctgcaccgaacatggaaagcattacatcaggattcctaggacccct
GQ161825_PreS2_P-E      gaccttgcaccgaacatggaaggcatcacatcaggattcctaggacccct
KY498770_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaagattcctaggacccct
HM363572_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaagattcctaggacccct
HM363603_PreS2_P-E      gaccctgcaccgaacatggaaaccatcacatcaggattcctaggacccct
EU239221_PreS2_P-E      gaccctgcaccgaacatggcaggcatcacatcaggattcctaggacccct
HM363593_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363611_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
MF772357_PreS2_P-E      gaccttgcatcgaacatggaaagcatcacatcaggattcctaggacccct
JN604168_PreS2_P-E      gaccctgcaccgaacatggagagcatcacatcaggattcctaggacccct
HM363602_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF170750_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF170782_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494714_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaagattcctaggacccct
MN507844_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KM108626_PreS2_P-E      gaccctgcaccgaacatggacagcatcacatcaggattcctaggacccct
KM108623_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
GQ161760_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FN594749_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
FN545821_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FN594762_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FN594761_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggattcctaagacccct
LT623847_PreS2_P-E      gaccttgcaccgaacatggaaaacatyacatcaggattcctaggacccct
HM363565_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363588_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacgtcaggattcctaggacccct
HM363589_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacgtcaggattcctaggacccct
HM363601_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacgtcaggattcctaggacccct
MH464856_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736913_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KT749841_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KM108610_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161820_PreS2_P-E      gaccctgcaccgaacatggaargcatcacatcaggattcctaggacccct
FN594760_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FN594750_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatccggattcctaggacccct
MH580645_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF170790_PreS2_P-E      gaccctgcaccgaacatggagagcatcacatcaggattcctaggacccct
KF170783_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
JN604235_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
EU239222_PreS2_P-E      gaccttgcaccgaacatggaaaacatcacatcaggattcctaggacccct
EU239224_PreS2_P-E      gaccctgcaccgaacatggaaagcattacatcaggactcctaggacccct
HM363595_PreS2_P-E      gaccctgcacagaacatggaaagcatcacatcaggattcctaggacccct
AM494703_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MN507841_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MN507846_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctacaacccct
AB194948_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
LT623845_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
LT623842_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KM108622_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF170753_PreS2_P-E      gaccctgcaccgaacatggagagcatcacatcaggattcctaggacccct
HM363599_PreS2_P-E      gaccatgcaccgaacatggaaggcatcacatcaggattcctaggacccct
HM363566_PreS2_P-E      gaccttgcactgaacatggaaagcatcacatcaggattcctaggacccct
GQ161768_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161757_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaagattcctaggacccct
AB274980_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctcggacccct
AB106564_PreS2_C-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB205129_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctgggacccct
AB205192_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KM606739_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363606_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatccggattcctaggacccct
FN545822_PreS2_P-E      gaccttgcaccgaacatggaaaacatcacatcaggattcctaggacccct
AM494695_PreS2_P-E      gaccctgcaccgaatatggaaagcatcacatcaggattcctaggacccct
AB274975_PreS2_P-E      gaccctgtaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161823_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KM108625_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF849720_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MN507847_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
MH580638_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MN507845_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
LT623849_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF849725_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
KF849717_PreS2_P-E      gaccctgcaccgaaaatggaaagcatcacatcaggattcctaggacccct
KF849715_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
HM363609_PreS2_P-E      gaccctgcaccgaacatggaaagcaccacatccggattcctaggacccct
HM363607_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161776_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161784_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161789_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161828_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161758_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
GQ161766_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
GQ161774_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
FN594756_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494692_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB274970_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
AB091256_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
AY738147_PreS2_P-E      gaccctgcaccgaacatggacagcatcacatcaggattcctaggacccct
AY738146_PreS2_P-E      gaccctgcaccgaacatggacagcatcacatcaggattcctaggacccct
AY738144_PreS2_P-E      gaccctgcaccgaacatggacagcatcacatcaggattcctaggacccct
AY738145_PreS2_C-E      gaccctgcaccgaacatggacagcatcacatcaggattcctaggacccct
KM108624_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363610_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FN545842_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FN545823_PreS2_P-E      ggccttgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB274979_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
AB274985_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363590_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363592_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
AY739674_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AY739675_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MN507840_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580630_PreS2_P-E      gaccctgcgccgaacatggaaagcatcacatcaggattcctaggacccct
MF772360_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF170789_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
JQ000009_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
JN604166_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363598_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363594_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161836_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161834_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161773_PreS2_P-E      gaccctgctccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161802_PreS2_P-E      gaccctgctccgaacatggaaagcatcacatcaggattcctaggacccct
FN594748_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FJ349226_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
EU239223_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
EU239219_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494697_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB915177_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB274981_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB274977_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
EU239226_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494709_PreS2_P-E      gaccctgcactgaacatggaaagcatcacatcaggattcctaggacccct
AM494705_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctcggacccct
GQ161797_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
EU159673_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161803_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494704_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FJ349239_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB915175_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161761_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161807_PreS2_P-E      gaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363579_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
HM363581_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
HM363580_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
KU736896_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB201287_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736895_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MN507842_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580634_PreS2_P-E      gaccctgcacggaacatggaaagcatcacatcaggattcctaggacccct
MH580635_PreS2_P-E      gaccctgcacggaacatggaaagcatcacatcaggattcctaggacccct
MH580636_PreS2_P-E      gaccctgcacggaacatggaaagcatcacatcaggattcctaggacccct
LT623848_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736901_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736899_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF849721_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF849716_PreS2_P-E      gaccctgcaccgaacatggacagcatcacatcaggattcctaggacccct
KF849714_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
KF849713_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
KF170785_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF170742_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
JQ000008_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363597_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363584_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363574_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363573_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161822_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161811_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
GQ161798_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161785_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161783_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161824_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161779_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
GQ161769_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161765_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161764_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161762_PreS2_P-E      gaccctgcacagaacatggaaagcatcacatcaggattcctaggacccct
FN594759_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FN594758_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
EU239218_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
EU239217_PreS2_P-E      gaccctgcaccgagcatggaaagcatcacatcaggattcctaggacccct
DQ060822_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494710_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494706_PreS2_P-E      gaccctgcaccgaacatggaargcatcacatcaggattcctaggacccct
AM494699_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB274982_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB091255_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
MH580650_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF170741_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363585_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF170784_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736891_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736892_PreS2_P-E      gaccytgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB915176_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494707_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB205191_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
FJ349237_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FJ349238_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
LT623846_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FN545841_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580614_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580615_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580616_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580618_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580619_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580620_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580623_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580651_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580644_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580617_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580628_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736912_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736911_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736909_PreS2_P-E      gaccytgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736902_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736893_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF170788_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
X75657_PreS2_P-E        gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF170786_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363569_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494693_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494715_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736903_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494690_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494701_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494702_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494708_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494713_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494717_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363570_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363571_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736900_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736904_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736905_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736906_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736907_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736908_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736910_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580640_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580641_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MK321264_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MK720631_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MK720632_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161755_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
GQ161835_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
AB201288_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
GQ161780_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
KR139749_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
MH464855_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
MN507848_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
LT623850_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
HQ700550_PreS2_P-E      gaccctgcaccgaacatcgaaggcatcacatcaggattcctaggacccct
DQ060824_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
DQ060825_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
KF849724_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
AB205189_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
HQ700552_PreS2_P-E      gaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccct
KF849718_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363583_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363582_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161770_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MF772362_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161778_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161810_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161804_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161808_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494694_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494700_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363575_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161833_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580648_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB201290_PreS2_P-E      gaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccct
KF849727_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161759_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736894_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MN507843_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH918655_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580631_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580632_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580652_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580629_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736897_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KU736898_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF922438_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF922439_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363605_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363604_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363596_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363591_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363587_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363586_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363578_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363577_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363576_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363568_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
HM363567_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161832_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161817_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161816_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161815_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161812_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161801_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161794_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161790_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161799_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161805_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161818_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161821_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161829_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161786_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161782_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161792_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161814_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161771_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161763_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161777_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
DQ060830_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB274978_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB274976_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB274974_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB274969_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB194947_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580621_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580622_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580624_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580625_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580637_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580646_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580647_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MH580649_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB274971_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161772_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161781_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161787_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161791_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161793_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161800_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161819_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161827_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
GQ161830_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KX186584_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AM494696_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
DQ060827_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
DQ060826_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
DQ060828_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
DQ060829_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FN594763_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
DQ060823_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AB201289_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KT192626_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF849719_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF849722_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
MF772354_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
KF849726_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
AY935700_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FN594752_PreS2_P-E      gaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccct
                        * ** **     *  ** *    **  ** **   * ****   ******

KF170787_PreS2_P-E      gctcgtgttacaggaggggttttccttgttgacaaaaatcctcacaatac
GQ161775_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
EU239220_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN594751_PreS2_P-E      gcccgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
LT623843_PreS2_P-E      gctcgtattacaggaggggtttttctygttgacaaaaatcctcacaatac
LT623851_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274984_PreS2_P-E      gcgcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363608_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF170779_PreS2_P-E      gctcgtgttgcaggcggggtttttcttgttgacaaaaatcctcacaatac
AB219533_PreS2_P-E      gctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494711_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494712_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN594765_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF170751_PreS2_P-E      gctcgtgttacaggcggggttttccttgttgacaaaaatcctcacaatac
AB205190_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274973_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MF772355_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KM606738_PreS2_P-E      gctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatac
FN594766_PreS2_P-E      gcacgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494691_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363600_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB915178_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
LT623844_PreS2_P-E      gctcgtgttacaggmggggtttttcttgttgacaaaaatcctcacaatac
KF849723_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161825_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcaaaatac
KY498770_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363572_PreS2_P-E      gctcgtgttacaggcggggtttttctcgttgacaaaaaccctcacaatac
HM363603_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
EU239221_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363593_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363611_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MF772357_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
JN604168_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363602_PreS2_P-E      gctcgcgttacaggcggggtttttctcgttgataaaaatcctcacaatac
KF170750_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF170782_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494714_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MN507844_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KM108626_PreS2_P-E      gctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatac
KM108623_PreS2_P-E      gctcgtgttacaggcggggttttccttgttgacaaaaatcctcacaatac
GQ161760_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN594749_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN545821_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN594762_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN594761_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
LT623847_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363565_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaattc
HM363588_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363589_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363601_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH464856_PreS2_P-E      gctcgcgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736913_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KT749841_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KM108610_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161820_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN594760_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN594750_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580645_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF170790_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF170783_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
JN604235_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
EU239222_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
EU239224_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363595_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494703_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MN507841_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MN507846_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB194948_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
LT623845_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
LT623842_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KM108622_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF170753_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363599_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363566_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161768_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161757_PreS2_P-E      gctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274980_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB106564_PreS2_C-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB205129_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB205192_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KM606739_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363606_PreS2_P-E      gctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN545822_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494695_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274975_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161823_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KM108625_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849720_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MN507847_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580638_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MN507845_PreS2_P-E      gcacgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
LT623849_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849725_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849717_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849715_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363609_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363607_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161776_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161784_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161789_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161828_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161758_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161766_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161774_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN594756_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494692_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274970_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB091256_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AY738147_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AY738146_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AY738144_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AY738145_PreS2_C-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KM108624_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363610_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN545842_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN545823_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274979_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274985_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363590_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363592_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AY739674_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AY739675_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MN507840_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580630_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MF772360_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF170789_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
JQ000009_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
JN604166_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363598_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363594_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161836_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgataaaaatcctcacaatac
GQ161834_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161773_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161802_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN594748_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FJ349226_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
EU239223_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
EU239219_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494697_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB915177_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274981_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274977_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
EU239226_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494709_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494705_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161797_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
EU159673_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161803_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494704_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FJ349239_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB915175_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161761_PreS2_P-E      gctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatac
GQ161807_PreS2_P-E      gctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatac
HM363579_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363581_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363580_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736896_PreS2_P-E      gctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB201287_PreS2_P-E      gctcgcattacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736895_PreS2_P-E      gctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatac
MN507842_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580634_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580635_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580636_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
LT623848_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736901_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736899_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849721_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849716_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849714_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849713_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF170785_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF170742_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
JQ000008_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363597_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaattc
HM363584_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363574_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363573_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161822_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161811_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161798_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161785_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161783_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161824_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161779_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161769_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161765_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161764_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161762_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN594759_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN594758_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
EU239218_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
EU239217_PreS2_P-E      gctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatac
DQ060822_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494710_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494706_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494699_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274982_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB091255_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580650_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF170741_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363585_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF170784_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736891_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736892_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB915176_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494707_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB205191_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FJ349237_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FJ349238_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
LT623846_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN545841_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580614_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580615_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580616_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580618_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580619_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580620_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580623_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580651_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580644_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580617_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580628_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736912_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736911_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736909_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736902_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736893_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF170788_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
X75657_PreS2_P-E        gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF170786_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363569_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494693_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494715_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736903_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494690_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494701_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494702_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494708_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494713_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494717_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363570_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363571_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736900_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736904_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736905_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736906_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736907_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736908_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736910_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580640_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580641_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MK321264_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MK720631_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MK720632_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161755_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161835_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB201288_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161780_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KR139749_PreS2_P-E      gctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH464855_PreS2_P-E      gctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatac
MN507848_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
LT623850_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HQ700550_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
DQ060824_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
DQ060825_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849724_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB205189_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HQ700552_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849718_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363583_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363582_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161770_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MF772362_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161778_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161810_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161804_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161808_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494694_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494700_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363575_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161833_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580648_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB201290_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849727_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161759_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736894_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MN507843_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH918655_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580631_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580632_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580652_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580629_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736897_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KU736898_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF922438_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF922439_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363605_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363604_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363596_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363591_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaattc
HM363587_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363586_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363578_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363577_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363576_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363568_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
HM363567_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161832_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161817_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161816_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161815_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161812_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161801_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161794_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161790_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161799_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161805_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161818_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161821_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161829_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161786_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161782_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161792_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161814_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161771_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161763_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161777_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
DQ060830_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274978_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274976_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274974_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274969_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB194947_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580621_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580622_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580624_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580625_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580637_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580646_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580647_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MH580649_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB274971_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161772_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161781_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161787_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161791_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161793_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161800_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161819_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161827_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
GQ161830_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KX186584_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AM494696_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
DQ060827_PreS2_P-E      gctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatac
DQ060826_PreS2_P-E      gctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatac
DQ060828_PreS2_P-E      gctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatac
DQ060829_PreS2_P-E      gctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatac
FN594763_PreS2_P-E      gctcgtgttacaggcggggttttccttgttgacaaaaatcctcacaatac
DQ060823_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AB201289_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KT192626_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849719_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849722_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
MF772354_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
KF849726_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
AY935700_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
FN594752_PreS2_P-E      gctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatac
                        ** **  ** **** *** **** ** ***** ***** ***** *** *

KF170787_PreS2_P-E      cacagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161775_PreS2_P-E      cgcagagtctagactcgtggtggacttcyctcaattttctagggggagct
EU239220_PreS2_P-E      cgcagaatctagactcgtggtggacttctctcagttttctagggggagct
FN594751_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
LT623843_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
LT623851_PreS2_P-E      cgcagaatctagactcgtggtggacttctctcagttttctaggggaagct
AB274984_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363608_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF170779_PreS2_P-E      cgcagagtctagacacgtggtggacttctctcaattttctagggggagct
AB219533_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494711_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctaggggaagct
AM494712_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctaggggaagct
FN594765_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF170751_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB205190_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274973_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MF772355_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KM606738_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctaggggaagct
FN594766_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctaggggaagct
AM494691_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363600_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcagttttctagggggagct
AB915178_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
LT623844_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcagttttctagggggagct
KF849723_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctaggggaagct
GQ161825_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KY498770_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagyt
HM363572_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363603_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
EU239221_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363593_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363611_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MF772357_PreS2_P-E      cacagagtctagactcgtggtggacttctctcaattttctagggggagct
JN604168_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363602_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF170750_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF170782_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494714_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MN507844_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KM108626_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KM108623_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161760_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN594749_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN545821_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN594762_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN594761_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
LT623847_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363565_PreS2_P-E      cgaagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363588_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363589_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363601_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH464856_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736913_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KT749841_PreS2_P-E      cacagagtctagactcgtggtggacttctctcaattttctagggggagct
KM108610_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcagttttctagggggagct
GQ161820_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN594760_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggggct
FN594750_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctaggggaagct
MH580645_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF170790_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF170783_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
JN604235_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctaggggaagct
EU239222_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
EU239224_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363595_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494703_PreS2_P-E      cgcagaatctagactcgtggtggacttctctcaattttctagggggagct
MN507841_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcagttttctagggggagct
MN507846_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB194948_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctaggggaagct
LT623845_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcarttttctagggggagct
LT623842_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcarttttctagggggagct
KM108622_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF170753_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363599_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363566_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161768_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctaggggaagct
GQ161757_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274980_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB106564_PreS2_C-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB205129_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB205192_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KM606739_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggatct
HM363606_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN545822_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggatct
AM494695_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274975_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161823_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KM108625_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF849720_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MN507847_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580638_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MN507845_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
LT623849_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF849725_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF849717_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF849715_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363609_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363607_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161776_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161784_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161789_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161828_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161758_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggaact
GQ161766_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggaact
GQ161774_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggaact
FN594756_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494692_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274970_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggatct
AB091256_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AY738147_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AY738146_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AY738144_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AY738145_PreS2_C-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KM108624_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363610_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN545842_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN545823_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274979_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274985_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggatct
HM363590_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363592_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AY739674_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AY739675_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MN507840_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580630_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MF772360_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggatct
KF170789_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
JQ000009_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
JN604166_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363598_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363594_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161836_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161834_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161773_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161802_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN594748_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FJ349226_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
EU239223_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
EU239219_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494697_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB915177_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274981_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274977_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
EU239226_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494709_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494705_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161797_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
EU159673_PreS2_P-E      cacagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161803_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494704_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FJ349239_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB915175_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161761_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161807_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363579_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggatct
HM363581_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggatct
HM363580_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggatct
KU736896_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB201287_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736895_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MN507842_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580634_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580635_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580636_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
LT623848_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736901_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736899_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF849721_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggatct
KF849716_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF849714_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF849713_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF170785_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF170742_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
JQ000008_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363597_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363584_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363574_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363573_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaatattctagggggagct
GQ161822_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161811_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161798_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161785_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161783_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161824_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161779_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161769_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161765_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161764_PreS2_P-E      cgcagaatctagactcgtggtggacttctctcaattttctagggggagct
GQ161762_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN594759_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN594758_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
EU239218_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtt
EU239217_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
DQ060822_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494710_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494706_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494699_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274982_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB091255_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580650_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF170741_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363585_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF170784_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736891_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736892_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB915176_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494707_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB205191_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FJ349237_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FJ349238_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
LT623846_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN545841_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580614_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580615_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580616_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580618_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580619_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580620_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580623_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580651_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580644_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580617_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580628_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736912_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736911_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736909_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736902_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736893_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF170788_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
X75657_PreS2_P-E        cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF170786_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363569_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494693_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494715_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736903_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494690_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494701_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494702_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494708_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494713_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494717_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363570_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363571_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736900_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736904_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736905_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736906_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736907_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736908_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736910_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580640_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580641_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MK321264_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MK720631_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MK720632_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161755_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161835_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB201288_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggatct
GQ161780_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KR139749_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH464855_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MN507848_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
LT623850_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HQ700550_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
DQ060824_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
DQ060825_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF849724_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB205189_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HQ700552_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF849718_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363583_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363582_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161770_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttgtagggggagct
MF772362_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161778_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161810_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161804_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161808_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494694_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494700_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363575_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161833_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580648_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB201290_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtt
KF849727_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtt
GQ161759_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736894_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MN507843_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH918655_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580631_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580632_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580652_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580629_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736897_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KU736898_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF922438_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF922439_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363605_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363604_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363596_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363591_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363587_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363586_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363578_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363577_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363576_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
HM363568_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagtt
HM363567_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161832_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161817_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161816_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggaact
GQ161815_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161812_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161801_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161794_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161790_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161799_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161805_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161818_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161821_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161829_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161786_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161782_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161792_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161814_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161771_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161763_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161777_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
DQ060830_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274978_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274976_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274974_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274969_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB194947_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580621_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580622_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580624_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580625_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580637_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580646_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580647_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MH580649_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB274971_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161772_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161781_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161787_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161791_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161793_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161800_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161819_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161827_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
GQ161830_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KX186584_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AM494696_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
DQ060827_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
DQ060826_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
DQ060828_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
DQ060829_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN594763_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
DQ060823_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AB201289_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KT192626_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF849719_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF849722_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
MF772354_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
KF849726_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
AY935700_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
FN594752_PreS2_P-E      cgcagagtctagactcgtggtggacttctctcaattttctagggggagct
                        *  *** ******* ************* **** * ** ******    *

KF170787_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
GQ161775_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcacc
EU239220_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
FN594751_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
LT623843_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaatctccaatcactcacc
LT623851_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB274984_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363608_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KF170779_PreS2_P-E      cccgggtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AB219533_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtcccaaatctccaatcactcacc
AM494711_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccagtcactcact
AM494712_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccagtcactcact
FN594765_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KF170751_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AB205190_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB274973_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MF772355_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KM606738_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
FN594766_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494691_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363600_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB915178_PreS2_P-E      cccgtgtgtcctggccaaaattcgcagtccccaacctccagtcactcacc
LT623844_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KF849723_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcact
GQ161825_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KY498770_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363572_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcacc
HM363603_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
EU239221_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363593_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363611_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MF772357_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagttcccaacctccaatcactcacc
JN604168_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363602_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KF170750_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KF170782_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494714_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MN507844_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KM108626_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KM108623_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
GQ161760_PreS2_P-E      cccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcact
FN594749_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
FN545821_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
FN594762_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcacc
FN594761_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
LT623847_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363565_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363588_PreS2_P-E      cccgtgtgtcttggccaaaatttgcagtccccaacctccaatcactcacc
HM363589_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363601_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH464856_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KU736913_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccagtcactcacc
KT749841_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcacc
KM108610_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
GQ161820_PreS2_P-E      cccgtgtgtcytggccaaaattcgcagtccccaacctccaatcactcacc
FN594760_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
FN594750_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaatctccaatcactcact
MH580645_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctgcaatcactcacc
KF170790_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KF170783_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
JN604235_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcacc
EU239222_PreS2_P-E      cccgtgtatcttggccaaaattcgcagtccccaacctccaatcactcacc
EU239224_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363595_PreS2_P-E      cccgggtgtcttggccaaaattcgcagtcccaaatctccaatcactcacc
AM494703_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MN507841_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MN507846_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB194948_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcacc
LT623845_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
LT623842_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KM108622_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccagtcactcacc
KF170753_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtcccaaacctccagtcactcacc
HM363599_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
HM363566_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
GQ161768_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161757_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcacc
AB274980_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB106564_PreS2_C-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB205129_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB205192_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KM606739_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363606_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
FN545822_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AM494695_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AB274975_PreS2_P-E      cccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcacc
GQ161823_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KM108625_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccagtcactcacc
KF849720_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
MN507847_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580638_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtcccaaatctccaatcactcacc
MN507845_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
LT623849_PreS2_P-E      cccgtgtgtcktggccaaaattcgcagtccccaacctccaatcactcacc
KF849725_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KF849717_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KF849715_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
HM363609_PreS2_P-E      cccgtgtgtcttggccaaaatttgcagtccccaatctccaatcactcacc
HM363607_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161776_PreS2_P-E      cccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcacc
GQ161784_PreS2_P-E      cccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcacc
GQ161789_PreS2_P-E      cccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcacc
GQ161828_PreS2_P-E      cccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcacc
GQ161758_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161766_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161774_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
FN594756_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AM494692_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AB274970_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB091256_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AY738147_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
AY738146_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
AY738144_PreS2_P-E      cccgtgtgtcttggccaaaattcgcggtccccaatctccaatcactcacc
AY738145_PreS2_C-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KM108624_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
HM363610_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
FN545842_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccagtcactcacc
FN545823_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcacc
AB274979_PreS2_P-E      cccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcacc
AB274985_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363590_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363592_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AY739674_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AY739675_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MN507840_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580630_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MF772360_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KF170789_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
JQ000009_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
JN604166_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
HM363598_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcacttacc
HM363594_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161836_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161834_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcacc
GQ161773_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161802_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
FN594748_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
FJ349226_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
EU239223_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
EU239219_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AM494697_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AB915177_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AB274981_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
AB274977_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
EU239226_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AM494709_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494705_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
GQ161797_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
EU159673_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
GQ161803_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcacc
AM494704_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccagtcactcacc
FJ349239_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB915175_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
GQ161761_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161807_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363579_PreS2_P-E      cccgtgtgtcttggccaaaatttgcagtccccaacctccaatcactcacc
HM363581_PreS2_P-E      cccgtgtgtcttggccaaaatttgcagtccccaacctccaatcactcacc
HM363580_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KU736896_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB201287_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KU736895_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MN507842_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580634_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580635_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580636_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
LT623848_PreS2_P-E      cccgtgtgtcktggccaaaattcgcagtccccaacctccaatcactcacc
KU736901_PreS2_P-E      cccgtgtgccttggccaaaattcgcagtccccaacctccagtcactcacc
KU736899_PreS2_P-E      cccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcacc
KF849721_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KF849716_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KF849714_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KF849713_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KF170785_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KF170742_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
JQ000008_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
HM363597_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363584_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363574_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363573_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161822_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcacc
GQ161811_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161798_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161785_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161783_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161824_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161779_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161769_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161765_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161764_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161762_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
FN594759_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
FN594758_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
EU239218_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
EU239217_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
DQ060822_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AM494710_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494706_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494699_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AB274982_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB091255_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580650_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KF170741_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
HM363585_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KF170784_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736891_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736892_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AB915176_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494707_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AB205191_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
FJ349237_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
FJ349238_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
LT623846_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
FN545841_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MH580614_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MH580615_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MH580616_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MH580618_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MH580619_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MH580620_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MH580623_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MH580651_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MH580644_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MH580617_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MH580628_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736912_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736911_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736909_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736902_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736893_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KF170788_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
X75657_PreS2_P-E        cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KF170786_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
HM363569_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494693_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494715_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736903_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494690_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494701_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494702_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494708_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494713_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
AM494717_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
HM363570_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
HM363571_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736900_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736904_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736905_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736906_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736907_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736908_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
KU736910_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MH580640_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MH580641_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MK321264_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MK720631_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
MK720632_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcacc
GQ161755_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161835_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB201288_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161780_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KR139749_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
MH464855_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
MN507848_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
LT623850_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HQ700550_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
DQ060824_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
DQ060825_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KF849724_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
AB205189_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HQ700552_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KF849718_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
HM363583_PreS2_P-E      cccgtgtgtcttggccaaaatttgcagtccccaacctccaatcactcacc
HM363582_PreS2_P-E      cccgtgtgtcttggccaaaatttgcagtccccaacctccaatcactcacc
GQ161770_PreS2_P-E      cccgtgtgtcttggccaaaatttgcagtccccaacctccaatcactcacc
MF772362_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161778_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161810_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161804_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161808_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AM494694_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AM494700_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363575_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161833_PreS2_P-E      cccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcacc
MH580648_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB201290_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KF849727_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
GQ161759_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KU736894_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MN507843_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH918655_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
MH580631_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580632_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580652_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580629_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KU736897_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KU736898_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KF922438_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KF922439_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
HM363605_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363604_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363596_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363591_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363587_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363586_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363578_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363577_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363576_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363568_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
HM363567_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161832_PreS2_P-E      cccgtatgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161817_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161816_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161815_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161812_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161801_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161794_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161790_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161799_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161805_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161818_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161821_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161829_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161786_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161782_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161792_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161814_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161771_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161763_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161777_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
DQ060830_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB274978_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB274976_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB274974_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB274969_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB194947_PreS2_P-E      cccgtgtgtcttggccaaaatttgcagtccccaacctccaatcactcacc
MH580621_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580622_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580624_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580625_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580637_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580646_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580647_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
MH580649_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AB274971_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161772_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161781_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161787_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161791_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161793_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161800_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161819_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161827_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
GQ161830_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
KX186584_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
AM494696_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
DQ060827_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
DQ060826_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
DQ060828_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
DQ060829_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
FN594763_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
DQ060823_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
AB201289_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KT192626_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KF849719_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KF849722_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
MF772354_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
KF849726_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
AY935700_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
FN594752_PreS2_P-E      cccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcacc
                        ****  *  * *********** ** ** ** ** ** ** ***** ** 

KF170787_PreS2_P-E      aacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
GQ161775_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
EU239220_PreS2_P-E      aacctcttgtcctcccatttgtcctggctatcgctggatgtgtctgcggc
FN594751_PreS2_P-E      aacctcttgtcctccaatttggcctggttatcgctggatgtgtctgcggc
LT623843_PreS2_P-E      aacctcttgtcctcmaatttgtcctggctatcgctggatgtgtctgcggc
LT623851_PreS2_P-E      aacctcttgtcctccaacttgtcctggctttcgctggatgtgtctgcggc
AB274984_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
HM363608_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtcggcggc
KF170779_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
AB219533_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
AM494711_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
AM494712_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
FN594765_PreS2_P-E      aacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
KF170751_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
AB205190_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
AB274973_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
MF772355_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
KM606738_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
FN594766_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
AM494691_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
HM363600_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
AB915178_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
LT623844_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
KF849723_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
GQ161825_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
KY498770_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
HM363572_PreS2_P-E      aatctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
HM363603_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
EU239221_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
HM363593_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
HM363611_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
MF772357_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
JN604168_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
HM363602_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
KF170750_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
KF170782_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
AM494714_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
MN507844_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
KM108626_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
KM108623_PreS2_P-E      aacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggc
GQ161760_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtatctgcggc
FN594749_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
FN545821_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgcttgatgtgtctgcggc
FN594762_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
FN594761_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
LT623847_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
HM363565_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
HM363588_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
HM363589_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
HM363601_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
MH464856_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
KU736913_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
KT749841_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
KM108610_PreS2_P-E      aacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
GQ161820_PreS2_P-E      aacctcttgtcctccaatttgtcctggct