HBVdb

Dataset for nucleotide sequence PreS1 of genotype E

[Download (right click)] [Edit] [Sequences] [Repertoires]

492 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


MW679682_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MZ962198_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MF772356_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MZ962195_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MZ962197_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF170787_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---gggaaagaatcagtc
LT623843_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161775_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MZ962192_PreS1_P-E      atggagctttcttggaacgtccctctcgaatc---ggggaagaatcattc
HM363602_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161760_PreS1_P-E      atggggctttcttggacggtcccactcgaatg---gggaaagaatcattc
FN594762_PreS1_P-E      atgggtctttcttggacggtccctctcgaatg---ggggaagaatcattc
MZ962193_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363572_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MN507844_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MW455162_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
JN604168_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161768_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB194948_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
EU239224_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcagtc
MW455163_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161762_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaattattc
MW455164_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363606_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
GQ161823_PreS1_P-E      atggggctttcttggacggtccctctagaatg---ggggaagaatcattc
LT623842_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN594756_PreS1_P-E      atgggactttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161796_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363594_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161834_PreS1_P-E      atggggctttcttggacggtccctctggaatg---ggggaagaatcattc
GQ161785_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcagtc
AB274977_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcaatc
GQ161820_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161807_PreS1_P-E      atggggctttcttggacggtccctctagaatg---ggggaagaatcattc
AB274985_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
MZ962194_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
MN507841_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MZ962191_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF170784_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161776_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161784_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161789_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161828_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FJ349239_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MN507842_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MN507843_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161836_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161761_PreS1_P-E      atggggctttcttggacggtccctctagaatg---ggggaagaatcattc
MW082636_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AY739674_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AY739675_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161803_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494696_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494694_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494700_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MZ962199_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363586_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB274982_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB274974_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161779_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161765_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161769_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MN507840_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736899_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736897_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
KU736898_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
GQ161830_PreS1_P-E      atggggctttcttggacggtccctctagaatg---ggggaagaatcattc
GQ161790_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161799_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161805_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161818_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161821_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161786_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB091255_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161816_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161759_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736894_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161822_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161817_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
GQ161798_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161794_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
GQ161771_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161770_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161764_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161763_PreS1_P-E      atggggctttcgtggacggtccctctcgaatg---ggggaagaatcattc
GQ161777_PreS1_P-E      atggggctttcgtggacggtccctctcgaatg---ggggaagaatcattc
FJ349237_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FJ349238_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB274976_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
GQ161801_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161833_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736896_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
KU736895_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
GQ161832_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161829_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161812_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161804_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161792_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161782_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161814_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161781_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161772_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB274971_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
GQ161787_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161791_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161793_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161800_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161819_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161827_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MF772355_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB219533_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KM606738_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF170750_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcagtc
KF170782_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN594761_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF849723_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
JN604166_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN594750_PreS1_P-E      atggggctttcttggaccgtccctctcgaatg---ggggaagaatcattc
HM363599_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH464856_PreS1_P-E      atggggctttcgtggacggtccctctcgaatgnnnggggaagaatcattc
KF849728_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
EU239221_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
EU239219_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
EU239223_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363598_PreS1_P-E      atggggctttcttggactgtccctctcgaatg---ggggaagaatcattc
FN594749_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF849720_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB219529_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494689_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AY738147_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AY738146_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AY738144_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AY738145_PreS1_C-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF849717_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN594748_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427114_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427115_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494692_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494697_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB091256_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494709_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494710_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427124_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580650_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494706_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427130_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427120_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427116_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427113_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427110_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427155_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427142_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427131_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427122_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427112_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattg
MT427143_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---gggaaagaatcattc
MT427123_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427152_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427157_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427134_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427133_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427144_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427139_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427118_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427136_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427192_PreS1_P-E      atggggctttcttggacggtccctctagaatg---ggggaagaatcattc
MT427190_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
MT427189_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427186_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427175_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427172_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427169_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427168_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427164_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427162_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427161_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427160_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427156_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427148_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427147_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427159_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427181_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427182_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427183_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427184_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427185_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427141_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427138_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427135_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427194_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427128_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427126_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427198_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427111_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427117_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427121_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427125_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427127_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427129_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427132_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427137_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427140_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427145_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427146_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427149_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427150_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427151_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427153_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427154_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427158_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427163_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427166_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427167_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427170_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427171_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427173_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427174_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427176_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427177_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427178_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427179_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427180_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427187_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427188_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427191_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427193_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427195_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427196_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427197_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427199_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427200_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427201_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427165_PreS1_P-E      gtggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT427119_PreS1_P-E      atgtggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF849725_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MT426115_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcatcc
HM363579_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363581_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363580_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB205189_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB205191_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF849715_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN594752_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
OM256457_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB201290_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF849724_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF849714_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
JQ000009_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KR139749_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH464855_PreS1_P-E      atggggctttcttggacggtccctctcgaatgnnnggggaagaatcattc
AB915175_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363578_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AY935700_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF849726_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MF772354_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF922438_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF922439_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN594763_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
DQ060823_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF170741_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB201289_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KT192626_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
DQ060825_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF849721_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
JQ000008_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF849718_PreS1_P-E      atggggctttcttggrcggtccctctcgaatg---ggggaagaatcattc
DQ060827_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
DQ060829_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
DQ060826_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
DQ060828_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
KF849716_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF849713_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
DQ060824_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF849719_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF849722_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494711_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcatgc
AM494712_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494714_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
EU239220_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatctttc
FN594765_PreS1_P-E      atggggctttcttggacggtccctctygaatg---ggggaagaatcattc
KF170780_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcagtc
KF170752_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
LT623851_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcaktc
KF170779_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN594751_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB205190_PreS1_P-E      atggggctttcttggactgtccctctcgaatg---ggggaagaatcattc
HM363608_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB915178_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcaatc
MF772358_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MZ962189_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB106564_PreS1_C-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN594766_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF170751_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161825_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KM108623_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494691_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcaatc
GQ161831_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB274973_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN545822_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KM108610_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MF772357_PreS1_P-E      atgggactttcttggacggtccctctcgaatg---ggggaagaatcattc
LT623844_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363603_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363600_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN545821_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB274979_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcagtc
KU736913_PreS1_P-E      atgggcctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363565_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcaatc
FN594760_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580626_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KT749841_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB274975_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MW455165_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
LT623847_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaaaaatcattc
HM363611_PreS1_P-E      atggggctttcttggacagtccctctcgaatg---ggggaagaatcagtc
HM363610_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcagtc
KF170790_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcagtc
HM363595_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN545823_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB274981_PreS1_P-E      atggggctttcttggacggtccctctcgagtg---ggggaagaatcattc
MW679683_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MN967526_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MN507846_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MZ962190_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MN507845_PreS1_P-E      atggggctttcttggacagtccctctcgaatg---ggggaagaatcattc
KM108626_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KM108625_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363566_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KM108622_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FJ349240_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
LT623845_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161757_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
EU239222_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
JN604235_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363609_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494703_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MN507847_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KM606739_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FJ349227_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MZ962196_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
LT623849_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363607_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB274980_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580648_PreS1_P-E      atgggactttcttggacggttcctctcgaatg---ggggaagaatcattc
MH580645_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF170783_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF170753_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494695_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161783_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161824_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161797_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB274970_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580638_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363593_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363591_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363597_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363601_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363588_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363589_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN594758_PreS1_P-E      atggggctttcmtggacggtccctctccaatg---ggggaagaatcattc
FN545842_PreS1_P-E      atgggactttcttggacggtccctctcgaatg---ggggaagaatcattc
EU239218_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
DQ060822_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB201288_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
EU239226_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
EU239217_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB274969_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB274978_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MN967527_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB205129_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB205192_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MN507848_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580631_PreS1_P-E      atggggctttcttggacggtccctctagaatg---ggggaagaattattc
MH580632_PreS1_P-E      atggggctttcttggacggtccctctagaatg---ggggaagaattattc
MH580652_PreS1_P-E      atggggctttcttggacggtccctctagaatg---ggggaagaattattc
GQ161773_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161802_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363605_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494705_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH918655_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN545827_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MF772362_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736893_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363590_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580621_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580625_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580622_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580637_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363573_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB194947_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580634_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580635_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580636_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580647_PreS1_P-E      atgggactttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580624_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580646_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580649_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580629_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363604_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363592_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN594759_PreS1_P-E      atggggctttcttggacggtccctctctcatg---ggggaagaatcattc
MH580630_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736901_PreS1_P-E      atggggctttcttggacagtccctctcgaatg---ggggaagaatcattc
KF170789_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363574_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161758_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161766_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161774_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161755_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161835_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FJ349226_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB915177_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HQ700550_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HQ700552_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KM108624_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363583_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363584_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363575_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363576_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MF772360_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF170785_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161815_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF170786_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363587_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363582_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161811_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494699_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363585_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580614_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580615_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580616_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580618_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580619_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580620_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580623_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580651_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161778_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161810_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161808_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494704_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736891_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736892_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AB201287_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
X75657_PreS1_P-E        atggggctttcttggacggtccctctcgaatg---ggggaagaatatttc
MN967529_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MN967528_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580644_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580640_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580641_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580617_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MH580628_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
LT623850_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
LT623848_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
LT623846_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736911_PreS1_P-E      atggggctttcgtggacggtccctctcgaatg---ggggaagaatcattc
KU736909_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736904_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736902_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF170788_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KF170742_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363596_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363577_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
DQ060830_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
FN545841_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MW455161_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363568_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363567_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
GQ161780_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KX186584_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363569_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363570_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
HM363571_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736912_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736910_PreS1_P-E      atggggctttcgtggacggtccctctcgaatg---ggggaagaatcattc
KU736906_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736903_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494715_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494713_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494707_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494702_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494701_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494693_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494690_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494708_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
AM494717_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736900_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736905_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736907_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
KU736908_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MK321264_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MK720631_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
MK720632_PreS1_P-E      atggggctttcttggacggtccctctcgaatg---ggggaagaatcattc
                         **   ***** ***   ** ** **    *    *** ** ***     

MW679682_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MZ962198_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MF772356_PreS1_P-E      cactaccaatcctttgggagtttttcccgaccaccagttggatccagcat
MZ962195_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MZ962197_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170787_PreS1_P-E      cactaccaatcctctgggattttttcccgaccaccagttggatccagcat
LT623843_PreS1_P-E      caccwccaatccgctgggaktttttcccgaccaccagttggatccagcat
GQ161775_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MZ962192_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363602_PreS1_P-E      cactaccaatcctctggggtttttacccgaccaccagttggatccagcat
GQ161760_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
FN594762_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MZ962193_PreS1_P-E      caccaccattcctcctggcatttttcccgaccaccagttggatccagcat
HM363572_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MN507844_PreS1_P-E      cacctccaatcctctgggattttttcccgaccaccagttggatccagcat
MW455162_PreS1_P-E      cacctccaatcctctgggattttttcccgaccaccagttggatccagcat
JN604168_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161768_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB194948_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
EU239224_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MW455163_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161762_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MW455164_PreS1_P-E      cacctccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363606_PreS1_P-E      cacctccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161823_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
LT623842_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FN594756_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161796_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363594_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggacccagcat
GQ161834_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161785_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB274977_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161820_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161807_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB274985_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MZ962194_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MN507841_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MZ962191_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170784_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161776_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161784_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161789_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161828_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FJ349239_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MN507842_PreS1_P-E      cacctccaatcctctgggattttttcccgaccaccagttggatccagcat
MN507843_PreS1_P-E      cacctccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161836_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161761_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MW082636_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AY739674_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AY739675_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161803_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494696_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494694_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494700_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MZ962199_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363586_PreS1_P-E      cactaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB274982_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB274974_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161779_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161765_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161769_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MN507840_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736899_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736897_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
KU736898_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
GQ161830_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161790_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161799_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161805_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161818_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161821_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161786_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB091255_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161816_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161759_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736894_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161822_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161817_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161798_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161794_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161771_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161770_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161764_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161763_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161777_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FJ349237_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FJ349238_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB274976_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161801_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161833_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736896_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736895_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161832_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161829_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161812_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161804_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161792_PreS1_P-E      caccaccaatcatctgggattttttcccgaccaccagttggatccagcat
GQ161782_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161814_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161781_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161772_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB274971_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161787_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161791_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161793_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161800_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161819_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161827_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MF772355_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB219533_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KM606738_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170750_PreS1_P-E      caccaccaatcctctgggatttcttcccgaccaccagttggatccagcat
KF170782_PreS1_P-E      caccaccaatcctctgggatttcttcccgaccaccagttggatccagcat
FN594761_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849723_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
JN604166_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FN594750_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363599_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH464856_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849728_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
EU239221_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
EU239219_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
EU239223_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363598_PreS1_P-E      caccaccaatcctctgggattttttcccgaccatcagttggatccagcat
FN594749_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849720_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB219529_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494689_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AY738147_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AY738146_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AY738144_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AY738145_PreS1_C-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849717_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FN594748_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427114_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427115_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494692_PreS1_P-E      caccaccaatcctctgggatttcttcccgaccaccagttggatccagcat
AM494697_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
AB091256_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494709_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494710_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427124_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580650_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494706_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427130_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427120_PreS1_P-E      caccaccgatcctctgggattttttcccgaccaccagttggatccagcat
MT427116_PreS1_P-E      caccaccaatcctctgggagtttttcccgaccaccagttggatccagcat
MT427113_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427110_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagtgggatccagcat
MT427155_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427142_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427131_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427122_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagtcggatccagcat
MT427112_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427143_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427123_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427152_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427157_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427134_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427133_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427144_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427139_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427118_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427136_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427192_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427190_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427189_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427186_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427175_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427172_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427169_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427168_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427164_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427162_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427161_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427160_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427156_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427148_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427147_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427159_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427181_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427182_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427183_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427184_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427185_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427141_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427138_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427135_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427194_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427128_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427126_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427198_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427111_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427117_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427121_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427125_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427127_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427129_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427132_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427137_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427140_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427145_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427146_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427149_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427150_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427151_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427153_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427154_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427158_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427163_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427166_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427167_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427170_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427171_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427173_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427174_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427176_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427177_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427178_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427179_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427180_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427187_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427188_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427191_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427193_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427195_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427196_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427197_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427199_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427200_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427201_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427165_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT427119_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849725_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MT426115_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363579_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363581_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363580_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB205189_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB205191_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849715_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FN594752_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
OM256457_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB201290_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849724_PreS1_P-E      caccaccaatcctctgggattttttcccgaccatcagttggatccagcat
KF849714_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
JQ000009_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KR139749_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH464855_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB915175_PreS1_P-E      cacctccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363578_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AY935700_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849726_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MF772354_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF922438_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF922439_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FN594763_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
DQ060823_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170741_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB201289_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KT192626_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
DQ060825_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849721_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
JQ000008_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849718_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
DQ060827_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
DQ060829_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
DQ060826_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
DQ060828_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849716_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849713_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
DQ060824_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849719_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF849722_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494711_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494712_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494714_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
EU239220_PreS1_P-E      caccgtaaatcctctgggattttttcccgaccaccagttggatccagcat
FN594765_PreS1_P-E      caccaccaatcctttgggattttttcccgaccaccagttggatccagcat
KF170780_PreS1_P-E      taccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170752_PreS1_P-E      cacyaccaatcctctgggattttttcccgaccaccagttggatccagcat
LT623851_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170779_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FN594751_PreS1_P-E      caccaccaatcctttgggattttttcccgaccaccagttggatccagcat
AB205190_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363608_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB915178_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MF772358_PreS1_P-E      caccaccaatcctttgggattttttcccgaccaccagttggatccagcat
MZ962189_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB106564_PreS1_C-E      caccaccaagcctctgggatgtgttcccgaccaccagttggatccagcat
FN594766_PreS1_P-E      caccaccaatcctttgggattttttcccgaccaccagttggatccagcat
KF170751_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161825_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KM108623_PreS1_P-E      caccaccaatcctctgggaatttttcccgaccaccagttggatccagcat
AM494691_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161831_PreS1_P-E      caccaccaatcctctgggattttttcccgagcaccagttggatccagcat
AB274973_PreS1_P-E      cacctccaatcctctgggattttttcccgaccaccagttggatccagcat
FN545822_PreS1_P-E      caccaccaatcctctgggatttttwcccgaccaccagttggatccagcat
KM108610_PreS1_P-E      caccaccaatcctctgggatttcttcccgaccaccagttggatccagcat
MF772357_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
LT623844_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363603_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363600_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FN545821_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB274979_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagaat
KU736913_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaycagttggatccagcat
HM363565_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FN594760_PreS1_P-E      caccaccaatcctttgggattttttcccgaccaccagttggatccagcat
MH580626_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KT749841_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB274975_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
MW455165_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
LT623847_PreS1_P-E      caccaccaatcctctgggattctttcccgaccaccagttggatccagcat
HM363611_PreS1_P-E      taccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363610_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170790_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363595_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FN545823_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB274981_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
MW679683_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MN967526_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MN507846_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MZ962190_PreS1_P-E      caccacaaatcctctgggattttttcccgaccaccagttggatccagcat
MN507845_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KM108626_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KM108625_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363566_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KM108622_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FJ349240_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
LT623845_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161757_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
EU239222_PreS1_P-E      cacctccaatcctctgggattttttcccgaccaccagttggatccagcat
JN604235_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
HM363609_PreS1_P-E      cacctccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494703_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MN507847_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
KM606739_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FJ349227_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MZ962196_PreS1_P-E      caccacaaatcctctgggattttttcccgaccaccagttggatccagcat
LT623849_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
HM363607_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB274980_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580648_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580645_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170783_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170753_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494695_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161783_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagaat
GQ161824_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagaat
GQ161797_PreS1_P-E      caccaccaatcctctgggagtttttcccgaccaccagttggatccagcat
AB274970_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580638_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363593_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363591_PreS1_P-E      caccacaaatcctctgggattttttcccgatcatcagttggatccagcat
HM363597_PreS1_P-E      caccacaaatcctctgggattttttcccgatcatcagttggatccagcat
HM363601_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363588_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363589_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FN594758_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FN545842_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
EU239218_PreS1_P-E      cacctccaatcctctgggattctttcccgaccaccagttggatccagcat
DQ060822_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
AB201288_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
EU239226_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
EU239217_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
AB274969_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
AB274978_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcgt
MN967527_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB205129_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB205192_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MN507848_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580631_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580632_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580652_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161773_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161802_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363605_PreS1_P-E      caccaccaatcctctgggattttttcccgatcaccagttggatccagcat
AM494705_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH918655_PreS1_P-E      cacctccaatcctctgggattttttcccgaccaccagttggatccagcat
FN545827_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MF772362_PreS1_P-E      caccaccaatcctttgggattttttcccgaccaccagttggatccagcat
KU736893_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363590_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580621_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcct
MH580625_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcct
MH580622_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcct
MH580637_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcct
HM363573_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB194947_PreS1_P-E      caccaccgatcctctgggattttttcccgaccaccagttggatccagcat
MH580634_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580635_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580636_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580647_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580624_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580646_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580649_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580629_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363604_PreS1_P-E      caccacccctcctctgggattttttcccgaccaccagttggatccagcat
HM363592_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FN594759_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580630_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736901_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170789_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363574_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161758_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161766_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161774_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161755_PreS1_P-E      caccacaaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161835_PreS1_P-E      caccacaaatcctctgggattttttcccgaccaccagttggatccagcat
FJ349226_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB915177_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HQ700550_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HQ700552_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KM108624_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363583_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363584_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363575_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363576_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MF772360_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170785_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161815_PreS1_P-E      cgtcaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170786_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363587_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363582_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161811_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494699_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363585_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580614_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580615_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580616_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580618_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580619_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580620_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580623_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580651_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161778_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161810_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161808_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494704_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736891_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736892_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AB201287_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
X75657_PreS1_P-E        caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MN967529_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MN967528_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580644_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580640_PreS1_P-E      taccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580641_PreS1_P-E      taccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580617_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MH580628_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
LT623850_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
LT623848_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
LT623846_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736911_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736909_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736904_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736902_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170788_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KF170742_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363596_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363577_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
DQ060830_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
FN545841_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MW455161_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363568_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363567_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
GQ161780_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KX186584_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363569_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363570_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
HM363571_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736912_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736910_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736906_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736903_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494715_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494713_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494707_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494702_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494701_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494693_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494690_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494708_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
AM494717_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736900_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736905_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736907_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
KU736908_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MK321264_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MK720631_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
MK720632_PreS1_P-E      caccaccaatcctctgggattttttcccgaccaccagttggatccagcat
                                  *     **     * ***** ** **** *** ****  *

MW679682_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MZ962198_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MF772356_PreS1_P-E      tcagagcaaacaccagcaatccagattgggatcacaatcccaacaaagac
MZ962195_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MZ962197_PreS1_P-E      tcagagcaaacaccagaaatccagattgggacttcaatcccacccaagac
KF170787_PreS1_P-E      tcaaagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
LT623843_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161775_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MZ962192_PreS1_P-E      tcaaagccaacacctgttattcagattgggaccacaatcccaacaaagac
HM363602_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161760_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN594762_PreS1_P-E      tcaaagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MZ962193_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363572_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MN507844_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
MW455162_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
JN604168_PreS1_P-E      tcagagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
GQ161768_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
AB194948_PreS1_P-E      tcagtgcaaacaccagaaatccagattgggaccacaatcccaacaaagac
EU239224_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagaa
MW455163_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161762_PreS1_P-E      tcaaagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MW455164_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
HM363606_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161823_PreS1_P-E      tcagagcaaataccagaaatccagattgggaccacaatcccaacaaagac
LT623842_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN594756_PreS1_P-E      tcagagcaaacaccaacaatccagattgggaccacaatcccaacaaagac
GQ161796_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363594_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161834_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
GQ161785_PreS1_P-E      tcagagcaaacacccgaaatccagattgggaccacaatcccaacaaagac
AB274977_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161820_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccwcaatcccaacaaagac
GQ161807_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB274985_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagat
MZ962194_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MN507841_PreS1_P-E      tcagagcaaacaccagcaatccagattgggaccacaatcccaacaaagac
MZ962191_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaactcaatcccaacaaagac
KF170784_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161776_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161784_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161789_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161828_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FJ349239_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MN507842_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
MN507843_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
GQ161836_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161761_PreS1_P-E      tcaaagcaaataccagaaatccagattgggaccacaatcccaacaaagac
MW082636_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagat
AY739674_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AY739675_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161803_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccaaaatcccaacaaagac
AM494696_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494694_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494700_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MZ962199_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363586_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB274982_PreS1_P-E      tcaaagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB274974_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagat
GQ161779_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161765_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161769_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MN507840_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736899_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736897_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736898_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161830_PreS1_P-E      tcagagcaaataccagaaatccagattgggaccacaatcccaacaaagac
GQ161790_PreS1_P-E      tcagagcaaacaccagaaatccagattgggacctcaatcccaacaaagac
GQ161799_PreS1_P-E      tcagagcaaacaccagaaatccagattgggacctcaatcccaacaaagac
GQ161805_PreS1_P-E      tcagagcaaacaccagaaatccagattgggacctcaatcccaacaaagac
GQ161818_PreS1_P-E      tcagagcaaacaccagaaatccagattgggacctcaatcccaacaaagac
GQ161821_PreS1_P-E      tcagagcaaacaccagaaatccagattgggacctcaatcccaacaaagac
GQ161786_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB091255_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161816_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161759_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736894_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161822_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161817_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161798_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161794_PreS1_P-E      tcagagcaaacacccgaaatccagattgggaccacaatcccaacaaagac
GQ161771_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161770_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161764_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161763_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161777_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FJ349237_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FJ349238_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB274976_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161801_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161833_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736896_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736895_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161832_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161829_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161812_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161804_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161792_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161782_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161814_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161781_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161772_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB274971_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161787_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161791_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161793_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161800_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161819_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161827_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MF772355_PreS1_P-E      tcagagccaacaccagaaatccagattgggaccacaatcccaacaaagat
AB219533_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggacaacaatcccaacaaagac
KM606738_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF170750_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF170782_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN594761_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
KF849723_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
JN604166_PreS1_P-E      tcmaagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN594750_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
HM363599_PreS1_P-E      tcagagcaaataccaaaaatccagattgggaccacaatcccaacaaagac
MH464856_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF849728_PreS1_P-E      tcaaagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
EU239221_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
EU239219_PreS1_P-E      tcaaagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
EU239223_PreS1_P-E      tcaaagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
HM363598_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN594749_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF849720_PreS1_P-E      tcaaagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB219529_PreS1_P-E      tcagagcaaacaccaaaaatcctgattgggacaacaatcctaacatagac
AM494689_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AY738147_PreS1_P-E      tcagagcgaacaccagaaatccagattgggaccacaatcccaacaaagat
AY738146_PreS1_P-E      tcagagcgaacaccagaaatccagattgggaccacaatcccaacaaagat
AY738144_PreS1_P-E      tcagagcgaacaccagaaatccagattgggaccacaatcccaacaaagat
AY738145_PreS1_C-E      tcagagcgaacaccagaaatccagattgggaccacaatcccaacaaagat
KF849717_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN594748_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
MT427114_PreS1_P-E      tcagagcaaacaccagaaatacagattgggaccacaatcccaacaaagac
MT427115_PreS1_P-E      tcagagcaaacaccagaaatacagattgggaccacaatcccaacaaagac
AM494692_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494697_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB091256_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494709_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494710_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427124_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580650_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494706_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427130_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427120_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427116_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427113_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaaaac
MT427110_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427155_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427142_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427131_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427122_PreS1_P-E      tcagagcaaacacccgaaatccagattgggaccacaatcccaacaaagac
MT427112_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427143_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427123_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427152_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427157_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427134_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427133_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
MT427144_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427139_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427118_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427136_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427192_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427190_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427189_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427186_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427175_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427172_PreS1_P-E      tcatagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427169_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427168_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427164_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427162_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427161_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427160_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427156_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427148_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427147_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427159_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427181_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427182_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427183_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427184_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427185_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427141_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427138_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427135_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427194_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427128_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427126_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427198_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427111_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427117_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427121_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427125_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427127_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427129_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427132_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427137_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427140_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427145_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427146_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427149_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427150_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427151_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427153_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427154_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427158_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427163_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427166_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427167_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427170_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427171_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427173_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427174_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427176_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427177_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427178_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427179_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427180_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427187_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427188_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427191_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427193_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427195_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427196_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427197_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427199_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427200_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427201_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427165_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MT427119_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF849725_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
MT426115_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363579_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363581_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363580_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB205189_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB205191_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF849715_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN594752_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggacaacaatcccaacaaagac
OM256457_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB201290_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
KF849724_PreS1_P-E      tcagagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
KF849714_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
JQ000009_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KR139749_PreS1_P-E      tcagagcgaacaccagaaatccagattgggaccacaatcccaacaaagac
MH464855_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB915175_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363578_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AY935700_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF849726_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MF772354_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF922438_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF922439_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN594763_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
DQ060823_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF170741_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB201289_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KT192626_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
DQ060825_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF849721_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
JQ000008_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF849718_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
DQ060827_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
DQ060829_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
DQ060826_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
DQ060828_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF849716_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF849713_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
DQ060824_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF849719_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF849722_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494711_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494712_PreS1_P-E      tcagagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
AM494714_PreS1_P-E      tcagagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
EU239220_PreS1_P-E      tcagagcaaacaccagaaatccagattgggacaacaatcccaacaaagac
FN594765_PreS1_P-E      tcaaagcaaacaccagmaatccagattgggatcacaatcccaacaaagac
KF170780_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccaaaatcccaacaaagac
KF170752_PreS1_P-E      tcaaagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
LT623851_PreS1_P-E      tccgagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF170779_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN594751_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB205190_PreS1_P-E      tcagagcaaacaccagaactccagattgggaccacaatcccaacaaagac
HM363608_PreS1_P-E      tcagagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
AB915178_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MF772358_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MZ962189_PreS1_P-E      tcagagcaaacaccagaaatccagattgggacttcaatcccaacaaagac
AB106564_PreS1_C-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN594766_PreS1_P-E      tcagagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
KF170751_PreS1_P-E      tcaaagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161825_PreS1_P-E      tcaaagcaaacaccagaagtccagattgggaccacaatcccaacaaagat
KM108623_PreS1_P-E      tcagagcaaactccagaaatccagattgggaccacaatcccaacaaagac
AM494691_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161831_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB274973_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN545822_PreS1_P-E      tcagggcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KM108610_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
MF772357_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
LT623844_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363603_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
HM363600_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN545821_PreS1_P-E      tcagagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
AB274979_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736913_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363565_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
FN594760_PreS1_P-E      tcagagcaaacaccagcaatccagattgggacgacaatcccaacaaagac
MH580626_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KT749841_PreS1_P-E      tcagagcaaacaccagcaatccagattgggaccacaatcccaacaaagac
AB274975_PreS1_P-E      tcaaagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MW455165_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
LT623847_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363611_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363610_PreS1_P-E      tcagagcaaacacccgaaatccagattgggatcacaatcccaccaaagac
KF170790_PreS1_P-E      tcagagcaaacaccagcaatccagattgggaccacaatcccaacaaagac
HM363595_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN545823_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB274981_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MW679683_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MN967526_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaaaaaagac
MN507846_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MZ962190_PreS1_P-E      tcagagcaaacaccagaaatccagattgggacttcaatcccaacaaagac
MN507845_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagat
KM108626_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KM108625_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363566_PreS1_P-E      tcacagcgaacaccagaaatccagattgggaccacaatcccaacaaagac
KM108622_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FJ349240_PreS1_P-E      tcaaagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
LT623845_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161757_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
EU239222_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
JN604235_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363609_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494703_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MN507847_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KM606739_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FJ349227_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MZ962196_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
LT623849_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363607_PreS1_P-E      tccgagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB274980_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580648_PreS1_P-E      tcaaagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580645_PreS1_P-E      tcagagcaaacaccagaaacccagattgggaccacaatcccaacaaagac
KF170783_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF170753_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494695_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161783_PreS1_P-E      tccaagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
GQ161824_PreS1_P-E      tccaagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
GQ161797_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagat
AB274970_PreS1_P-E      tccgagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580638_PreS1_P-E      tccgagcaaacacccgaaatccagattgggaccacaatcccaacaaagac
HM363593_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363591_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaccaaagac
HM363597_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaccaaagac
HM363601_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaccaaagac
HM363588_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaccaaagac
HM363589_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaccaaagac
FN594758_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN545842_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
EU239218_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
DQ060822_PreS1_P-E      tcagagcaaataccagaaatccagattgggaccacaatcccaacaaagac
AB201288_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
EU239226_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
EU239217_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB274969_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB274978_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MN967527_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB205129_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccgacaaagac
AB205192_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MN507848_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580631_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
MH580632_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
MH580652_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
GQ161773_PreS1_P-E      tcagagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
GQ161802_PreS1_P-E      tcagagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
HM363605_PreS1_P-E      tcagagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
AM494705_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH918655_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN545827_PreS1_P-E      tcagagcaaacaccagaaatccagattgggacmacaatcccaacaaagac
MF772362_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736893_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363590_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaccaaagac
MH580621_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
MH580625_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
MH580622_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
MH580637_PreS1_P-E      tcagagcaaacaccaaaaatccagattgggaccacaatcccaacaaagac
HM363573_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB194947_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580634_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580635_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580636_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580647_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580624_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580646_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580649_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580629_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363604_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363592_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN594759_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580630_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736901_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccagcaaagac
KF170789_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363574_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161758_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161766_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161774_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161755_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161835_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FJ349226_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB915177_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HQ700550_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HQ700552_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KM108624_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363583_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363584_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363575_PreS1_P-E      tccgagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363576_PreS1_P-E      tccgagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MF772360_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF170785_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccatcaaagac
GQ161815_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF170786_PreS1_P-E      tcaaagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363587_PreS1_P-E      tcagagcaaacaccagaaatccagattgggacaacaatcccaacaaagac
HM363582_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161811_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494699_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363585_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580614_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580615_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580616_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580618_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580619_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580620_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580623_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580651_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161778_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161810_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161808_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494704_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736891_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736892_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AB201287_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
X75657_PreS1_P-E        tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MN967529_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MN967528_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580644_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580640_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580641_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580617_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MH580628_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
LT623850_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
LT623848_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
LT623846_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736911_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736909_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736904_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736902_PreS1_P-E      tcagagcaaacaccagaaatccagattgggatcacaatcccaacaaagac
KF170788_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KF170742_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363596_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363577_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
DQ060830_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
FN545841_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MW455161_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363568_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363567_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
GQ161780_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KX186584_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363569_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363570_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
HM363571_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736912_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736910_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736906_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736903_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494715_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494713_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494707_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494702_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494701_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494693_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494690_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494708_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
AM494717_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736900_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736905_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736907_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
KU736908_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MK321264_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MK720631_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
MK720632_PreS1_P-E      tcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagac
                        **   ** **  **       * ********    *****      * * 

MW679682_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
MZ962198_PreS1_P-E      tactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
MF772356_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
MZ962195_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MZ962197_PreS1_P-E      cactggaccgcagccaacaaggtaggagtgggagcattcgggccggggtt
KF170787_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
LT623843_PreS1_P-E      cattggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
GQ161775_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
MZ962192_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363602_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161760_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
FN594762_PreS1_P-E      cactggaaaaaagccaacaaggtaggagtgggagcattctggccggggct
MZ962193_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363572_PreS1_P-E      cactggtcagaagccaacaaggtaggagtgggagcattcgggccggggtt
MN507844_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
MW455162_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
JN604168_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161768_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggct
AB194948_PreS1_P-E      cactggacggaagccaaccaggtaggagtgggagcattcgggccggggtt
EU239224_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
MW455163_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161762_PreS1_P-E      cactggaccgaagccaacaaggtaggagtgggagcattcgggccggggtt
MW455164_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggcctgggtt
HM363606_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161823_PreS1_P-E      cactggaaggaagccaacaaggtaggagtgggagcattcgggccggggtt
LT623842_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
FN594756_PreS1_P-E      cactggaccgaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161796_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363594_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccgggatt
GQ161834_PreS1_P-E      cactggacggaagccaccaaggtaggagtgggagcattcgggccggggtt
GQ161785_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggacggggtt
AB274977_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161820_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161807_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcggcccggggtt
AB274985_PreS1_P-E      cactggacggaacccaacaaggtaggagtgggagcattcgggccggggtt
MZ962194_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
MN507841_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
MZ962191_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KF170784_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161776_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161784_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161789_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161828_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
FJ349239_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
MN507842_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
MN507843_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161836_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161761_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
MW082636_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
AY739674_PreS1_P-E      cactggaccgaagccaacaaggtaggagtgggagcattcgggccggggtt
AY739675_PreS1_P-E      cactggaccgaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161803_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
AM494696_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggct
AM494694_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggct
AM494700_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggct
MZ962199_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363586_PreS1_P-E      cactggacaaaagccaacaaggtaggagtgggagcattcgggccggggtt
AB274982_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
AB274974_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161779_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161765_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161769_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
MN507840_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
KU736899_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
KU736897_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
KU736898_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161830_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcggaccggggtt
GQ161790_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161799_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161805_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161818_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161821_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161786_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
AB091255_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161816_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161759_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
KU736894_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161822_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161817_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggaacattcgggccggggtt
GQ161798_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161794_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161771_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161770_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161764_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161763_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161777_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
FJ349237_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
FJ349238_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
AB274976_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161801_PreS1_P-E      cactggatggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161833_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
KU736896_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
KU736895_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161832_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161829_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161812_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161804_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161792_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161782_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161814_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161781_PreS1_P-E      tactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161772_PreS1_P-E      cactggaaggaagccaacaaggtaggagtgggagcattcgggccggggtt
AB274971_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161787_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161791_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161793_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161800_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161819_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161827_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
MF772355_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
AB219533_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
KM606738_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagctttcgggcctgggtt
KF170750_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KF170782_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
FN594761_PreS1_P-E      cactggacagacgccaacaaggtaggagtgggagcatttgggccggggct
KF849723_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggcctggggt
JN604166_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccagggtt
FN594750_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
HM363599_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccgggatt
MH464856_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
KF849728_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
EU239221_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccagggtt
EU239219_PreS1_P-E      cactggacagacgccaacaaggtaggagtgggagcatttgggccggggtt
EU239223_PreS1_P-E      cactggacagacgccaacaaggtaggagtgggagcatttgggccggggtt
HM363598_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
FN594749_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
KF849720_PreS1_P-E      cactggacagaagccaacgaggtaggagtgggagcatttgggccggggtt
AB219529_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
AM494689_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AY738147_PreS1_P-E      cactggacggcagccaacaaggtaggagtgggagcattcgggcctgggtt
AY738146_PreS1_P-E      cactggacagcagccaacaaggtaggagtgggagcattcgggcctgggtt
AY738144_PreS1_P-E      cactggacagcagccaacaaggtaggagtgggagcattcgggcctgggtt
AY738145_PreS1_C-E      cactggacagcagccaacaaggtaggagtgggagcattcgggcctgggtt
KF849717_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
FN594748_PreS1_P-E      cactggacagacgccaacaaggtaggagtgggagcatttgggccggggyt
MT427114_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427115_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AM494692_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AM494697_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AB091256_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AM494709_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AM494710_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427124_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggacggggtt
MH580650_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AM494706_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427130_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427120_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427116_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427113_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427110_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427155_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427142_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427131_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427122_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427112_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427143_PreS1_P-E      cactgcacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427123_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427152_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427157_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427134_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427133_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427144_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427139_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427118_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427136_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427192_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427190_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427189_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427186_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427175_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427172_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427169_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427168_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427164_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427162_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427161_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427160_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427156_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427148_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427147_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427159_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427181_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427182_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427183_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427184_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427185_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427141_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427138_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427135_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427194_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427128_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427126_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427198_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427111_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427117_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427121_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427125_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427127_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427129_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427132_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427137_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427140_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427145_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427146_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427149_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427150_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427151_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427153_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427154_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427158_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427163_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427166_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427167_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427170_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427171_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427173_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427174_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427176_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427177_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427178_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427179_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427180_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427187_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427188_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427191_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427193_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427195_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427196_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427197_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427199_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427200_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427201_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427165_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MT427119_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KF849725_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
MT426115_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccagggtt
HM363579_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccagggtt
HM363581_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccagggtt
HM363580_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccagggtt
AB205189_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccagggtt
AB205191_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccagggtt
KF849715_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggcckgggtt
FN594752_PreS1_P-E      cactggacagaagccaacgaggtaggagtgggagcttttgggccggggtt
OM256457_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AB201290_PreS1_P-E      cactggaaagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KF849724_PreS1_P-E      cactggacagaagcaaacaaggtaggagtgggagcattcgggcctgggtt
KF849714_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggcctgggtt
JQ000009_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KR139749_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
MH464855_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
AB915175_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
HM363578_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
AY935700_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
KF849726_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
MF772354_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
KF922438_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
KF922439_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
FN594763_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
DQ060823_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
KF170741_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
AB201289_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
KT192626_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
DQ060825_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcatttgggcctgggtt
KF849721_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
JQ000008_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KF849718_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
DQ060827_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
DQ060829_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
DQ060826_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
DQ060828_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KF849716_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KF849713_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
DQ060824_PreS1_P-E      cactggacaaaagccaacaaggtaggagtgggagcattcgggcctgggtt
KF849719_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KF849722_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AM494711_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AM494712_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AM494714_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
EU239220_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
FN594765_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggatcattcgggccggggtt
KF170780_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KF170752_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
LT623851_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KF170779_PreS1_P-E      cactggacacaagccaacaaggtaggagtgggagcattcgggcctgggtt
FN594751_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AB205190_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363608_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AB915178_PreS1_P-E      cactggwcagaagccaacaaggtaggagtgggagcattcgggcctgggtt
MF772358_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggct
MZ962189_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AB106564_PreS1_C-E      cactggacagacgccaacaaggtaggagtgggagcatttgggccggggtt
FN594766_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggatcattcgggccggggtt
KF170751_PreS1_P-E      cactggatagaagccaacaaggtaggagtgggagcattcgggcctgggtt
GQ161825_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KM108623_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AM494691_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161831_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AB274973_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
FN545822_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KM108610_PreS1_P-E      cactggaatgcagccaacaaggtaggagtgggagcattcgggcctgggtt
MF772357_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
LT623844_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggkt
HM363603_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363600_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
FN545821_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AB274979_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KU736913_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
HM363565_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
FN594760_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580626_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KT749841_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AB274975_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggtgcattcgggccggggtt
MW455165_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggtgcattcgggccggggtt
LT623847_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363611_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363610_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KF170790_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
HM363595_PreS1_P-E      cattggacagaagccaacaaggtaggagtgggagcattcgggccgggatt
FN545823_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccagggtt
AB274981_PreS1_P-E      cactggacagaacccaacgaggtaggagtgagtgcattcgggccggggtt
MW679683_PreS1_P-E      cactggacagaagccaaccaggtaggagtgggagcattcgggccggggtt
MN967526_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
MN507846_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
MZ962190_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MN507845_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KM108626_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KM108625_PreS1_P-E      cactggtcagaagccaacaaggtaggagtgggagcattcgggcctgggtt
HM363566_PreS1_P-E      cactggacagaagccaaccaggtaggagtgggagcattcgggccggggtt
KM108622_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
FJ349240_PreS1_P-E      cactggtcagaagccaacaaggtaggagtgggagcattcgggccggggtt
LT623845_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161757_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
EU239222_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
JN604235_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggtgcattcgggccggggtt
HM363609_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggaacattcgggccggggtt
AM494703_PreS1_P-E      cactggccagaagccaacaaggtaggagtgggagcattcgggcctgggtt
MN507847_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggtgcattcgggccggggtt
KM606739_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
FJ349227_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatacgggccggggtt
MZ962196_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
LT623849_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggtgcattcgggccggggtt
HM363607_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AB274980_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580648_PreS1_P-E      cactggacacaggccaacaaggtaggagtgggagcattcgggccggggtt
MH580645_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KF170783_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KF170753_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AM494695_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
GQ161783_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161824_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161797_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AB274970_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580638_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363593_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363591_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363597_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363601_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363588_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363589_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
FN594758_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
FN545842_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
EU239218_PreS1_P-E      cactggacagacgccaacaaggtaggagtgggagcattcgggccggggtt
DQ060822_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
AB201288_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
EU239226_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggtgcattcgggccggggtt
EU239217_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggtgcattcgggccggggtt
AB274969_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggtgcattcgggccggggtt
AB274978_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggtgcattcgggccggggtt
MN967527_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AB205129_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AB205192_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MN507848_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580631_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580632_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580652_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161773_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161802_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363605_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AM494705_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagccttcgggccggggtt
MH918655_PreS1_P-E      cattggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
FN545827_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MF772362_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KU736893_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
HM363590_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580621_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580625_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580622_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580637_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363573_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AB194947_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580634_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580635_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580636_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580647_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580624_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580646_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580649_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580629_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363604_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363592_PreS1_P-E      cactggatagaagccaacaaggtaggagtgggagcattcgggccggggtt
FN594759_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcatttgggccggggtt
MH580630_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KU736901_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KF170789_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363574_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161758_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161766_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161774_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161755_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161835_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
FJ349226_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AB915177_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
HQ700550_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HQ700552_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KM108624_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
HM363583_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363584_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363575_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363576_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MF772360_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KF170785_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161815_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KF170786_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
HM363587_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363582_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161811_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AM494699_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
HM363585_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580614_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580615_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580616_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580618_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580619_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580620_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580623_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580651_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161778_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161810_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161808_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AM494704_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KU736891_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KU736892_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AB201287_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
X75657_PreS1_P-E        cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
MN967529_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
MN967528_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
MH580644_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580640_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580641_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580617_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MH580628_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
LT623850_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
LT623848_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
LT623846_PreS1_P-E      cactggtcagaagccaacaaggtaggagtgggagcattcgggccggggtt
KU736911_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KU736909_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KU736904_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KU736902_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KF170788_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KF170742_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
HM363596_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363577_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
DQ060830_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
FN545841_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
MW455161_PreS1_P-E      cactggacggaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363568_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363567_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
GQ161780_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KX186584_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363569_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363570_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
HM363571_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
KU736912_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KU736910_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KU736906_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KU736903_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AM494715_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggccggggtt
AM494713_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AM494707_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AM494702_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AM494701_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AM494693_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AM494690_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AM494708_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
AM494717_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KU736900_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KU736905_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KU736907_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
KU736908_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
MK321264_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
MK720631_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
MK720632_PreS1_P-E      cactggacagaagccaacaaggtaggagtgggagcattcgggcctgggtt
                         * **        * * * *********** *  * *   *  * **  *

MW679682_PreS1_P-E      cacttccccccacggaggccttttgggggggagccctcaggcccaaggca
MZ962198_PreS1_P-E      cactcccctacacggaggccttttggggtgcagccctcaggctcaaggcc
MF772356_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MZ962195_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MZ962197_PreS1_P-E      cactgccccacacggaggtcttttggggtggagccctcaggctcaaggca
KF170787_PreS1_P-E      tactcccccacacggaggccttctggggtggagccctcaggctcaaggca
LT623843_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161775_PreS1_P-E      cactcccccgcacggaggccttttggggtggagccctcaggctcaaggca
MZ962192_PreS1_P-E      cactcccctacacggaggccttttggggtggagccctcaggctcaaggca
HM363602_PreS1_P-E      cactcccccacacggaggccttctggggtggagccctcaggctcaaggca
GQ161760_PreS1_P-E      cactcccccacatggaggccttttggggtggagccctcaggctcaaggca
FN594762_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MZ962193_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363572_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MN507844_PreS1_P-E      cactcccccacacggaggccttctggggtggagccctcaggctcaaggca
MW455162_PreS1_P-E      cactcccccacacggaagccttttggggtggagccctcaggctcaaggca
JN604168_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161768_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB194948_PreS1_P-E      cactcccccacacggaggccttctgggggggagccctcaggctcaaggca
EU239224_PreS1_P-E      cactcccccacacggaggccttctggggtggagccctcaggctcaaggca
MW455163_PreS1_P-E      cactcccccacacggaggccttctggggtggagccctcaggctcaaggca
GQ161762_PreS1_P-E      cactcccccgcacggaggccttttggggtggagccctcaggctcaaggca
MW455164_PreS1_P-E      cactcccccacacggaagccttttggggtggagccctcaggctcaaggca
HM363606_PreS1_P-E      cactcccccgcacggaggccttttggggtcgagccctcaggctcaaggca
GQ161823_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
LT623842_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FN594756_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161796_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363594_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161834_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161785_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB274977_PreS1_P-E      cacccccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161820_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161807_PreS1_P-E      cactcccccacacggaggccttttggggtcgagccctcaggctcaaggca
AB274985_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MZ962194_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MN507841_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MZ962191_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF170784_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaagctcaaggca
GQ161776_PreS1_P-E      cactcccccgcacggaggccttttggggtggagccctcaggctcaaggca
GQ161784_PreS1_P-E      cactcccccgcacggaggccttttggggtggagccctcaggctcaaggca
GQ161789_PreS1_P-E      cactcccccgcacggaggccttttggggtggagccctcaggctcaaggca
GQ161828_PreS1_P-E      cactcccccgcacggaggccttttggggtggagccctcaggctcaaggca
FJ349239_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MN507842_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MN507843_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161836_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161761_PreS1_P-E      cactcccctacacggaggccttttggggtggagccctcaggctcaaggca
MW082636_PreS1_P-E      cacacccccacacggaggccttttggggtcgagccctcaggctcaaggca
AY739674_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AY739675_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161803_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494696_PreS1_P-E      cactcccccacacggaggccttctggggtggagtcctcaggctcaaggca
AM494694_PreS1_P-E      cactcccccacacggaggccttctggggtggagtcctcaggctcaaggca
AM494700_PreS1_P-E      cactcccccacacggaggccttctggggtggagtcctcaggctcaaggca
MZ962199_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363586_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB274982_PreS1_P-E      cactcccccacacggaggccttgtggggtggagccctcaggctcaaggca
AB274974_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161779_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161765_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161769_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MN507840_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736899_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736897_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736898_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161830_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161790_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161799_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161805_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161818_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161821_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161786_PreS1_P-E      cactcccccacacggaggccttttgggatggagccctcaggctcaaggca
AB091255_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161816_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161759_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736894_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161822_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161817_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161798_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161794_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161771_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161770_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161764_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161763_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161777_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FJ349237_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FJ349238_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB274976_PreS1_P-E      cactcccccacacggaggccttttgggatggagccctcaggctcaaggca
GQ161801_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161833_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736896_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736895_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161832_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161829_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161812_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161804_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161792_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161782_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161814_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161781_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161772_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB274971_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161787_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161791_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161793_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161800_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161819_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161827_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MF772355_PreS1_P-E      cactccaccacacggaggccttttggggtggagccctcaggctcaaggca
AB219533_PreS1_P-E      cactcccccacacggaggccttctggggtggagccctcaggctcaaggca
KM606738_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF170750_PreS1_P-E      cactcccccacacggaggccttctggggtggagccctcaggctcaaggca
KF170782_PreS1_P-E      cactcccccacacggaggccttctggggtggagccctcaggctcaaggca
FN594761_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849723_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
JN604166_PreS1_P-E      cactcccacacacggaggccttttggggtggagccctcaggctcaaggca
FN594750_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363599_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH464856_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849728_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
EU239221_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
EU239219_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
EU239223_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363598_PreS1_P-E      cactcccccacacggaggccttttgggatggagccctcaggctcaaggca
FN594749_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849720_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB219529_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494689_PreS1_P-E      cactcccccacacggaggccttttggggtcgagccctcaggctcaaggca
AY738147_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AY738146_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AY738144_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AY738145_PreS1_C-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849717_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FN594748_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427114_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427115_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494692_PreS1_P-E      cactcccccacacggaggcattttggggtggagccctcaggctcaaggca
AM494697_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB091256_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494709_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494710_PreS1_P-E      cactcccccacacggaggtcttttggggtggagccctcaggctcaaggca
MT427124_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580650_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494706_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427130_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427120_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427116_PreS1_P-E      cactcccccacacggaggccttttggggtagagccctcaggctcaaggca
MT427113_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427110_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427155_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427142_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427131_PreS1_P-E      cactcccccacacggaggccttttggggtgaagccctcaggctcaaggca
MT427122_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427112_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427143_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427123_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427152_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427157_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427134_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427133_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427144_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427139_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427118_PreS1_P-E      cactcccccacacggaggccttttggggtgaagccctcaggctcaaggca
MT427136_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427192_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427190_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427189_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427186_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427175_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427172_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427169_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427168_PreS1_P-E      cactcccccacacgaaggccttttggggtggagccctcaggctcaaggca
MT427164_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427162_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427161_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427160_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427156_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427148_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427147_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427159_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427181_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427182_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427183_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427184_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427185_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427141_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427138_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427135_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427194_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427128_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427126_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427198_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427111_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427117_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427121_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427125_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427127_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427129_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427132_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427137_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427140_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427145_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427146_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427149_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427150_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427151_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427153_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427154_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427158_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427163_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427166_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427167_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427170_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427171_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427173_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427174_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427176_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427177_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427178_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427179_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427180_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427187_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427188_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427191_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427193_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427195_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427196_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427197_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427199_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427200_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427201_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427165_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MT427119_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849725_PreS1_P-E      cactcccccacacggaggccttgtggggtggagccctcaggctcaaggca
MT426115_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363579_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363581_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363580_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB205189_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB205191_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849715_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FN594752_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
OM256457_PreS1_P-E      cactcccccacacggaggccttttggggtggagtcctcaggctcaaggca
AB201290_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849724_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcacggca
KF849714_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
JQ000009_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KR139749_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH464855_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB915175_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363578_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AY935700_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849726_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MF772354_PreS1_P-E      cacacccccacacggaggccttttggggtggagccctcaggctcaaggca
KF922438_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF922439_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FN594763_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
DQ060823_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF170741_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB201289_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KT192626_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
DQ060825_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849721_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
JQ000008_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849718_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
DQ060827_PreS1_P-E      cactcccccacacggaggccttttgggatggagccctcaggctcaaggca
DQ060829_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
DQ060826_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
DQ060828_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849716_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849713_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
DQ060824_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849719_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF849722_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494711_PreS1_P-E      cacwcccccacacggaggccttttggggtggagcccccaggctcaaggca
AM494712_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494714_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
EU239220_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FN594765_PreS1_P-E      cactcccccacacggaggccttttggggtggagycctcaggctcaaggca
KF170780_PreS1_P-E      cactcccccacacggaggcctcttggggtggagccctcaggctcaaggca
KF170752_PreS1_P-E      cactcccccacacggaggccttttggggtcgagccctcaggctcaaggaa
LT623851_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF170779_PreS1_P-E      cactcccccacacggaggccttttgggatggagtcctcaggctcaaggca
FN594751_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB205190_PreS1_P-E      ctctcccccgcacggaggccttttggggtggagccctcaggctcaaggca
HM363608_PreS1_P-E      cactcccccacacggaggccttctggggtggagccctcaggctcaaggca
AB915178_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MF772358_PreS1_P-E      cactcccccacacggaggtcttttggggtggagccctcaggctcaaggca
MZ962189_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB106564_PreS1_C-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FN594766_PreS1_P-E      cactcccccacacggaggccttttggggtggagycctcaggctcaaggca
KF170751_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161825_PreS1_P-E      cactccaccacacggaggccttttggggtggagccctcaggctcaaggca
KM108623_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494691_PreS1_P-E      cactcccccacatggaggccttttggggtggagccctcaggctcaaggca
GQ161831_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB274973_PreS1_P-E      cactcccccacacggaggccttttggggagcagccctcaggctcaaggca
FN545822_PreS1_P-E      cactcccccgcacggaggccttttggggtggagccctcaggctcagggca
KM108610_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggct
MF772357_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
LT623844_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363603_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363600_PreS1_P-E      cacccccccacacggaggccttttggggtggagccctcaggctcaaggca
FN545821_PreS1_P-E      cactcccccacacggaggccttttgggttggagccctcaggctcagggca
AB274979_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctctggctcaaggca
KU736913_PreS1_P-E      cactccmccacacggaggccttttggggtggagtcctcaggctcaaggca
HM363565_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FN594760_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580626_PreS1_P-E      cactcccccacacggaggccttttggggtggagcactcaggctcaaggca
KT749841_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB274975_PreS1_P-E      cactcccccacacggaggccttttgggatggagccctcaggctcaaggca
MW455165_PreS1_P-E      cactcccccacacggaggccttttggggtcgagccctcaggctcaaggca
LT623847_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363611_PreS1_P-E      cactcccccacacggaggccttttggggtggagcccgcaggctcaaggca
HM363610_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctccaggca
KF170790_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363595_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FN545823_PreS1_P-E      cactcccccacacggaggccttttggggwggagccctcaggctcaaggca
AB274981_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MW679683_PreS1_P-E      cgctcccccacacggtggccttttggggtggagccctcagctcaaaggca
MN967526_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MN507846_PreS1_P-E      cactcccccgcacggaggccttctggggtggagccctcaggctcaaggca
MZ962190_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MN507845_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcgggctcaaggca
KM108626_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KM108625_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363566_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KM108622_PreS1_P-E      cactcccccacacggaggccttttggggtgggaccctcaggctcaaggca
FJ349240_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
LT623845_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161757_PreS1_P-E      cactcccccacacggaggccttttggggtcgagccctcaggctcaaggca
EU239222_PreS1_P-E      cactcccccacacggaggccttttggggtcgagccctcaggctcaaggca
JN604235_PreS1_P-E      cactcccccacacggaggccttttgggatggagccctcaggctcaaggca
HM363609_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggaa
AM494703_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MN507847_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcagggca
KM606739_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FJ349227_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MZ962196_PreS1_P-E      cactccccctcacggaggccttttggggtggagccctcaggctcaaggca
LT623849_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363607_PreS1_P-E      tactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB274980_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580648_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580645_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF170783_PreS1_P-E      cactcccccacacggaggcctcttggggtggagtcctcaggctcaaggca
KF170753_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494695_PreS1_P-E      cactcccccacacggagaccttttggggtggagccctcaggctcaaggca
GQ161783_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161824_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161797_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB274970_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580638_PreS1_P-E      tactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363593_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363591_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363597_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363601_PreS1_P-E      cactcccccacacggcggccttttggggtggagccctcaggctcaaggca
HM363588_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363589_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FN594758_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FN545842_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
EU239218_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
DQ060822_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB201288_PreS1_P-E      cactcccccgcacggaggccttttggggtggagccctcaggctcagggca
EU239226_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
EU239217_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB274969_PreS1_P-E      cactcccccacacggaagccttttggggtggagccctcaggctcaaggca
AB274978_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MN967527_PreS1_P-E      cactccaccacacggaggccttttggggtggagccctcaggctcaaggca
AB205129_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB205192_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MN507848_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580631_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580632_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580652_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161773_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161802_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363605_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494705_PreS1_P-E      cactcccccacatggaggccttttggggtggagccctcaggctcaaggca
MH918655_PreS1_P-E      tactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FN545827_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MF772362_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736893_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363590_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580621_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580625_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580622_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580637_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363573_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB194947_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580634_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580635_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580636_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580647_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580624_PreS1_P-E      cactcccccccacggaggccttttggggtggagccctcaggctcaaggca
MH580646_PreS1_P-E      cactcccccccacggaggccttttggggtggagccctcaggctcaaggca
MH580649_PreS1_P-E      cactcccccccacggaggccttttggggtggagccctcaggctcaaggca
MH580629_PreS1_P-E      cactcccccccacggaggccttttggggtggagccctcaggctcaaggca
HM363604_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363592_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FN594759_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580630_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736901_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF170789_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363574_PreS1_P-E      cacacccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161758_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161766_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161774_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161755_PreS1_P-E      cactccccctcacggaggccttttggggtggagccctcaggctcaaggca
GQ161835_PreS1_P-E      cactccccctcacggaggccttttggggtggagccctcaggctcaaggca
FJ349226_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB915177_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HQ700550_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HQ700552_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KM108624_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363583_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363584_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363575_PreS1_P-E      tactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363576_PreS1_P-E      tactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MF772360_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF170785_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161815_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF170786_PreS1_P-E      cactcccccacacggaggccttctggggtggagccctcaggctcaaggca
HM363587_PreS1_P-E      cactcccccacatggaggccttttggggtggagccctcaggctcaaggca
HM363582_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161811_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494699_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363585_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580614_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580615_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580616_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580618_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580619_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580620_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580623_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580651_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161778_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161810_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161808_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494704_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736891_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736892_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AB201287_PreS1_P-E      cactcccccacacggaggttttttggggtggagccctcaggctcaaggca
X75657_PreS1_P-E        cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MN967529_PreS1_P-E      cactcccccacacggaggccttttagggtggagccctcaggctcaaggca
MN967528_PreS1_P-E      cactcccccacacggaggccttttggggtggagtcctcaggctcaaggca
MH580644_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580640_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580641_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580617_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MH580628_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
LT623850_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
LT623848_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
LT623846_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736911_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736909_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736904_PreS1_P-E      cactcccccacacggaggccttctggggtggagccctcaggctcaaggca
KU736902_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF170788_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KF170742_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363596_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363577_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
DQ060830_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
FN545841_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MW455161_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363568_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363567_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
GQ161780_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KX186584_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363569_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363570_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
HM363571_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736912_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736910_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736906_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736903_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494715_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494713_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494707_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494702_PreS1_P-E      cactcccccacacggaggccttttggggtggagtcctcaggctcaaggca
AM494701_PreS1_P-E      cactcccccacacggaggcctcttggggtggagccctcaggctcaaggca
AM494693_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494690_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494708_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
AM494717_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736900_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736905_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736907_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
KU736908_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MK321264_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MK720631_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
MK720632_PreS1_P-E      cactcccccacacggaggccttttggggtggagccctcaggctcaaggca
                          *  *    ** *      *  * **        * *        **  

MW679682_PreS1_P-E      tgctaaaaaaattgcaagaagatccgcctctggcttccacaattgggaat
MZ962198_PreS1_P-E      tgctaaaaacattgccagcagtaccgcctcctgcatccaccattcggccg
MF772356_PreS1_P-E      tgttaaaaacattgccagcagatccgccgcctgcctccaccaatcggcag
MZ962195_PreS1_P-E      tgctaaatacattgccagcagatccgcctcctgcctccaccaatcggcag
MZ962197_PreS1_P-E      tgctaaaaacattgccagcagatctgcctcctgcctccaccaaacggcag
KF170787_PreS1_P-E      tgctaaaaacattgccagcagattctcctcctgcctccaccaatcggcag
LT623843_PreS1_P-E      tgctaaaaacattgccagcaratccgcctcctgcctccaccaatcggcag
GQ161775_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
MZ962192_PreS1_P-E      tgcagaacacagtgccagcagatccgcctcctgcctccaccaatcggcag
HM363602_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161760_PreS1_P-E      tgctaaaaacattgccagcaaatccgcctcctgcctccaccatttggcag
FN594762_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MZ962193_PreS1_P-E      tgctaaaaacattgcaagaagattcgcctcctgcctccaccaatcggcag
HM363572_PreS1_P-E      tgttaaaaacgttgccagcagatccgcctcctgcctccaccaatcggcag
MN507844_PreS1_P-E      tgcaaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
MW455162_PreS1_P-E      tgctacaaacattgccagcagatccgcctcctgcctccaccaatcggcag
JN604168_PreS1_P-E      tgctaaaaacrttgccagcagatccgcctcctgcctccaccaatcggcag
GQ161768_PreS1_P-E      tgctaaaaacattgccagtagatccacctcctgcctccaccaatcggcag
AB194948_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
EU239224_PreS1_P-E      tgctaaaaacattgccagcaaatccgcctcctgcctccaccaatcggcag
MW455163_PreS1_P-E      tgcaaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161762_PreS1_P-E      tgttacaaacattgccagcagatccccctcctgcctccaccaatcggcag
MW455164_PreS1_P-E      tgctacaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363606_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161823_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
LT623842_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcgrcag
FN594756_PreS1_P-E      tgttacaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161796_PreS1_P-E      tgctaaaaacattgccagtagatccacctcctgcctccaccaatcggcag
HM363594_PreS1_P-E      tgctaaaaacattgccagcagatccccctcctgcctccaccaatcggcag
GQ161834_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161785_PreS1_P-E      cgctacaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB274977_PreS1_P-E      tgctacaaacattgccagcaaatccgcctcctgcctccaccaatcggcag
GQ161820_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161807_PreS1_P-E      tgctaagaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB274985_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MZ962194_PreS1_P-E      tgctaaaaacattgcaagaagattcgcctcctgcctccaccaatcggcag
MN507841_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MZ962191_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF170784_PreS1_P-E      tgctaacaacattgccagcagagccgcctcctgcctccaccaatcggcag
GQ161776_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161784_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161789_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161828_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FJ349239_PreS1_P-E      tgctacaaacattgccagcagatccgcctcctgcctccaccaatcggcaa
MN507842_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MN507843_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctggctccaccaatcggcag
GQ161836_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161761_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MW082636_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AY739674_PreS1_P-E      tgttacaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AY739675_PreS1_P-E      tgttacaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161803_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494696_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494694_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494700_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MZ962199_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363586_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB274982_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB274974_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctcctccaatcgtcag
GQ161779_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161765_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161769_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MN507840_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736899_PreS1_P-E      tgctaaaaacattgccagcaaatccgcctcctgcctccaccaatcggcag
KU736897_PreS1_P-E      tgctgaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736898_PreS1_P-E      tgctgaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161830_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161790_PreS1_P-E      tgctaaatacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161799_PreS1_P-E      tgctaaatacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161805_PreS1_P-E      tgctaaatacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161818_PreS1_P-E      tgctaaatacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161821_PreS1_P-E      tgctaaatacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161786_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB091255_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161816_PreS1_P-E      tgttacaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161759_PreS1_P-E      tgctacaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736894_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161822_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161817_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161798_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161794_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161771_PreS1_P-E      tgctaaaaacattgccagcaaatccgcctcctgcctccaccaatcggcag
GQ161770_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161764_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161763_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161777_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FJ349237_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
FJ349238_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB274976_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161801_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161833_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736896_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736895_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161832_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161829_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161812_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161804_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161792_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161782_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161814_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161781_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161772_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB274971_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161787_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161791_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161793_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161800_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161819_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161827_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MF772355_PreS1_P-E      tgctaaaaaccttgccagcagatccgcctcctgcctccaccaatcggcag
AB219533_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KM606738_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcttccaccaatcggcag
KF170750_PreS1_P-E      tgccaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF170782_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FN594761_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF849723_PreS1_P-E      tactaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
JN604166_PreS1_P-E      tgcaaaaaaccttgccagcagatccgcctcctgcctccaccaatcggcag
FN594750_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363599_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MH464856_PreS1_P-E      tgctaaaaaccttgccagcagatccgcctcctgcctccaccaatcggcag
KF849728_PreS1_P-E      tcctaacaacattgccagcagatccgcctcctccctccaccaatcggcag
EU239221_PreS1_P-E      tgctaaaaacattgccaacagatccgcctcctgcctccaccaatcggcag
EU239219_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
EU239223_PreS1_P-E      tgctaaaaacattgccggcagatccgcctcctgcctccaccaatcggcag
HM363598_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggatg
FN594749_PreS1_P-E      tgcaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF849720_PreS1_P-E      tgctaacaaccttgccagcagatccgcctcctgcctccaccaatcggcag
AB219529_PreS1_P-E      tgctaaaaacattgccagcggatccgcctcctgcctccaccaatcggcag
AM494689_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcaa
AY738147_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AY738146_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AY738144_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AY738145_PreS1_C-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF849717_PreS1_P-E      tgctgaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FN594748_PreS1_P-E      tgctaaaaacattgccagcaaatccgcctcctgcctccaccaatcggcag
MT427114_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427115_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494692_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcaa
AM494697_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcaa
AB091256_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494709_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcaa
AM494710_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcaa
MT427124_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MH580650_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcaa
AM494706_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcaa
MT427130_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427120_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427116_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427113_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427110_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427155_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgccttcaccaatcggcag
MT427142_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427131_PreS1_P-E      tgctaaaaacattgccagcatatccgcctcctgcctccaccaatcggcag
MT427122_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427112_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427143_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427123_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427152_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427157_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427134_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427133_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427144_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427139_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427118_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427136_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427192_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427190_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427189_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427186_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427175_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427172_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427169_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427168_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427164_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427162_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427161_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427160_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427156_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427148_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427147_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427159_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427181_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427182_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427183_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427184_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427185_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427141_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427138_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427135_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427194_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427128_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427126_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427198_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427111_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427117_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427121_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427125_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427127_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427129_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427132_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427137_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427140_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427145_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427146_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427149_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427150_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427151_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427153_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427154_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427158_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427163_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427166_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427167_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427170_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427171_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427173_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427174_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427176_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427177_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427178_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427179_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427180_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427187_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427188_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427191_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427193_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427195_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427196_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427197_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427199_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427200_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427201_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427165_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT427119_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF849725_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MT426115_PreS1_P-E      tgcaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363579_PreS1_P-E      tgcaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363581_PreS1_P-E      tgcaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363580_PreS1_P-E      tgcaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB205189_PreS1_P-E      tgctaaaaacattgccaacagatccgcctcctgcctccaccaatcggcag
AB205191_PreS1_P-E      tgctaaaaacagtgccaacagatccgcctcctgcctccaccaatcggcag
KF849715_PreS1_P-E      tgcaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FN594752_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
OM256457_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaagcggcag
AB201290_PreS1_P-E      tgctaaaaacattgccagcagatccacctcctgcctccaccaatcggcag
KF849724_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF849714_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
JQ000009_PreS1_P-E      tgataaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KR139749_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MH464855_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB915175_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363578_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AY935700_PreS1_P-E      tgctaaaaaccttgccagcagatccgcctcctgcctccaccaatcggcag
KF849726_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MF772354_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF922438_PreS1_P-E      tgctaaaaacattgccagcaaatccgcctcctgcctccaccaatcggcag
KF922439_PreS1_P-E      tgctaaaaacattgccagcaaatccgcctcctgcctccaccaatcggcag
FN594763_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
DQ060823_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF170741_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB201289_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KT192626_PreS1_P-E      tgctaaaaacattgccagcaaatccgcctcctgcctccaccaatcggcag
DQ060825_PreS1_P-E      tgctaaagacattgccagcagatccgcctcctgcctccaccaatcggcag
KF849721_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
JQ000008_PreS1_P-E      tgataaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF849718_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
DQ060827_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
DQ060829_PreS1_P-E      tgctaaaaacattgccagcaaatccgcctcctgcctccaccaatcggcag
DQ060826_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
DQ060828_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF849716_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF849713_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
DQ060824_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF849719_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF849722_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494711_PreS1_P-E      tgctaaacactttgccagcagatccgcctcctgcctccaccaatcggcag
AM494712_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgtttccaccaatcggcaa
AM494714_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgtttccaccaatcggcaa
EU239220_PreS1_P-E      tgctaaagacattgccagcagatccgcctcctgcctccaccaatcggcag
FN594765_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF170780_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctcaaccaatcggcag
KF170752_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
LT623851_PreS1_P-E      tgctraaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF170779_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaaccggcat
FN594751_PreS1_P-E      tgctaacaccattgccagcagatccgcctcctgcctccaccaatcggcag
AB205190_PreS1_P-E      tgttacaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363608_PreS1_P-E      tgctaaaaacattgccaacagatccgcctcctgcctccatcaagcggcag
AB915178_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MF772358_PreS1_P-E      tgttaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MZ962189_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB106564_PreS1_C-E      tgccaaaaacatcgccagcagaaccgcctcctgcctccaccaagcggcag
FN594766_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF170751_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161825_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KM108623_PreS1_P-E      ggctaacatcattgccagcaaatccgcctcctgcctccaccaatcggcag
AM494691_PreS1_P-E      tgcwaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161831_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB274973_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FN545822_PreS1_P-E      tgcaaaaaacattgccagcagatccgcctcttgcctccaccaatcggaag
KM108610_PreS1_P-E      cgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MF772357_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctctaccaatcggcag
LT623844_PreS1_P-E      tgctacaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363603_PreS1_P-E      tgccaaaaacattgccatcagatccgcctcctgcctccaccaatcggcag
HM363600_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FN545821_PreS1_P-E      tgctgaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB274979_PreS1_P-E      tgctaaaaacattgccagcaaatccgcctcctgcctccaccaatcggcag
KU736913_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363565_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccgccaatcggcag
FN594760_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MH580626_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
KT749841_PreS1_P-E      tgcaaaaaacattgccagcagatccgcctactgcctccaccaatcggcag
AB274975_PreS1_P-E      tgctaacaacattgccaacagatccgcctactgcctccaccaatcggcag
MW455165_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
LT623847_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccamtcggcag
HM363611_PreS1_P-E      cgcaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363610_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF170790_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363595_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FN545823_PreS1_P-E      tgctaacaacgttgccagcaaatccgcctcctgcctccaccaatcggcag
AB274981_PreS1_P-E      cgctaaaaacattgccaacagatccgcctcctgcctccaccaatcggcag
MW679683_PreS1_P-E      tgttacacacattgccagcagatccgcctcctgcctccaccaatcggcag
MN967526_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
MN507846_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MZ962190_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MN507845_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
KM108626_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KM108625_PreS1_P-E      tgcaaaaaacattgccagcaaatccgcctcctgcctctaccaatcggcag
HM363566_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KM108622_PreS1_P-E      tgctaaaaacattgccagcagaccctcctcctgcctccaccaatcggcag
FJ349240_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
LT623845_PreS1_P-E      tgctaacaacattgccagcaaatccgcctcctgcctccaccaatcggcag
GQ161757_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
EU239222_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
JN604235_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363609_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494703_PreS1_P-E      tgctgaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MN507847_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KM606739_PreS1_P-E      tgcaaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
FJ349227_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MZ962196_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
LT623849_PreS1_P-E      tgctaaaaacwgtgccagcagatccgcctcctgcctccaccaatcggcag
HM363607_PreS1_P-E      tgttaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB274980_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccgccaatcggcag
MH580648_PreS1_P-E      tgctaaaaatgttgccagcagatcctcctcctgcctccaccaatcggcag
MH580645_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
KF170783_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF170753_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494695_PreS1_P-E      tgctaaaaacattgccagcagatccgccttctgcctccaccaatcggcag
GQ161783_PreS1_P-E      tgctaaaaacattgccagcagttccgcctcctgcctccaccaatcggcag
GQ161824_PreS1_P-E      tgctaaaaacattgccagcagttccgcctcctgcctccaccaatcggcag
GQ161797_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB274970_PreS1_P-E      tactaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MH580638_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363593_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363591_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363597_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggaag
HM363601_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363588_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363589_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FN594758_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FN545842_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
EU239218_PreS1_P-E      tgcaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
DQ060822_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB201288_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcttgcctccaccaatcggcag
EU239226_PreS1_P-E      tgctaaaaacattgccagcaaatccgcctcctgcctccaccaatcggcag
EU239217_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB274969_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB274978_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
MN967527_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB205129_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB205192_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MN507848_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
MH580631_PreS1_P-E      tgctaaaaacgttgccagcagatccgcctcctgcctccaccaatcggcag
MH580632_PreS1_P-E      tgctaaaaacgttgccagcagatccgcctcctgcctccaccaatcggcag
MH580652_PreS1_P-E      tgctaaaaacgttgccagcagatccgcctcctgcctccaccaatcggcag
GQ161773_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161802_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363605_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494705_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MH918655_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FN545827_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
MF772362_PreS1_P-E      tgttaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736893_PreS1_P-E      tgctgacaacattgccagcaaatccgcctcctgcttccaccaatcggcag
HM363590_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MH580621_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
MH580625_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
MH580622_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
MH580637_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
HM363573_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
AB194947_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
MH580634_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
MH580635_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
MH580636_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
MH580647_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
MH580624_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
MH580646_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
MH580649_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
MH580629_PreS1_P-E      tgctaaaaatgttgccagcagatccgcctcctgcctccaccaatcggcag
HM363604_PreS1_P-E      tgcaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363592_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FN594759_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MH580630_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736901_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF170789_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363574_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161758_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161766_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161774_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161755_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161835_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FJ349226_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB915177_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HQ700550_PreS1_P-E      tccaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HQ700552_PreS1_P-E      tccaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KM108624_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363583_PreS1_P-E      tgcacataacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363584_PreS1_P-E      tgcacataacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363575_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363576_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MF772360_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF170785_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161815_PreS1_P-E      tgctaaaaacattgccagcagttccgcctcctgcctccaccaatcggcag
KF170786_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363587_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363582_PreS1_P-E      tgcaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161811_PreS1_P-E      tgctaaaaacagtgccagcagatccgcctcctgcctccaccaatcggcag
AM494699_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363585_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MH580614_PreS1_P-E      tgctaaaaacattgccaacagatccgcctcctgcctccaccaatcggcag
MH580615_PreS1_P-E      tgctaaaaacattgccaacagatccgcctcctgcctccaccaatcggcag
MH580616_PreS1_P-E      tgctaaaaacattgccaacagatccgcctcctgcctccaccaatcggcag
MH580618_PreS1_P-E      tgctaaaaacattgccaacagatccgcctcctgcctccaccaatcggcag
MH580619_PreS1_P-E      tgctaaaaacattgccaacagatccgcctcctgcctccaccaatcggcag
MH580620_PreS1_P-E      tgctaaaaacattgccaacagatccgcctcctgcctccaccaatcggcag
MH580623_PreS1_P-E      tgctaaaaacattgccaacagatccgcctcctgcctccaccaatcggcag
MH580651_PreS1_P-E      tgctaaaaacattgccaacagatccgcctcctgcctccaccaatcggcag
GQ161778_PreS1_P-E      tgcaaaaatcattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161810_PreS1_P-E      tgcwaaaatcattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161808_PreS1_P-E      tgctaaaatcattgccagcagatccgcctcctgcctccaccaatcggcag
AM494704_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736891_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736892_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AB201287_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
X75657_PreS1_P-E        tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MN967529_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MN967528_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MH580644_PreS1_P-E      tgctaaaaacagtgccagcagatccgcctcctgcctccaccaatcggcag
MH580640_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MH580641_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MH580617_PreS1_P-E      tgctaaaaacagtgccagcagatccgcctcctgcctccaccaatcggcag
MH580628_PreS1_P-E      tgctaaaaacagtgccagcagatccgcctcctgcctccaccaatcggcag
LT623850_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
LT623848_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
LT623846_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736911_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736909_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736904_PreS1_P-E      tgcaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736902_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF170788_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KF170742_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363596_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363577_PreS1_P-E      tgctaaaaacattgccaacagatccgcctcctgcctccaccaatcggcag
DQ060830_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
FN545841_PreS1_P-E      tgctaacaacattgccagcagatccgcctcctgcctccaccaatcggcag
MW455161_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363568_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363567_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
GQ161780_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KX186584_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363569_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363570_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
HM363571_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736912_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736910_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736906_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcgrcag
KU736903_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494715_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494713_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcat
AM494707_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494702_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494701_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494693_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494690_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494708_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
AM494717_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736900_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736905_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736907_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
KU736908_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MK321264_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MK720631_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
MK720632_PreS1_P-E      tgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcag
                                     **           **       *     *   *    

MW679682_PreS1_