Dataset for nucleotide sequence Genomes of genotype E

[Download (right click)] [Edit] [Sequences] [Repertoires]

376 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

GQ161775_FT00000_P-E      ttccacaacattccaccaacctctgcagaatcccagagtaagaggtcagg
HM363611_FT00000_P-E      ttccaaaacattccaccaagctctacaggaccccagagtaagaggcctgt
LT623851_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MF772356_FT00000_P-E      tgccacaacattccaccaagctctgcaggatcccaaagtaag--------
AB915180_FT00000_P-E      ttccacgacattccaccaagctctgcaggatccca---------------
EU239220_FT00000_P-E      ttccacaacattccaccaaaatctgcaggatcccagagtaagaggcctgt
MF772355_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgt
FN594762_FT00000_P-E      ttccacaacattccaccaagctctgctggatcccacagtaggaggcctgt
HM363610_FT00000_P-E      ttccacaacattccacaaagctctgcaggatcccagagtaagaggcctgt
AB915178_FT00000_P-E      ttccaagacattccaccaagctctgcaggatmccagagtaagaggcctgt
FN594760_FT00000_P-E      ttccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FN594758_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FN594759_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849720_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736913_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849728_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccaaagcaaaa-------
AM494695_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849724_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494703_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736902_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736892_FT00000_P-E      ttccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgt
KU736891_FT00000_P-E      ttccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgt
X75657_FT00000_P-E        ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MN967527_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MN967526_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgt
KU736904_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736909_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494698_FT00000_P-E      ttccacaacattccaccaagctctgcaggatccc----------------
KF170742_FT00000_P-E      ttccacaacattccaccaaactctgcaggatcccagagtaagaggcctgt
MK720632_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MK720631_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MK321264_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736903_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494699_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgt
KU736911_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736910_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736905_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736912_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736906_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736908_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736907_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494713_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494707_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494701_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494715_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494693_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494704_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494690_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MN967529_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MN967528_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494708_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494717_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494702_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB201290_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KM606738_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctga
DQ060827_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
DQ060826_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
DQ060829_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
DQ060828_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
JQ000008_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MN507841_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaaaaacctgt
JQ000009_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849726_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849715_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH464856_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849716_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AY738147_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagggtaagaggcctgt
AY738146_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagggtaagaggcctgt
AY738144_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagggtaagaggcctgt
AY738145_FT00000_C-E      ttccacaacattccaccaagctctgcaggatcccagggtaagaggcctgt
KF849717_FT00000_P-E      ttccacaacattccaccaaactctgcaggatcccagagtaagaggcctgt
KF849718_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849723_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
OM256457_FT00000_P-E      ttccacaayattccaccaarctctgcaggatcccagagtaagaggcctgt
DQ060822_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849725_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849727_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MF772354_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
DQ060823_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AY935700_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF922438_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF922439_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KT192626_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849714_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849713_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
DQ060825_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
DQ060824_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849719_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849722_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KF849721_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363598_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363602_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgt
HM363601_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363604_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggtctgt
HM363597_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363586_FT00000_P-E      ttccacaaaattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363592_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctat
HM363587_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363591_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363590_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363589_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363588_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363568_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363567_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgg
HM363565_FT00000_P-E      ttccacaacattccaccaagctctgcaggaccccagagtaaggggcctgt
MW679682_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MF772358_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaag--------
LT623843_FT00000_P-E      ttccacaacattccgccaagctctgcaggatcccagagtaagarrcctgw
FN594753_FT00000_P-E      ttccacaaagttccaccaagctctgcaggatcccagg-------------
AB274984_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaggggcctgc
FN594765_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363607_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgt
HM363603_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtacgaggcctgt
HM363605_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FN594748_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363606_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363599_FT00000_P-E      ttccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgt
HM363566_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363608_FT00000_P-E      ttccagaacatttcaccaagctctgcaggatcccagagtaagaggcctgt
AB219529_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaca-------
FN594766_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MN507842_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB106564_FT00000_C-E      ctccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MF772357_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580648_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FN545822_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagaataaaaggcctgt
GQ161825_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgt
FN594761_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161831_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtgaga-------
AB219533_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaaaaacctgt
GQ161768_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB274979_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MZ962197_FT00000_P-E      ttacacagcattccaccaagctctgcaggatcccagagtaagacacctgt
LT623847_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363600_FT00000_P-E      ttcaacaacattccaccaaactctgcagaatcccagagtaacaggcctgt
LT623844_FT00000_P-E      ttccacaacattccacaaagctctgcaggatcccagagtaagaggcctgt
AB274977_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgt
FN594749_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB194948_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363609_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161796_FT00000_P-E      ttacacaacattccaccaagctctgcaggatcccaaagtaaga-------
FJ349240_FT00000_P-E      ttccaccacattccaccaagctctgcaggatcccaaagtaa---------
MH580645_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB205188_FT00000_P-E      ttccacaacatttcaccaagctctgcaggatcccagagta----------
AB274975_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FN594756_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaacaggcctgt
HM363596_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FN545823_FT00000_P-E      ttctacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB274973_FT00000_P-E      ttccacaacattccaccaagttcagcaggatcacagagtaagaggcctg-
LT623842_FT00000_P-E      ttccayaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FN545821_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccaaagtaaaaggcctgt
AM494691_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaggggcctgt
EU239222_FT00000_P-E      ttccacaacattccaccaagctctgcagaatcccagagtaagaggcctgt
AM494692_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494711_FT00000_P-E      ttccacaacattccaccaaactctgcaggatcccagagtaaggggcctgt
MZ962195_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB274980_FT00000_P-E      ttccacaacattccaccaggctctgcaggatcccagagtaagaggcctgt
AB274981_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FN594751_FT00000_P-E      ttccaaaacattccaccaagctctgcaggatcccagagtaagaggccttc
MH580626_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccaaagtaaa--------
MW455162_FT00000_P-E      ttacaaaacattccaccaagatctgcagaatcccagagtaagaggcctgt
KT749841_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB274978_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaacaggcctgt
EU239217_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FN594750_FT00000_P-E      ttccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MZ962189_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161820_FT00000_P-E      ttccacaacattccaccaagmtctgcaggatcccagagtaagaggcctgt
HM363595_FT00000_P-E      ttccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgt
GQ161823_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaaaggc----
AB205190_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaggggcctgt
MW455165_FT00000_P-E      ttccacaacattccacaaagctctgcaggatcccagagtaagaggcctgt
AB274985_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctg-
MZ962194_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161794_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MZ962190_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MZ962196_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161755_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161835_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MN507840_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
LT623849_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB274982_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MN507847_FT00000_P-E      ttccacaacattccaacaagctctgcaggatcccagagtaagaggcctgt
GQ161836_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgt
MZ962198_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagcggcctgt
FN545842_FT00000_P-E      ttccacagcattccaccaagctctgcaggatcccagagtaaaaggcctgt
GQ161757_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494714_FT00000_P-E      ttccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494712_FT00000_P-E      ttccaaaacattccaccaagctctgcaggatcccagagtaaggggcctgt
GQ161786_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
LT623845_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161826_FT00000_P-E      ttccacaacattccaccaagctctgcaggatccca---------------
GQ161797_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccaaaatcagaggcccgt
GQ161762_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494689_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccatagtaar--------
FN594752_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgt
GQ161807_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtgagaggcctgt
KM606739_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161785_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363594_FT00000_P-E      ttccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgt
AB201287_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161811_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MW455163_FT00000_P-E      ttccacaacattccacaaagctctgcaggatcccagagtaagaggcctgt
MW455164_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161824_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaaaggtctgt
GQ161783_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaaaggtctgt
GQ161802_FT00000_P-E      ttccacaacattccaccaaactctgcaggatcccagagtaagaggcctgt
GQ161773_FT00000_P-E      ttccacaacattccaccaaactctgcaggatcccagagtaagaggcctgt
HM363593_FT00000_P-E      ttccaaaacattccaccaagctctacaggaccccagagtaagaggcctgt
LT623846_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MN507844_FT00000_P-E      ttacaaaacattccaccaagatctgcagaatcccagagtaagaggcctgt
HM363578_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
EU239224_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FN545827_FT00000_P-E      ttccacagcattccaccaagctctgcaggatcccagagtaag--------
FN594763_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
DQ060830_FT00000_P-E      ttccacaacattccaccaagctctgcaagatcccagagtaagaggcctgt
HQ700550_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HQ700552_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363572_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagatgcctgt
MT426115_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363580_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363579_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363581_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580631_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580632_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580652_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MW679683_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363584_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgt
HM363583_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgt
HM363582_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HQ700551_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagt-----------
KF170741_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB915175_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaaacctgt
AB201289_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB274976_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB205192_FT00000_P-E      ttccacagcattccaccaagctctgcaggatcccaaagtaagaggcctgt
AB205129_FT00000_P-E      ttccacagcattccaccaagctctgcaggatcccaaagtaagaggcctgt
AB205189_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161760_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctga
MZ962192_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtacgaggcctgt
AM494710_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494709_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580650_FT00000_P-E      ttccccaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494697_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgt
AB091256_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363573_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580633_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaa---------
MH580634_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580636_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580635_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580647_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580622_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580625_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580621_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580637_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB194947_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580629_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580649_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580646_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580624_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363585_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161803_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FJ349226_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MF772360_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AY739675_FT00000_P-E      ctccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AY739674_FT00000_P-E      ctccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB274970_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
LT623848_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MW455161_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161774_FT00000_P-E      ttacacaacattccaccaagctctgcaggatcccagagtaaaaggcctgt
GQ161758_FT00000_P-E      ttacacaacattccaccaagctctgcaggatcccagagtaaaaggcctgt
GQ161766_FT00000_P-E      ttacacaacattccaccaagctctgcaggatcccagagtaaaaggcctgt
EU239219_FT00000_P-E      ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgt
EU239223_FT00000_P-E      ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgt
GQ161834_FT00000_P-E      ttccacaacattccaccaagctcttcaggatcccagagtaagaggcctgt
EU239221_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363576_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363575_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363574_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggtctgt
AB201288_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580638_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161815_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MW082636_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
LT623850_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagaataagaggcctgt
KU736901_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB205191_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161828_FT00000_P-E      ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgt
GQ161776_FT00000_P-E      ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgt
GQ161789_FT00000_P-E      ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgt
GQ161784_FT00000_P-E      ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgt
AB091255_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MN507843_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161812_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AB274974_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580630_FT00000_P-E      ttccacaacattccaccaaactctgcaagatcccagagtaagaggcctgt
AM494706_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MZ962191_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FJ349239_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161833_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363577_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736894_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH918655_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggtctgt
GQ161814_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161792_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161782_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161790_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MN507845_FT00000_P-E      ttccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494694_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494696_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
AM494700_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363569_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363570_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580628_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580617_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580644_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161756_FT00000_P-E      ttccacaacattccaccaagctctgcca----------------------
GQ161795_FT00000_P-E      ttccacaacattccaccaagctctgcca----------------------
AB274969_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161771_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FJ349237_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
FJ349238_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736898_FT00000_P-E      ttccacaacattccaccaaactctgcaggatcccagagtaagaggcctgt
KU736897_FT00000_P-E      ttccacaacattccaccaaactctgcaggatcccagagtaagaggcctgt
AM494705_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736893_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580641_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580640_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161777_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161763_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MF772362_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161761_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtgagaggcctgt
MN507846_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161765_FT00000_P-E      ttccacaacattccatcaagctctgcaggatcccagagtaagaggcctgt
GQ161769_FT00000_P-E      ttccacaacattccatcaagctctgcaggatcccagagtaagaggcctgt
GQ161779_FT00000_P-E      ttccacaacattccatcaagctctgcaggatcccagagtaagaggcctgt
GQ161759_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
HM363571_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736900_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161808_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161778_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161810_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736895_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736896_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KU736899_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
EU239226_FT00000_P-E      ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgt
GQ161832_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MZ962193_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgt
MH580616_FT00000_P-E      ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580615_FT00000_P-E      ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580623_FT00000_P-E      ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580614_FT00000_P-E      ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580651_FT00000_P-E      ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580618_FT00000_P-E      ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580619_FT00000_P-E      ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgt
MH580620_FT00000_P-E      ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgt
FN545841_FT00000_P-E      ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgt
AB274971_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161817_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MN507848_FT00000_P-E      ttctacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161801_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161780_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
MZ962199_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161829_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161770_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161791_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161800_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161819_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161764_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161816_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
KX186584_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161798_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtacgaggcctgt
GQ161772_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161787_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161781_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161804_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161827_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
GQ161793_FT00000_P-E      ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgt
                                    ** *   *   **  *                        

GQ161775_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363611_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
LT623851_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MF772356_FT00000_P-E      ----tcctgctggtggctccagttccggaacagtaaaccctgttccgact
AB915180_FT00000_P-E      ---ctcctgctggtggctccagttccggaacagtgaaccctgttccgact
EU239220_FT00000_P-E      attttcctgctggtggctccagttccgggacagtgaaccctgttccgact
MF772355_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaamcctgttccgact
FN594762_FT00000_P-E      cttctcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363610_FT00000_P-E      atcttcctgctggtggctccagttcaggaaaagtgaaccctgttccgact
AB915178_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
FN594760_FT00000_P-E      mttttcctgctggtggctccagttccggaacagtgaaccctgttccgact
FN594758_FT00000_P-E      mttttcctgctggtggctccagttccggaacagtgaaccctgttccgact
FN594759_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849720_FT00000_P-E      at---cctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736913_FT00000_P-E      atattcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849728_FT00000_P-E      -----cctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494695_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849724_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494703_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736902_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736892_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736891_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
X75657_FT00000_P-E        attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MN967527_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MN967526_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736904_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736909_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494698_FT00000_P-E      -----cctgctggtggctccagttccggaacagtgaaccctgttccgact
KF170742_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MK720632_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MK720631_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MK321264_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736903_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494699_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736911_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736910_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736905_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736912_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736906_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736908_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736907_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494713_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494707_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494701_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494715_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494693_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494704_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494690_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MN967529_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MN967528_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494708_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494717_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494702_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB201290_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KM606738_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccatgttccgact
DQ060827_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
DQ060826_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
DQ060829_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
DQ060828_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
JQ000008_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MN507841_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
JQ000009_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849726_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849715_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH464856_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849716_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AY738147_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AY738146_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AY738144_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AY738145_FT00000_C-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849717_FT00000_P-E      attttcctgctggtggctccagttccgggacagtaaaccctgttccgact
KF849718_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849723_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
OM256457_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
DQ060822_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849725_FT00000_P-E      attttcctgctggtggctccagttcaggaacagtgaaccctgttccgact
KF849727_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MF772354_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
DQ060823_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AY935700_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF922438_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF922439_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KT192626_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849714_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849713_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
DQ060825_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
DQ060824_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849719_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849722_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF849721_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363598_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363602_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363601_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtaaaccctgttccgact
HM363604_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363597_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363586_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363592_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363587_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363591_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363590_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363589_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363588_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363568_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363567_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363565_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MW679682_FT00000_P-E      atttttctgctggtggctccagttccggaacagtgaaccctggtccgact
MF772358_FT00000_P-E      ----tcctgctggtggctccagttccggaacagtgaaccctgttccgact
LT623843_FT00000_P-E      atcytcytgctggtggctccagttccggaacagtgaaccctgttccgact
FN594753_FT00000_P-E      --cctcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB274984_FT00000_P-E      aattccctgctggtggctccagttccggaacagtgagccctgttccgact
FN594765_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363607_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363603_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363605_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
FN594748_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363606_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363599_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363566_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363608_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB219529_FT00000_P-E      -----cctgctggtggctccagttccggaacagtgaaccctgttccgact
FN594766_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttcggact
MN507842_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB106564_FT00000_C-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MF772357_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580648_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
FN545822_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161825_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
FN594761_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161831_FT00000_P-E      -----cctgctggtggctccagttccggaacagtgaaccctgttccgact
AB219533_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161768_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB274979_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MZ962197_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
LT623847_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363600_FT00000_P-E      atcctcctgctggtggctccagttccggaacagtgaaccctgttccgact
LT623844_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB274977_FT00000_P-E      attttcctgctggtggctccagttccggaacagtaaaccctgttccgact
FN594749_FT00000_P-E      attctcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB194948_FT00000_P-E      atcgtcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363609_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161796_FT00000_P-E      -----cctgctggtggctccagttccggaacagtgaaccctgttccgact
FJ349240_FT00000_P-E      ---ctcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580645_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB205188_FT00000_P-E      -----cctgctggtggctccagttccggaacagtgaaccctgttccgact
AB274975_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtaaaccctgttccgact
FN594756_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363596_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
FN545823_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB274973_FT00000_P-E      -----cctgctggtggctccagttccggaacagtgaaccctgttccgact
LT623842_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
FN545821_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494691_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
EU239222_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgacc
AM494692_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494711_FT00000_P-E      a---tcctgctggtggctccagttccggaacagtgaaccctgttccgact
MZ962195_FT00000_P-E      attttcctgctggtggccccaattccggaacaaggaaccctgttccgact
AB274980_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB274981_FT00000_P-E      attttcctgctggtggctccagttccggaacagtaaaccctgttccgact
FN594751_FT00000_P-E      attyttccgctggtggctccagttccggaacagtgaaccctgttccgact
MH580626_FT00000_P-E      ----tcctgctggtggctccagtttcggaacagtgaaccctgttccgact
MW455162_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KT749841_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgaat
AB274978_FT00000_P-E      attttcctgctggtggctccagttccggaacagtaaaccctgttccgact
EU239217_FT00000_P-E      attttcctgctggtggctccagttccggaacagtaaaccctgttccgact
FN594750_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MZ962189_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161820_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363595_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161823_FT00000_P-E      -----cctgctggtggctccagttccggaacagtgaaccctgttccgact
AB205190_FT00000_P-E      ttcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MW455165_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB274985_FT00000_P-E      -----cctgctggtggctccagttccggaacagtgaaccctgttccgact
MZ962194_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161794_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MZ962190_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MZ962196_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161755_FT00000_P-E      attttcctgctggtggctccagtttcggaacagtgaaccctgttccgact
GQ161835_FT00000_P-E      attttcctgctggtggctccagtttcggaacagtgaaccctgttccgact
MN507840_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
LT623849_FT00000_P-E      attttcctgctggtggctccagttccggaacagtaaaccctgttccgact
AB274982_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MN507847_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161836_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MZ962198_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccccgttcccgct
FN545842_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161757_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494714_FT00000_P-E      atcctcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494712_FT00000_P-E      a---tcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161786_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
LT623845_FT00000_P-E      attatcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161826_FT00000_P-E      ---ttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161797_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161762_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494689_FT00000_P-E      ----tcctgctggtggctccagttccggaacagtgaaccctgttccgact
FN594752_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161807_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KM606739_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161785_FT00000_P-E      atcctcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363594_FT00000_P-E      attttcctgctggtggctccagttccggaacagtaaaccctgttccgact
AB201287_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161811_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MW455163_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MW455164_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161824_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161783_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161802_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161773_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363593_FT00000_P-E      atcttcctgctggtggctctcattccggaacagtgaaccctgttccgact
LT623846_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MN507844_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363578_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
EU239224_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
FN545827_FT00000_P-E      ----tcctgctggtggctccagttccggaacagtgaaccctgttccgact
FN594763_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
DQ060830_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HQ700550_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HQ700552_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363572_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MT426115_FT00000_P-E      atttccctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363580_FT00000_P-E      atttccctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363579_FT00000_P-E      atttccctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363581_FT00000_P-E      atttccctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580631_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580632_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580652_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MW679683_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363584_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363583_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363582_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HQ700551_FT00000_P-E      ----tcctgctggtggctccagttccggaacagtgaaccctgttccgact
KF170741_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB915175_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB201289_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB274976_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB205192_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgagccctgttccgact
AB205129_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgagccctgttccgact
AB205189_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161760_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MZ962192_FT00000_P-E      atgttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494710_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494709_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgacc
MH580650_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494697_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB091256_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363573_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580633_FT00000_P-E      ------ctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580634_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580636_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580635_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580647_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580622_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580625_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580621_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580637_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB194947_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580629_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580649_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580646_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580624_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363585_FT00000_P-E      cttttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161803_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
FJ349226_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MF772360_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AY739675_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AY739674_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB274970_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgagccctgttccgact
LT623848_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MW455161_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161774_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161758_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161766_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
EU239219_FT00000_P-E      attttcctgctggtggctccagttccgaaacagtgaaccctgttccgact
EU239223_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161834_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
EU239221_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363576_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363575_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363574_FT00000_P-E      attttcctgctggtggctccagttccggaacagtaaaccctgttccgact
AB201288_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580638_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161815_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MW082636_FT00000_P-E      atcttcctgctggtggctccagttccggaacagtgaaccctgttccgact
LT623850_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736901_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB205191_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161828_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161776_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161789_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161784_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB091255_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MN507843_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161812_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgagccctgttccgact
AB274974_FT00000_P-E      attttcctgctggtggcttcagttccggaacagtgaaccctgttccgact
MH580630_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494706_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MZ962191_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
FJ349239_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161833_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363577_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736894_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH918655_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161814_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgagccctgttccgact
GQ161792_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgagccctgttccgact
GQ161782_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgagccctgttccgact
GQ161790_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MN507845_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494694_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494696_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494700_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363569_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363570_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580628_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580617_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580644_FT00000_P-E      attttcctgctggtggctccagttccggaacagcgaaccctgttccgact
GQ161756_FT00000_P-E      -----cctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161795_FT00000_P-E      -----cctgctggtggctccagttccggaacagtgaaccctgttccgact
AB274969_FT00000_P-E      attttcctgctggtggctccagttccggaacagtaaaccctgttccgact
GQ161771_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
FJ349237_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
FJ349238_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736898_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736897_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AM494705_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736893_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580641_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580640_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161777_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161763_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MF772362_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161761_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MN507846_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161765_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161769_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161779_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161759_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
HM363571_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736900_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161808_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161778_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161810_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736895_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736896_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KU736899_FT00000_P-E      attttcctgctggtggctccagtttcggaacagtgaaccctgttccgact
EU239226_FT00000_P-E      attttcctgctggtggctccagttccggaacagtaaaccctgttccgact
GQ161832_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MZ962193_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580616_FT00000_P-E      a---tcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580615_FT00000_P-E      a---tcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580623_FT00000_P-E      a---tcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580614_FT00000_P-E      a---tcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580651_FT00000_P-E      a---tcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580618_FT00000_P-E      a---tcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580619_FT00000_P-E      a---tcctgctggtggctccagttccggaacagtgaaccctgttccgact
MH580620_FT00000_P-E      a---tcctgctggtggctccagttccggaacagtgaaccctgttccgact
FN545841_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
AB274971_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161817_FT00000_P-E      attttcctgttggtggctccagttccggaacagtgaaccctgttccgact
MN507848_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161801_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161780_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
MZ962199_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161829_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161770_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161791_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161800_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161819_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161764_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161816_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
KX186584_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161798_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161772_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161787_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161781_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161804_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161827_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
GQ161793_FT00000_P-E      attttcctgctggtggctccagttccggaacagtgaaccctgttccgact
                                  * *******     **  *  * *   *  *  * **     

GQ161775_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363611_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
LT623851_FT00000_P-E      actgcctcactcatatcgtcaatcttctcgaggattggggaccctgcacc
MF772356_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccatgcacc
AB915180_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
EU239220_FT00000_P-E      actgcctcactcacctcgtcaatcttctcgaggattggggaccctgcacc
MF772355_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgtacc
FN594762_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363610_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB915178_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
FN594760_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN594758_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN594759_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849720_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736913_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849728_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggtccctgcacc
AM494695_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849724_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494703_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736902_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736892_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccytgcacc
KU736891_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
X75657_FT00000_P-E        actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MN967527_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MN967526_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736904_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736909_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccytgcacc
AM494698_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF170742_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MK720632_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MK720631_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MK321264_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736903_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494699_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736911_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736910_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736905_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736912_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736906_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736908_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736907_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494713_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494707_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494701_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494715_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494693_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494704_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494690_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MN967529_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MN967528_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcatc
AM494708_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494717_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494702_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB201290_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KM606738_FT00000_P-E      actgtctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
DQ060827_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
DQ060826_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
DQ060829_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
DQ060828_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
JQ000008_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MN507841_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
JQ000009_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849726_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849715_FT00000_P-E      actgcctcactcatctcctcaatcttctcgaggactggggaccctgcacc
MH464856_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849716_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AY738147_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AY738146_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AY738144_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AY738145_FT00000_C-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849717_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849718_FT00000_P-E      actgtctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849723_FT00000_P-E      actgtctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
OM256457_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccytgcacc
DQ060822_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849725_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849727_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MF772354_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
DQ060823_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AY935700_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF922438_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF922439_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KT192626_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849714_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849713_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
DQ060825_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
DQ060824_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849719_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849722_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF849721_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363598_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363602_FT00000_P-E      actgcctcacgcatctcgtcaatcttctcgaggattggggaccttgcacc
HM363601_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363604_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363597_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363586_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363592_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363587_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaagattggggaccctgcacc
HM363591_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363590_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363589_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363588_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363568_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363567_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363565_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
MW679682_FT00000_P-E      actgccttactcatctcgtcaatcttctcgagggttgggggccctgcccc
MF772358_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaagattggggtccctgcacc
LT623843_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
FN594753_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
AB274984_FT00000_P-E      actgtctcacgcatctcgtcaatcttctcgaggattggggaccttgcacc
FN594765_FT00000_P-E      actgcctcactcatatcgtcaatcttctcgaggattggggaccttgcacc
HM363607_FT00000_P-E      actgcatcactcatatcgtcaatcttctcgaggattggggaccctgcacc
HM363603_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363605_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN594748_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363606_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
HM363599_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccatgcacc
HM363566_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcact
HM363608_FT00000_P-E      actgtctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB219529_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN594766_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MN507842_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB106564_FT00000_C-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MF772357_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcatc
MH580648_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN545822_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
GQ161825_FT00000_P-E      actgcatcactcatctcgtcaatcttctcgaggattggggaccttgcacc
FN594761_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
GQ161831_FT00000_P-E      actgcctcactcatctcgtcaatctcctcgaggattggggaccctgcacc
AB219533_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161768_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB274979_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MZ962197_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
LT623847_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
HM363600_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
LT623844_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccytgcacc
AB274977_FT00000_P-E      actgtctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN594749_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB194948_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363609_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161796_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
FJ349240_FT00000_P-E      actgcctctctcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580645_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB205188_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB274975_FT00000_P-E      actgcctcactcatctcgtcaatctcctcgaggattggggaccctgtacc
FN594756_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363596_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN545823_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattgggggccttgcacc
AB274973_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccatgcacc
LT623842_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN545821_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494691_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
EU239222_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
AM494692_FT00000_P-E      actgcctcactcatatcgtcaatcttctcgaggattggggaccctgcacc
AM494711_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
MZ962195_FT00000_P-E      actgccttactcctctcctcaatcttcccgaggattgggggcttggcacc
AB274980_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB274981_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN594751_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
MH580626_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
MW455162_FT00000_P-E      actgcctcactcatatcgtcaatcttctcgaggattggggaccttgcacc
KT749841_FT00000_P-E      actgcctctctcatctcgtcaatcttctcgaggattggggaccctgcacc
AB274978_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
EU239217_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN594750_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MZ962189_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggatcctgcacc
GQ161820_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363595_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaca
GQ161823_FT00000_P-E      actgtctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB205190_FT00000_P-E      actgcctcactcatctcatcaatcttctcgaggattggggaccctgcacc
MW455165_FT00000_P-E      actgcctcactcgtatcgtcaatcttctcgaggattggggaccctgcacc
AB274985_FT00000_P-E      actgcctcactcatatcgtcaatcttctcgaggattggggaccctgcacc
MZ962194_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161794_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MZ962190_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MZ962196_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161755_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161835_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MN507840_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
LT623849_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB274982_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MN507847_FT00000_P-E      actgcctcactcgtatcgtcaatcttctcgaggattggggaccctgcacc
GQ161836_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgacgattggggaccctgcacc
MZ962198_FT00000_P-E      actgcctcactcatctcctcaatcttctccaggattggcgaccttgtacc
FN545842_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
GQ161757_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494714_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494712_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
GQ161786_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
LT623845_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161826_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161797_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161762_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaca
AM494689_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN594752_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161807_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
KM606739_FT00000_P-E      actgcctcactcatctcgtcaatcgtctcgaggattggggaccttgcacc
GQ161785_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363594_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
AB201287_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161811_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MW455163_FT00000_P-E      actgcctcactcatatcgtcaatcttctcgaggattggggaccttgcacc
MW455164_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161824_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161783_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161802_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgctcc
GQ161773_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgctcc
HM363593_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
LT623846_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MN507844_FT00000_P-E      actgcctcactcatatcgtcaatcttctcgaggattggggaccttgcacc
HM363578_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
EU239224_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN545827_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN594763_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
DQ060830_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HQ700550_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HQ700552_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363572_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MT426115_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363580_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363579_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363581_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580631_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580632_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580652_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MW679683_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363584_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363583_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363582_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HQ700551_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KF170741_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB915175_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB201289_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB274976_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB205192_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB205129_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB205189_FT00000_P-E      actgtctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161760_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MZ962192_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494710_FT00000_P-E      actgtctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494709_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcact
MH580650_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494697_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB091256_FT00000_P-E      actgtctctctcatctcgtcaatcttctcgaggactggggaccctgcacc
HM363573_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580633_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacg
MH580634_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacg
MH580636_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacg
MH580635_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacg
MH580647_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580622_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580625_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580621_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580637_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB194947_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580629_FT00000_P-E      tctgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580649_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580646_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580624_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363585_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161803_FT00000_P-E      actgcctcactcatctcgtcaaccttctcgaggattggggaccctgcacc
FJ349226_FT00000_P-E      actgcctcactcatctcgtcaatcttctccaggattggggaccctgcacc
MF772360_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AY739675_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccttgcacc
AY739674_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB274970_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
LT623848_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MW455161_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161774_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161758_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161766_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
EU239219_FT00000_P-E      actgcctctctcatctcgtcaatcttctcgaggattggggaccctgcacc
EU239223_FT00000_P-E      actgcctctctcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161834_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
EU239221_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363576_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363575_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363574_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB201288_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580638_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161815_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MW082636_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
LT623850_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736901_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB205191_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161828_FT00000_P-E      actgcctctctcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161776_FT00000_P-E      actgcctctctcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161789_FT00000_P-E      actgcctctctcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161784_FT00000_P-E      actgcctctctcatctcgtcaatcttctcgaggattggggaccctgcacc
AB091255_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MN507843_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161812_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB274974_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580630_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcgcc
AM494706_FT00000_P-E      actgcctctctcatctcgtcaatcttctcgaggattggggaccctgcacc
MZ962191_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FJ349239_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161833_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363577_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736894_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH918655_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161814_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161792_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161782_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161790_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MN507845_FT00000_P-E      actgcctcactcacctcgtcaaccttctcgaggattggggaccctgcacc
AM494694_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggawtggggaccctgcacc
AM494696_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494700_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363569_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363570_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580628_FT00000_P-E      actgtctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580617_FT00000_P-E      actgtctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580644_FT00000_P-E      actgtctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161756_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161795_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB274969_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161771_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FJ349237_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FJ349238_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736898_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736897_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AM494705_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736893_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580641_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580640_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161777_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161763_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MF772362_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161761_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MN507846_FT00000_P-E      actgtctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161765_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161769_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161779_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161759_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
HM363571_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736900_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161808_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161778_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161810_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736895_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736896_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KU736899_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
EU239226_FT00000_P-E      actgcctcactcatctcgccaatcttctcgaggattggggaccctgcacc
GQ161832_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MZ962193_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580616_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580615_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580623_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580614_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580651_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580618_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580619_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MH580620_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
FN545841_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
AB274971_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161817_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MN507848_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161801_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161780_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
MZ962199_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161829_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161770_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161791_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161800_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161819_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161764_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161816_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
KX186584_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161798_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161772_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161787_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161781_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161804_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161827_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
GQ161793_FT00000_P-E      actgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacc
                           ***  *  * *   **  *** *  * * * *  *** *     *    

GQ161775_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363611_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
LT623851_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MF772356_FT00000_P-E      gaacatggaaagcatcacatcaggattcccagaacccctgcgcgtgttac
AB915180_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
EU239220_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MF772355_FT00000_P-E      gaacatggagagcatcacatcaggattcctaggacccctgctcgtgttac
FN594762_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363610_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB915178_FT00000_P-E      gaacatggagagcatcacatcaggattcctaggacccctgctcgtgttac
FN594760_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FN594758_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FN594759_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF849720_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736913_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF849728_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494695_FT00000_P-E      gaatatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF849724_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
AM494703_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736902_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736892_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736891_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
X75657_FT00000_P-E        gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MN967527_FT00000_P-E      gaacatggaaagcaccacatcaggattcctaggacccctgctcgtgttac
MN967526_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736904_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736909_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494698_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF170742_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MK720632_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MK720631_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MK321264_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736903_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494699_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736911_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736910_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736905_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736912_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736906_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736908_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736907_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494713_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494707_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494701_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494715_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494693_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494704_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494690_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MN967529_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MN967528_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494708_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494717_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494702_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB201290_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
KM606738_FT00000_P-E      gaacatggaaagcattacatcaggattcctaggacccctgctcgtgttac
DQ060827_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
DQ060826_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
DQ060829_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
DQ060828_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
JQ000008_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MN507841_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
JQ000009_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
KF849726_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF849715_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
MH464856_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgcgttac
KF849716_FT00000_P-E      gaacatggacagcatcacatcaggattcctaggacccctgctcgtgttac
AY738147_FT00000_P-E      gaacatggacagcatcacatcaggattcctaggacccctgctcgtgttac
AY738146_FT00000_P-E      gaacatggacagcatcacatcaggattcctaggacccctgctcgtgttac
AY738144_FT00000_P-E      gaacatggacagcatcacatcaggattcctaggacccctgctcgtgttac
AY738145_FT00000_C-E      gaacatggacagcatcacatcaggattcctaggacccctgctcgtgttac
KF849717_FT00000_P-E      gaaaatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF849718_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF849723_FT00000_P-E      gaacatggaaagcattacatcaggattcctaggacccctgctcgtgttac
OM256457_FT00000_P-E      gaacatggaaagcattacatcaggattcctaggacccctgctcgtgttac
DQ060822_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF849725_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
KF849727_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MF772354_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
DQ060823_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AY935700_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF922438_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF922439_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KT192626_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF849714_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
KF849713_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
DQ060825_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
DQ060824_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
KF849719_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF849722_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF849721_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363598_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363602_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgcgttac
HM363601_FT00000_P-E      gaacatggaaagcatcacgtcaggattcctaggacccctgctcgtgttac
HM363604_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363597_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363586_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363592_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
HM363587_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363591_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363590_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363589_FT00000_P-E      gaacatggaaagcatcacgtcaggattcctaggacccctgctcgtgttac
HM363588_FT00000_P-E      gaacatggaaagcatcacgtcaggattcctaggacccctgctcgtgttac
HM363568_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363567_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363565_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MW679682_FT00000_P-E      gaacatggaaaggatcacatcaggattcctagggcccccgctcgtgttac
MF772358_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
LT623843_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtattac
FN594753_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
AB274984_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgcgcgtgttac
FN594765_FT00000_P-E      gaacatggaaagcatcacatcaggactcctaggacccctgctcgtgttac
HM363607_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363603_FT00000_P-E      gaacatggaaaccatcacatcaggattcctaggacccctgctcgtgttac
HM363605_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FN594748_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363606_FT00000_P-E      gaacatggaaagcatcacatccggattcctaggacccctgctcgtattac
HM363599_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
HM363566_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363608_FT00000_P-E      gaacatggaaagcattacatcaggattcctaggacccctgctcgtgttac
AB219529_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FN594766_FT00000_P-E      gaacatggaaagcaccacatcaggattcctaggacccctgcacgtgttac
MN507842_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB106564_FT00000_C-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MF772357_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580648_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FN545822_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
GQ161825_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
FN594761_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaagacccctgctcgtgttac
GQ161831_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
AB219533_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgggttac
GQ161768_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB274979_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
MZ962197_FT00000_P-E      gaacatggaaagcatcacgtcaggattcctagaacccctgcgcgtgttac
LT623847_FT00000_P-E      gaacatggaaaacatyacatcaggattcctaggacccctgctcgtgttac
HM363600_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
LT623844_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB274977_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FN594749_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
AB194948_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363609_FT00000_P-E      gaacatggaaagcaccacatccggattcctaggacccctgctcgtgttac
GQ161796_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FJ349240_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580645_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB205188_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtattac
AB274975_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FN594756_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363596_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FN545823_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB274973_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
LT623842_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FN545821_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494691_FT00000_P-E      gaacatggagagcatcacatcaggattcctcggacccctgctcgtgttac
EU239222_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
AM494692_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494711_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MZ962195_FT00000_P-E      ggacatggaaagcctcccatcaggattccttggacccctgcccgttttac
AB274980_FT00000_P-E      gaacatggaaagcatcacatcaggattcctcggacccctgctcgtgttac
AB274981_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FN594751_FT00000_P-E      gaacatggaaagcatcacatcaggactcctaggacccctgcccgtgttac
MH580626_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MW455162_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KT749841_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB274978_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
EU239217_FT00000_P-E      gagcatggaaagcatcacatcaggattcctaggacccctgctcgggttac
FN594750_FT00000_P-E      gaacatggaaagcatcacatccggattcctaggacccctgctcgtgttac
MZ962189_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
GQ161820_FT00000_P-E      gaacatggaargcatcacatcaggattcctaggacccctgctcgtgttac
HM363595_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161823_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB205190_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MW455165_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
AB274985_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MZ962194_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161794_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MZ962190_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
MZ962196_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161755_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
GQ161835_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
MN507840_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
LT623849_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB274982_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MN507847_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
GQ161836_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MZ962198_FT00000_P-E      gaccatggagagcatcacatcaggtttcctaggacccctgctcgcgttac
FN545842_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161757_FT00000_P-E      gaacatggaaagcatcacatcaagattcctaggacccctgctcgggttac
AM494714_FT00000_P-E      gaacatggaaagcatcacatcaagattcctaggacccctgctcgtgttac
AM494712_FT00000_P-E      gaacatggaaagcatcacatcarrattcctaggacccctgctcgtgttac
GQ161786_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
LT623845_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161826_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgcacgtgttac
GQ161797_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161762_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494689_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FN594752_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161807_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KM606739_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161785_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363594_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB201287_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgcattac
GQ161811_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
MW455163_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MW455164_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161824_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161783_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161802_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161773_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363593_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
LT623846_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MN507844_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363578_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
EU239224_FT00000_P-E      gaacatggaaagcattacatcaggactcctaggacccctgctcgtgttac
FN545827_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FN594763_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
DQ060830_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HQ700550_FT00000_P-E      gaacatcgaaggcatcacatcaggattcctaggacccctgctcgtgttac
HQ700552_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
HM363572_FT00000_P-E      gaacatggaaagcatcacatcaagattcctaggacccctgctcgtgttac
MT426115_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
HM363580_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
HM363579_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
HM363581_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
MH580631_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580632_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580652_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MW679683_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
HM363584_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363583_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363582_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HQ700551_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KF170741_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB915175_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB201289_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB274976_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB205192_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB205129_FT00000_P-E      gaacatggaaggcatcacatcaggattcctgggacccctgctcgtgttac
AB205189_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
GQ161760_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MZ962192_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494710_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494709_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580650_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494697_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB091256_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
HM363573_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580633_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580634_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580636_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580635_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580647_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580622_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580625_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580621_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580637_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB194947_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580629_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580649_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580646_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580624_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363585_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161803_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FJ349226_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MF772360_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AY739675_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AY739674_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB274970_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
LT623848_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MW455161_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161774_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
GQ161758_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
GQ161766_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
EU239219_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
EU239223_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161834_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
EU239221_FT00000_P-E      gaacatggcaggcatcacatcaggattcctaggacccctgctcgtgttac
HM363576_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363575_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363574_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB201288_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
MH580638_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161815_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MW082636_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
LT623850_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
KU736901_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB205191_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
GQ161828_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161776_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161789_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161784_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB091255_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
MN507843_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161812_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB274974_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580630_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494706_FT00000_P-E      gaacatggaargcatcacatcaggattcctaggacccctgctcgtgttac
MZ962191_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FJ349239_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161833_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363577_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736894_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH918655_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161814_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161792_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161782_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161790_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MN507845_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgcacgtgttac
AM494694_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494696_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494700_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363569_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363570_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580628_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580617_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580644_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161756_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161795_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB274969_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161771_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FJ349237_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FJ349238_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736898_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736897_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AM494705_FT00000_P-E      gaacatggaaagcatcacatcaggattcctcggacccctgctcgtgttac
KU736893_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580641_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580640_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161777_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161763_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MF772362_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161761_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MN507846_FT00000_P-E      gaacatggaaagcatcacatcaggattcctacaacccctgctcgtgttac
GQ161765_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161769_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161779_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
GQ161759_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
HM363571_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736900_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161808_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161778_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161810_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KU736895_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtattac
KU736896_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtattac
KU736899_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
EU239226_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161832_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MZ962193_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580616_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580615_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580623_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580614_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580651_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580618_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580619_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MH580620_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
FN545841_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
AB274971_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161817_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
MN507848_FT00000_P-E      gaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttac
GQ161801_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161780_FT00000_P-E      gaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttac
MZ962199_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161829_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161770_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161791_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161800_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161819_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161764_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161816_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
KX186584_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161798_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161772_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161787_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161781_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161804_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161827_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
GQ161793_FT00000_P-E      gaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttac
                          *   ** *         * **     ***     **** ** **  ****

GQ161775_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363611_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
LT623851_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagaatcta
MF772356_FT00000_P-E      aggcggggttttccttgttgacaaaaatcctcacaataccgcagagtcta
AB915180_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
EU239220_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagaatcta
MF772355_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN594762_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363610_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB915178_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN594760_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN594758_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN594759_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849720_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736913_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849728_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494695_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849724_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494703_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagaatcta
KU736902_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736892_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736891_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
X75657_FT00000_P-E        aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MN967527_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MN967526_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736904_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736909_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494698_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF170742_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MK720632_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MK720631_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MK321264_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736903_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494699_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736911_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736910_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736905_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736912_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736906_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736908_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736907_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494713_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494707_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494701_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494715_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494693_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494704_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494690_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MN967529_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MN967528_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494708_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494717_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494702_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB201290_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KM606738_FT00000_P-E      aggcgggatttttcttgttgacaaaaatcctcacaataccgcagagtcta
DQ060827_FT00000_P-E      aggcgggatttttcttgttgacaaaaatcctcacaataccgcagagtcta
DQ060826_FT00000_P-E      aggcgggatttttcttgttgacaaaaatcctcacaataccgcagagtcta
DQ060829_FT00000_P-E      aggcgggatttttcttgttgacaaaaatcctcacaataccgcagagtcta
DQ060828_FT00000_P-E      aggcgggatttttcttgttgacaaaaatcctcacaataccgcagagtcta
JQ000008_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MN507841_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
JQ000009_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849726_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849715_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH464856_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849716_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AY738147_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AY738146_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AY738144_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AY738145_FT00000_C-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849717_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849718_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849723_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
OM256457_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
DQ060822_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849725_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849727_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MF772354_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
DQ060823_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AY935700_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF922438_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF922439_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KT192626_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849714_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849713_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
DQ060825_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
DQ060824_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849719_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849722_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF849721_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363598_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363602_FT00000_P-E      aggcggggtttttctcgttgataaaaatcctcacaataccgcagagtcta
HM363601_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363604_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363597_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaattccgcagagtcta
HM363586_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363592_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363587_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363591_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaattccgcagagtcta
HM363590_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363589_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363588_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363568_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363567_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363565_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaattccgaagagtcta
MW679682_FT00000_P-E      aggcggggtttttcttggttacaaaaatccttacaattccgcagagtcca
MF772358_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
LT623843_FT00000_P-E      aggaggggtttttctygttgacaaaaatcctcacaataccgcagagtcta
FN594753_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB274984_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN594765_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363607_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363603_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363605_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN594748_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363606_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363599_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363566_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363608_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB219529_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN594766_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MN507842_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB106564_FT00000_C-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MF772357_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccacagagtcta
MH580648_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN545822_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161825_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcaaaataccgcagagtcta
FN594761_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161831_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB219533_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161768_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB274979_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MZ962197_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
LT623847_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363600_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
LT623844_FT00000_P-E      aggmggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB274977_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN594749_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB194948_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363609_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161796_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FJ349240_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580645_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB205188_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB274975_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN594756_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363596_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN545823_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB274973_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
LT623842_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN545821_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494691_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
EU239222_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494692_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494711_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MZ962195_FT00000_P-E      aggcggggtttttcctgttgacaaaaatcctcccaataccgaagagtcca
AB274980_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB274981_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN594751_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580626_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgaagagtcta
MW455162_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KT749841_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccacagagtcta
AB274978_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
EU239217_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN594750_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MZ962189_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161820_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363595_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161823_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB205190_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MW455165_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB274985_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MZ962194_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161794_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MZ962190_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MZ962196_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161755_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161835_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MN507840_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
LT623849_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB274982_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MN507847_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161836_FT00000_P-E      aggcggggtttttcttgttgataaaaatcctcacaataccgcagagtcta
MZ962198_FT00000_P-E      aggcgggatttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN545842_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161757_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494714_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494712_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161786_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
LT623845_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161826_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161797_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161762_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494689_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN594752_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161807_FT00000_P-E      aggcgggatttttcttgttgacaaaaatcctcacaataccgcagagtcta
KM606739_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161785_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363594_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB201287_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161811_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MW455163_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MW455164_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161824_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161783_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161802_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161773_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363593_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
LT623846_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MN507844_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363578_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
EU239224_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN545827_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN594763_FT00000_P-E      aggcggggttttccttgttgacaaaaatcctcacaataccgcagagtcta
DQ060830_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HQ700550_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HQ700552_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363572_FT00000_P-E      aggcggggtttttctcgttgacaaaaaccctcacaataccgcagagtcta
MT426115_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363580_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363579_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363581_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580631_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580632_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580652_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MW679683_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363584_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363583_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363582_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HQ700551_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KF170741_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB915175_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB201289_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB274976_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB205192_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB205129_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB205189_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161760_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MZ962192_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494710_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494709_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580650_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494697_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB091256_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363573_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580633_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580634_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580636_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580635_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580647_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580622_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580625_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580621_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580637_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB194947_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580629_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580649_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580646_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580624_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363585_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161803_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FJ349226_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MF772360_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AY739675_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AY739674_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB274970_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
LT623848_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MW455161_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161774_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161758_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161766_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
EU239219_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
EU239223_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161834_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
EU239221_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363576_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363575_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363574_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB201288_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580638_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161815_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MW082636_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
LT623850_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736901_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB205191_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161828_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161776_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161789_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161784_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB091255_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MN507843_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161812_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB274974_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580630_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494706_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MZ962191_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FJ349239_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161833_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363577_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736894_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH918655_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161814_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161792_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161782_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161790_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MN507845_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494694_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494696_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494700_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363569_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363570_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580628_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580617_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580644_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161756_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161795_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB274969_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161771_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FJ349237_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FJ349238_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736898_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736897_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AM494705_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736893_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580641_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580640_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161777_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161763_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MF772362_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161761_FT00000_P-E      aggcgggatttttcttgttgacaaaaatcctcacaataccgcagagtcta
MN507846_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161765_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161769_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161779_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161759_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
HM363571_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736900_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161808_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161778_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161810_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736895_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736896_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KU736899_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
EU239226_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161832_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MZ962193_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580616_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580615_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580623_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580614_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580651_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580618_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580619_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MH580620_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
FN545841_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
AB274971_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161817_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MN507848_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161801_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161780_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
MZ962199_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161829_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161770_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161791_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161800_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161819_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161764_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagaatcta
GQ161816_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
KX186584_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161798_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161772_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161787_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161781_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161804_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161827_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
GQ161793_FT00000_P-E      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
                          *** *** **** *  * * * ***** ***   *** **  *** ** *

GQ161775_FT00000_P-E      gactcgtggtggacttcyctcaattttctagggggagctcccgtgtgtcg
HM363611_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
LT623851_FT00000_P-E      gactcgtggtggacttctctcagttttctaggggaagctcccgtgtgtct
MF772356_FT00000_P-E      gactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcg
AB915180_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
EU239220_FT00000_P-E      gactcgtggtggacttctctcagttttctagggggagctcccgtgtgtct
MF772355_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN594762_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
HM363610_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB915178_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcc
FN594760_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggggctcccgtgtgtct
FN594758_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN594759_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849720_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736913_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
KF849728_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494695_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849724_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494703_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736902_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736892_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736891_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
X75657_FT00000_P-E        gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MN967527_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MN967526_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736904_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736909_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494698_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
KF170742_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MK720632_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MK720631_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MK321264_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736903_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494699_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736911_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736910_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736905_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736912_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736906_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736908_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736907_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494713_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494707_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494701_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494715_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494693_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494704_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
AM494690_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MN967529_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MN967528_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494708_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494717_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494702_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB201290_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagttcccgtgtgtct
KM606738_FT00000_P-E      gactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtct
DQ060827_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
DQ060826_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
DQ060829_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
DQ060828_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
JQ000008_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MN507841_FT00000_P-E      gactcgtggtggacttctctcagttttctagggggagctcccgtgtgtct
JQ000009_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849726_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849715_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH464856_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849716_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AY738147_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AY738146_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AY738144_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AY738145_FT00000_C-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849717_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849718_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849723_FT00000_P-E      gactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtct
OM256457_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
DQ060822_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849725_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849727_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagttcccgtgtgtct
MF772354_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
DQ060823_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AY935700_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF922438_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF922439_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KT192626_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849714_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849713_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
DQ060825_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
DQ060824_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849719_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849722_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KF849721_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggatctcccgtgtgtct
HM363598_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363602_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363601_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363604_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363597_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363586_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363592_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363587_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363591_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363590_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363589_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363588_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363568_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagttcccgtgtgtct
HM363567_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363565_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MW679682_FT00000_P-E      gactcgtggtggacttctttcaattttctagggggaggttccgtgtgttt
MF772358_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
LT623843_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
FN594753_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB274984_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN594765_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363607_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363603_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363605_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN594748_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363606_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363599_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363566_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363608_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB219529_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN594766_FT00000_P-E      gactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtct
MN507842_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB106564_FT00000_C-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MF772357_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580648_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN545822_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggatctcccgtgtgtct
GQ161825_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN594761_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161831_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB219533_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161768_FT00000_P-E      gactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtct
AB274979_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcc
MZ962197_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
LT623847_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363600_FT00000_P-E      gactcgtggtggacttctctcagttttctagggggagctcccgtgtgtct
LT623844_FT00000_P-E      gactcgtggtggacttctctcagttttctagggggagctcccgtgtgtct
AB274977_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN594749_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB194948_FT00000_P-E      gactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcg
HM363609_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161796_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FJ349240_FT00000_P-E      gactcgtggtggacttctctcagttttctagggggagctcccgtgtgtct
MH580645_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB205188_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB274975_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcc
FN594756_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363596_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN545823_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
AB274973_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
LT623842_FT00000_P-E      gactcgtggtggacttctctcarttttctagggggagctcccgtgtgtct
FN545821_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494691_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
EU239222_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtatct
AM494692_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494711_FT00000_P-E      gactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcg
MZ962195_FT00000_P-E      gacttgtggtggacttctcccaattttctagggggagctccagtgtgtct
AB274980_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB274981_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN594751_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580626_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MW455162_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KT749841_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
AB274978_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
EU239217_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN594750_FT00000_P-E      gactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcg
MZ962189_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggaactaccgtgtgtct
GQ161820_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcy
HM363595_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgggtgtct
GQ161823_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB205190_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MW455165_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB274985_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggatctcccgtgtgtct
MZ962194_FT00000_P-E      gactcgtggtggacttctctcaattttgtagggggagctcccgtgtgtct
GQ161794_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MZ962190_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagcttccgtgtgtct
MZ962196_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161755_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161835_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MN507840_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
LT623849_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtck
AB274982_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MN507847_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161836_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MZ962198_FT00000_P-E      gactcgtggtggacttctctcccctttctagggggagcccccgtgtgtct
FN545842_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
GQ161757_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
AM494714_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494712_FT00000_P-E      gactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcg
GQ161786_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
LT623845_FT00000_P-E      gactcgtggtggacttctctcarttttctagggggagctcccgtgtgtct
GQ161826_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagttcccgtgtgtct
GQ161797_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161762_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494689_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN594752_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161807_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KM606739_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggatctcccgtgtgtct
GQ161785_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363594_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB201287_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161811_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MW455163_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MW455164_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161824_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161783_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161802_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161773_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363593_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
LT623846_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MN507844_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363578_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
EU239224_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN545827_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN594763_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
DQ060830_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HQ700550_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HQ700552_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363572_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
MT426115_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggatctcccgtgtgtct
HM363580_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggatctcccgtgtgtct
HM363579_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggatctcccgtgtgtct
HM363581_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggatctcccgtgtgtct
MH580631_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580632_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580652_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MW679683_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363584_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363583_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363582_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HQ700551_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggaactcccgtgtgtct
KF170741_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB915175_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB201289_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB274976_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB205192_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB205129_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB205189_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161760_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcc
MZ962192_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494710_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494709_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580650_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494697_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB091256_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363573_FT00000_P-E      gactcgtggtggacttctctcaatattctagggggagctcccgtgtgtct
MH580633_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
MH580634_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580636_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580635_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580647_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580622_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580625_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580621_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580637_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB194947_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580629_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580649_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580646_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580624_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363585_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161803_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
FJ349226_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MF772360_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggatctcccgtgtgtct
AY739675_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AY739674_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB274970_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggatctcccgtgtgtct
LT623848_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtck
MW455161_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161774_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggaactcccgtgtgtct
GQ161758_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggaactcccgtgtgtct
GQ161766_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggaactcccgtgtgtct
EU239219_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
EU239223_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161834_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
EU239221_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363576_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363575_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363574_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB201288_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggatctcccgtgtgtct
MH580638_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161815_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MW082636_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
LT623850_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736901_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgcct
AB205191_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161828_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcc
GQ161776_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcc
GQ161789_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcc
GQ161784_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcc
AB091255_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MN507843_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161812_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB274974_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580630_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494706_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MZ962191_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FJ349239_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161833_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcg
HM363577_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736894_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH918655_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161814_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161792_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161782_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161790_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MN507845_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494694_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494696_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494700_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363569_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363570_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580628_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580617_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580644_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161756_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161795_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB274969_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161771_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FJ349237_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FJ349238_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736898_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736897_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AM494705_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736893_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580641_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580640_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161777_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161763_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MF772362_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161761_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MN507846_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161765_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161769_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161779_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161759_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
HM363571_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736900_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161808_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161778_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161810_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736895_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736896_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
KU736899_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcc
EU239226_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161832_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtatgtct
MZ962193_FT00000_P-E      gactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcc
MH580616_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580615_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580623_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580614_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580651_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580618_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580619_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MH580620_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
FN545841_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
AB274971_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161817_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MN507848_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161801_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161780_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
MZ962199_FT00000_P-E      gactcgtggtggacttctctcaattttgtagggggagctcccgtgtgtct
GQ161829_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161770_FT00000_P-E      gactcgtggtggacttctctcaattttgtagggggagctcccgtgtgtct
GQ161791_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161800_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161819_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161764_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161816_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggaactcccgtgtgtct
KX186584_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161798_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161772_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161787_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161781_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161804_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161827_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
GQ161793_FT00000_P-E      gactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
                          **** ************   *    ** ******      * *  *    

GQ161775_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363611_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
LT623851_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MF772356_FT00000_P-E      tggccaaaattcgcagttcccaatctccaatcactcaccaacctcttgtc
AB915180_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
EU239220_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MF772355_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
FN594762_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363610_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB915178_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
FN594760_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
FN594758_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
FN594759_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KF849720_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KU736913_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KF849728_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
AM494695_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KF849724_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
AM494703_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736902_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736892_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736891_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
X75657_FT00000_P-E        tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MN967527_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MN967526_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736904_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736909_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494698_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KF170742_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MK720632_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MK720631_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MK321264_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736903_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494699_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736911_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736910_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736905_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736912_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736906_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736908_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736907_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494713_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494707_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494701_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494715_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494693_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494704_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494690_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MN967529_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MN967528_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494708_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494717_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494702_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AB201290_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KM606738_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
DQ060827_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
DQ060826_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
DQ060829_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
DQ060828_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
JQ000008_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
MN507841_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
JQ000009_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF849726_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF849715_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
MH464856_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF849716_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
AY738147_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
AY738146_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
AY738144_FT00000_P-E      tggccaaaattcgcggtccccaatctccaatcactcaccaacctcttgtc
AY738145_FT00000_C-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF849717_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF849718_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF849723_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcactaacctcttgtc
OM256457_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
DQ060822_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
KF849725_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF849727_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
MF772354_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
DQ060823_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
AY935700_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF922438_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF922439_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KT192626_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF849714_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF849713_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
DQ060825_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
DQ060824_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF849719_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF849722_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
KF849721_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
HM363598_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcacttaccaacctcttgtc
HM363602_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363601_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363604_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363597_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363586_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363592_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363587_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363591_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363590_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363589_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363588_FT00000_P-E      tggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtc
HM363568_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363567_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363565_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MW679682_FT00000_P-E      tggccaaaatttgcaggccccaacccccaatcactcaccaacctcttgtc
MF772358_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
LT623843_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
FN594753_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB274984_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FN594765_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363607_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363603_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363605_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FN594748_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
HM363606_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
HM363599_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
HM363566_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
HM363608_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AB219529_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
FN594766_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MN507842_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB106564_FT00000_C-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MF772357_FT00000_P-E      tggccaaaattcgcagttcccaacctccaatcactcaccaacctcttgtc
MH580648_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FN545822_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161825_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FN594761_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161831_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB219533_FT00000_P-E      tggccaaaattcgcagtcccaaatctccaatcactcaccaacctcttgtc
GQ161768_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB274979_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MZ962197_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgcc
LT623847_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363600_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
LT623844_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB274977_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FN594749_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
AB194948_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363609_FT00000_P-E      tggccaaaatttgcagtccccaatctccaatcactcaccaacctcttgtc
GQ161796_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FJ349240_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580645_FT00000_P-E      tggccaaaattcgcagtccccaacctgcaatcactcaccaacctcttgtc
AB205188_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB274975_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FN594756_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363596_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FN545823_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB274973_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
LT623842_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FN545821_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AM494691_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
EU239222_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AM494692_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494711_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcactaacctcttgtc
MZ962195_FT00000_P-E      tggcccaaattcgcagtccccaaaccccaatcactcaccaacctctcttc
AB274980_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB274981_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
FN594751_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580626_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MW455162_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
KT749841_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB274978_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
EU239217_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FN594750_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcactaacctcttgtc
MZ962189_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccagggtcttgtc
GQ161820_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363595_FT00000_P-E      tggccaaaattcgcagtcccaaatctccaatcactcaccaacctcttgtc
GQ161823_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB205190_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MW455165_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB274985_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MZ962194_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161794_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MZ962190_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacgtcttgtc
MZ962196_FT00000_P-E      tggccaaagttcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161755_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161835_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MN507840_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
LT623849_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB274982_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MN507847_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161836_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MZ962198_FT00000_P-E      tggccaaaattcccagtccccaagctacaatcactcaccaacctcttgtc
FN545842_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
GQ161757_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AM494714_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494712_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcactaacctcttgtc
GQ161786_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
LT623845_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161826_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161797_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161762_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AM494689_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
FN594752_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
GQ161807_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
KM606739_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161785_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363594_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB201287_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161811_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MW455163_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MW455164_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161824_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161783_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161802_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161773_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363593_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
LT623846_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MN507844_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363578_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
EU239224_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FN545827_FT00000_P-E      tggccaaaattcgcagtccccaacctccartcactcaccaacctcttgtc
FN594763_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
DQ060830_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HQ700550_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HQ700552_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363572_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaatctcttgtc
MT426115_FT00000_P-E      tggccaaaattcgcagtccccaacctcctatcactcaccaacctcttgtc
HM363580_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363579_FT00000_P-E      tggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtc
HM363581_FT00000_P-E      tggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtc
MH580631_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580632_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580652_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MW679683_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363584_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363583_FT00000_P-E      tggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtc
HM363582_FT00000_P-E      tggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtc
HQ700551_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
KF170741_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
AB915175_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
AB201289_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
AB274976_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB205192_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB205129_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB205189_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161760_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcactaacctcttgtc
MZ962192_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AM494710_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494709_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580650_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494697_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AB091256_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363573_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580633_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580634_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580636_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580635_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580647_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580622_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580625_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580621_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580637_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB194947_FT00000_P-E      tggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtc
MH580629_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580649_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580646_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580624_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363585_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161803_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FJ349226_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MF772360_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AY739675_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AY739674_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB274970_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
LT623848_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MW455161_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
GQ161774_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161758_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161766_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
EU239219_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
EU239223_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161834_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
EU239221_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363576_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363575_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363574_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB201288_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580638_FT00000_P-E      tggccaaaattcgcagtcccaaatctccaatcactcaccaacctcttgtc
GQ161815_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MW082636_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
LT623850_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
KU736901_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AB205191_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161828_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161776_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161789_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161784_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB091255_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MN507843_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161812_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB274974_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580630_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AM494706_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MZ962191_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FJ349239_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161833_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363577_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctctagtc
KU736894_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH918655_FT00000_P-E      tggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtc
GQ161814_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161792_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161782_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161790_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MN507845_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AM494694_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AM494696_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AM494700_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363569_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
HM363570_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580628_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580617_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580644_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
GQ161756_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161795_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AB274969_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161771_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FJ349237_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
FJ349238_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
KU736898_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
KU736897_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
AM494705_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736893_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580641_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580640_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
GQ161777_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161763_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MF772362_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161761_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MN507846_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161765_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161769_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161779_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161759_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
HM363571_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
KU736900_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
GQ161808_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161778_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161810_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
KU736895_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
KU736896_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
KU736899_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
EU239226_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161832_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MZ962193_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MH580616_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580615_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580623_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580614_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580651_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580618_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580619_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
MH580620_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
FN545841_FT00000_P-E      tggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtc
AB274971_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161817_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MN507848_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161801_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161780_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
MZ962199_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161829_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161770_FT00000_P-E      tggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161791_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161800_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161819_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161764_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161816_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
KX186584_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161798_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161772_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161787_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161781_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161804_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161827_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
GQ161793_FT00000_P-E      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
                          ***** ** **  * *  ** ** *  *  ***** ** *   ***   *

GQ161775_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM363611_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
LT623851_FT00000_P-E      ctccaacttgtcctggctttcgctggatgtgtctgcggcgttttatcata
MF772356_FT00000_P-E      ctccgatttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
AB915180_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
EU239220_FT00000_P-E      ctcccatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
MF772355_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
FN594762_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
HM363610_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
AB915178_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
FN594760_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
FN594758_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
FN594759_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KF849720_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KU736913_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KF849728_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
AM494695_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KF849724_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
AM494703_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KU736902_FT00000_P-E      ctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
KU736892_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KU736891_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
X75657_FT00000_P-E        ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
MN967527_FT00000_P-E      ctctaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
MN967526_FT00000_P-E      ctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
KU736904_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KU736909_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
AM494698_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
KF170742_FT00000_P-E      ctccaatttgtcctggctatcgctggatgtgt