Dataset for nucleotide sequence X of genotype D

[Download (right click)] [Edit] [Sequences] [Repertoires]

2097 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

MF925366_X_P-D      atggctgctaggctgtgccgcagactggaagctgcgcgggacgtcctttgtttacgtccc
MF925379_X_P-D      atggctgctaggctgttctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774445_X_P-D      atggctgttaggctgtgctgccaactggatcgtgcgcgggacgtcctttgtttacgtccc
LT992444_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ922004_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688683_X_P-D      atggctgctaggctgtrctgccaactggatcctkcgcgggacgtcctttgtttacgtccc
GQ922003_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacrtcctttgtttacgtccc
MT591281_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664947_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN664924_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423706_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX423707_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX423722_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN664913_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN664926_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU668447_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtccc
MZ097869_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ205384_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ205382_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875342_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196229_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ205388_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtccc
KU668439_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtccc
KU668448_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtccc
MF618342_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtccc
KM524345_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875340_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ205380_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ205389_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524340_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ205385_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875341_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688708_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ922005_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601305_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ927384_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP168419_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ922000_X_P-D      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904433_X_C-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN476100_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700458_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904439_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
FJ904410_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904435_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904438_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904395_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904419_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904422_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097884_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754625_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601314_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ470894_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ470895_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF618348_X_P-D      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtccc
KM524338_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF618349_X_P-D      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtccc
KM524358_X_P-D      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtccc
KU668441_X_P-D      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtccc
JN664912_X_P-D      atggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtccc
KF192830_X_P-D      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtccc
KF192831_X_P-D      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtccc
KF192832_X_P-D      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtccc
KF192834_X_P-D      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtccc
KM606752_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM606754_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601323_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097784_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM606755_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB048701_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF922432_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ692533_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AJ627219_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ692532_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ470885_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ470889_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724251_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ470893_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ470896_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097627_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097697_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456651_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
DQ464175_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052972_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052960_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052961_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052952_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052954_X_P-D      gtggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052974_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052959_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcccttgtttacgtccc
MK052956_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052950_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052949_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052948_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052951_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052947_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052955_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052958_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052953_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052963_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052966_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052971_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052973_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK052975_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
X85254_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688678_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ562338_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601267_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF679990_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU414141_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB270537_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgtgggacgtcctttgtttacgtccc
GQ922001_X_P-D      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ922002_X_P-D      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN310715_X_P-D      atggctgytaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU414142_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598655_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097802_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ647353_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097789_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601295_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT347090_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ647355_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349213_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594434_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU155893_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724245_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM606744_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY233291_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097656_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598657_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601275_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP090179_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688722_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097882_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN310714_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH464854_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ464178_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601308_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097776_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
X65257_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601257_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097739_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097752_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH464834_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601286_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097760_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH464841_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH464836_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM606745_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN310708_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN310710_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN310709_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN310711_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN310712_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU921418_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097809_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097632_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601290_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601242_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097725_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724233_X_P-D      atggctgctaggctgtgctgccaactggatcctgcacgggacgtcctttgtttacgtccc
MH724232_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH464844_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875316_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875315_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774437_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594382_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598651_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY236160_X_P-D      atggctgctaggccgtgctgccaactggatcctgcgcgggacgtcctttatttacgtccc
AY233294_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724226_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724249_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724250_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097684_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688679_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH464839_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY236164_X_P-D      atggctgctaggctgtcgtgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ486022_X_P-D      atggctgctaggctgtcgtgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ486021_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ464174_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336690_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336686_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336687_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336688_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336689_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336692_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336685_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336674_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336675_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336676_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336677_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336678_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336679_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ464172_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ464173_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ236014_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN507852_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724215_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724220_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097696_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598658_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724225_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524356_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM519455_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875337_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196220_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196232_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875335_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196218_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196230_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875325_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875326_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875313_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875317_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875319_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875321_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875334_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875336_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196216_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196219_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196221_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196222_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196231_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196233_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196234_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HM750151_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ692506_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ692507_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY233292_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB493846_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU921419_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU414143_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP090180_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349232_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP090181_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724214_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724221_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724224_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724227_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724228_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724229_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724230_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724248_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN310713_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601327_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097793_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH464840_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688713_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456652_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MZ097864_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB270539_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH464838_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688685_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688712_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688711_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664919_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU736926_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU736927_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ486025_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097879_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601234_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097720_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601324_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601287_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097761_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724242_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724237_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724235_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875318_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688710_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ236015_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875333_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875331_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875329_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196235_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875320_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875322_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875323_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196217_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196224_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196225_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875330_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724234_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601233_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875328_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875324_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875314_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875332_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF618343_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601237_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097722_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ329356_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ329357_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG877718_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG877720_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG877719_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097804_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ464169_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
S77748_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG877709_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG877710_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843187_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX470760_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC012652_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT749845_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097694_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX898697_X_P-D      atggctgctaggctgtsctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX827292_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524349_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349214_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP090177_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtccc
KP090178_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtccc
MH724219_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtccc
MH724218_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtccc
AJ131956_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618441_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX898689_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX898691_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX898692_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX898694_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618443_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU668434_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524361_X_P-D      atggctgctaggctgtgctgctaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664909_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY233296_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU668436_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349211_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664936_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF618341_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF488704_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
LC705462_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU668444_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524350_X_P-D      atggctgctaggctgtgctgctaactggatcctgcgcgggacgtcctttgtttacgtccc
KU668438_X_P-D      atggctgctaggctgtgctgctaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664921_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtttacgtccc
JN664914_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664920_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664910_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257181_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU939680_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349209_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AM422939_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ315776_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ464170_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664911_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664917_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664922_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664928_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664930_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664937_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664938_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU668433_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU668435_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU668437_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU668442_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU668445_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU668446_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF618339_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN507839_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
V01460_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ464168_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF103279_X_P-D      atggctggtaggctgtgctgccaacgggatcttgcgcgggacgtcctttgtttacgtccc
MW601328_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097794_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603388_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603387_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603397_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN792911_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603404_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603389_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603392_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603390_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603391_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603395_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN792904_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603394_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603398_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603396_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603393_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603385_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN792908_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603383_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN792912_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603384_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603400_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN792903_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN792905_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN792906_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN792907_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN792909_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN792910_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603401_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603402_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603403_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT603399_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ486023_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776535_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
MG776668_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
MW601278_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK693108_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ032006_X_P-D      atggctgctaggctgtgctgccacggggtacctgcgcgggacgtcctttgtttacgtccc
KC774477_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674424_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX357622_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
X65258_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601288_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040762_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
X80924_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
X80926_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776623_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY090452_X_P-D      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
MW601247_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MZ097731_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MZ097833_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KM577670_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097713_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601301_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097773_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040828_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776624_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN642147_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ304547_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ304550_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ304551_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY236162_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ304549_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ304548_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX827300_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggatgtcctttgtttacgtccc
JN642128_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456682_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN844881_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776473_X_P-D      atggtcgttaggctgtgctgccaacaggatcctgcgcgggacgtcctttgtttacgtccc
FJ349215_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097768_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456639_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AJ627218_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
AJ627215_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
AJ627216_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
AY161158_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097661_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471645_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040752_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
JF754614_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456674_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF911683_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF911685_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601321_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601245_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097728_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ032005_X_P-D      atggctgctaggctgtgctgccaactggttcctgcgcgggacgtcctttgtttacgtccc
JN257190_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040753_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097877_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtccc
MG776387_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF911682_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456676_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AJ344116_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674408_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT591276_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT591277_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524348_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
JN664931_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776794_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776784_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776778_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776790_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776476_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642155_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF170739_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN507836_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW455166_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097873_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097823_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097691_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097637_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776549_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ032007_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040774_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754631_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HM750156_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ315778_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY721610_X_P-D      atggctgttaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB270548_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097639_X_P-D      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776547_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
MG776681_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
KX423711_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM577669_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642154_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257170_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY161157_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776497_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776640_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776754_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776555_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtccc
JF911687_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754629_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754619_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674431_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456673_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MG776691_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
EU787440_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU787442_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY629630_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ833470_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456671_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ833469_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066388_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066403_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097830_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774462_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776759_X_P-D      atggctgctaggctgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776760_X_P-D      atggctgctaggctgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776717_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040772_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471654_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601334_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097805_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774436_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774460_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776389_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524339_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642135_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754598_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097743_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY945307_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471656_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349230_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598638_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594396_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598636_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601297_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097764_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601292_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097788_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040761_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097849_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601311_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754592_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
AB330367_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
Y07587_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618428_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618427_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
S41175_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349219_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349216_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349220_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349217_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097638_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097626_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601309_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK693109_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776522_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcstttgtttacgtccc
KF018210_X_P-D      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN688695_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664932_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040781_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754624_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754605_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HM750153_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456664_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456662_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456635_X_P-D      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904424_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904399_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU787443_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700478_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700553_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601307_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097775_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF679995_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KR905423_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF679992_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF679993_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366497_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366507_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK355501_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU787438_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU787439_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HM750155_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU939681_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ899792_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601285_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ097759_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN642146_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754628_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ833467_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097712_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598648_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776606_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
LT992454_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ236016_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097848_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK541688_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT235615_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642131_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040767_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456675_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
GU456657_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF594772_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674420_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF911690_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
OK106256_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097825_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097707_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097705_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598637_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK507912_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776435_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601298_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097769_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY741794_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY741795_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY741796_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040758_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097835_X_P-D      atggctgctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtccc
MZ097646_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097643_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601228_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097717_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN507837_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK693107_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598650_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776756_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776688_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776679_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776684_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776689_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776771_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776774_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776783_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776634_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776511_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
LC365689_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875286_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257171_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040794_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040780_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040771_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040770_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040759_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040757_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754635_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
HQ833465_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456667_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456666_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594426_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
DQ336681_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY721608_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY721605_X_P-D      atggctggtaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF121242_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB222712_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP317983_X_P-D      atggctgctaggctgtgctgccaactgaatcctgcgcgggacgtcctttgtttacgtccc
KM577671_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257163_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349229_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB246348_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257182_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ833471_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU787436_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB222711_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423692_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MK355500_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KF471657_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097868_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598671_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB330369_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB330370_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040769_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097856_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601254_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN891828_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK598649_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700441_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HM750154_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456660_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349234_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF121240_X_C-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF121241_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY721606_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257151_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471659_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524342_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601252_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601283_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097648_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097736_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097757_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB222709_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU787445_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456663_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097786_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097813_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU787441_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP317982_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183478_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF679989_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423713_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX357639_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349218_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598659_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB205127_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598670_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ477454_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
Z35716_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097876_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097640_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598642_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776752_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754618_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594425_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU414138_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB583680_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP322601_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776474_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776478_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776480_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776650_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097654_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257162_X_P-D      atggctgctaggctgtgctgccaactggatcctrcgcggaacgtcctttgtttacgtccc
MG776524_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776761_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040782_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776611_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
L27106_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
JN642163_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257167_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MG776777_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776441_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776410_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776411_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097815_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471658_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JF754634_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040773_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KF471642_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774459_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MW601265_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097746_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776714_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776715_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776651_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097642_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097812_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097647_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776751_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774440_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JF754606_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776578_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776378_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776398_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
X59795_X_P-D        atggctgctaggctgtgctgccaactggatcctgagcgggacgtccttcgtttacgtccc
JN040779_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257176_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257177_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040776_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456644_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904415_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904421_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904420_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT591278_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776436_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776428_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642161_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
EF594771_X_P-D      atggctgttaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642158_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257179_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642166_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097860_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097871_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097674_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097664_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776604_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT749823_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774444_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642157_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257205_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456638_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349231_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601329_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257202_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtktacgtccc
MW601291_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MZ097763_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MW601229_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097718_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097662_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097832_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724252_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776500_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642145_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257155_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257196_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257199_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257169_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776536_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776459_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776460_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097676_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601331_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT591279_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776392_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB270542_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257159_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456670_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097845_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471640_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY721609_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040800_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040801_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097816_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY741798_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456640_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040814_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097840_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642138_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776666_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776581_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776600_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776477_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776492_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776642_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776558_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257203_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040811_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
AB674416_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456643_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776747_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776748_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040786_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtccc
JN040787_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtccc
JN040788_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtccc
MZ097810_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097730_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097634_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776576_X_P-D      atggctactaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY629634_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642156_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN257200_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456680_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674429_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
JN642149_X_P-D      atggctgctaggctgtactgccaactggatcctacgcgggacgtcctttgtttacgtccc
GU456645_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776597_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776599_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776593_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776590_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776568_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776588_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776596_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776579_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776639_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471647_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776496_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776528_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776439_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904429_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097834_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF018208_X_P-D      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754594_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU787437_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097821_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
MN585094_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257160_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257161_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040768_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601279_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MZ097753_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MZ097797_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097678_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776725_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776683_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776658_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776657_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776543_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642142_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257149_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754588_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB126581_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB674417_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674418_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097636_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097644_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601319_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040799_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776667_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776713_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456661_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776396_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB104710_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097692_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601289_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097762_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601282_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097756_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066383_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097866_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097649_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097635_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601261_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097741_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776793_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776781_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776710_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776663_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776638_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776633_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776637_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776720_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776553_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776545_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040778_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040775_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754622_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754608_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754590_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456683_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456658_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ562309_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF594773_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF103276_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccg
AY721607_X_P-D      atggctggtaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674413_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776776_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP995100_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601336_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097807_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB270547_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776510_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776541_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776626_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776629_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776641_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776643_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776656_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776703_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776705_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776708_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776507_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776610_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097742_X_P-D      atggctgctaggctgtgctgccaactggatmctgcgcgggacgtcctttgtttacgtccc
MW601262_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456653_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776390_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097702_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097824_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040804_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456648_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471649_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601269_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754591_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601248_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097732_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601302_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097774_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB270540_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776669_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097861_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097688_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040829_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674405_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674404_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456654_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642134_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601239_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097723_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF151735_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349233_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754595_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257201_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097881_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776420_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776470_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776566_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776636_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776652_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776501_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754626_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674406_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776635_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097658_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776763_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776532_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776735_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776762_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776727_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF115849_X_P-D      atggctgctaggctgtgctgccaactggaccctgcgcggggcgtcctttgtttacgtccc
GQ184322_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF115858_X_P-D      atggctgctaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtccc
MF115867_X_P-D      atggctggcaggctgtgctgccaactggaccctgcgcggggcgtcctttgtttacgtccc
MF115865_X_P-D      atggctggcaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtccc
MF115923_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtccc
MF115857_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtccc
MF115924_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtccc
GQ167301_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ167302_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF115851_X_P-D      atggccgctaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtccc
MF115870_X_P-D      atggctgctaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtccc
MF115869_X_P-D      atggctgctaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtccc
MF115866_X_P-D      atggctggcaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtccc
MF115868_X_P-D      atggctgccaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtccc
MG776525_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601276_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097779_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097865_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
MZ097699_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
KM577668_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
JN642148_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601255_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
MZ097792_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776682_X_P-D      atggctgctaggatgtcatgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776419_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776466_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776523_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776516_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257172_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257173_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097765_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601294_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674415_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754615_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097624_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040822_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB188241_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040750_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AJ627222_X_P-D      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
MZ097663_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724241_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776440_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF925391_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456678_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtccc
GU456650_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU787447_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456669_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB090269_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097863_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776594_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097878_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257187_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257188_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HM750152_X_P-D      atggctactcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ464181_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097870_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776749_X_P-D      atggctgctaggctgtactgccaactggatcctacgcgggacgtcctttgtttacgtccc
MG776647_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776602_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040795_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601330_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776648_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257211_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257183_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776379_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776491_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776706_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097880_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
MZ097698_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601274_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097750_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776770_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776505_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT749827_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642144_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642140_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040796_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040751_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456636_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674414_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB270550_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB222710_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776655_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257165_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
JN257166_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
JN040783_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY796031_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097843_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642159_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642153_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040824_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY721611_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB674426_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097811_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601240_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257178_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776520_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY796032_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776789_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456665_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ111986_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040821_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097842_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097801_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097653_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601277_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
MG776644_X_P-D      atggctgctcggctgtgctgccaaccggatcctgcgcgggacgtcctttgtttacgtccc
MG776603_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776438_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ647350_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471655_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664948_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257150_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040818_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
GQ477453_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336682_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtccc
AB674411_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674409_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MW601244_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097727_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776391_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776399_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776400_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097660_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KF471641_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642165_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN642162_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642143_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097853_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776649_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700510_X_P-D      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
HQ700514_X_P-D      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
HQ700512_X_P-D      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
HQ700513_X_P-D      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
GU456646_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040813_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776546_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097851_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF018197_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF018211_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ833466_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776539_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642151_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776416_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776712_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776457_X_P-D      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776461_X_P-D      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776471_X_P-D      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776504_X_P-D      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776514_X_P-D      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097875_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097857_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097855_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097819_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
MZ097770_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097693_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097625_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601335_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724236_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776791_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776766_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776613_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776572_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875284_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875276_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196214_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257148_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040777_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040756_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040755_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN040754_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754627_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754617_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754599_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754623_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456659_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456647_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ377589_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ336680_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtccc
DQ336683_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtccc
DQ336684_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtccc
AF121239_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB270546_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ833468_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598641_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097711_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097704_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040785_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875300_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196226_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875299_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875278_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875307_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875293_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875275_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875305_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875287_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875303_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875295_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196227_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875294_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875291_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196210_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196213_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875289_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875296_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875298_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875309_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196228_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875283_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875308_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875281_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875297_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP322599_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196236_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875288_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196208_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196211_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601243_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097726_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040760_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183463_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598677_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097628_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724246_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX260231_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN310706_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN310707_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594424_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF043593_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF043594_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598676_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594404_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598678_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776451_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MG776632_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097629_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776726_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471653_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776695_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776704_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598647_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB270549_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598646_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471650_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674410_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257214_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257215_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776488_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776533_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182684_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097715_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601299_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776418_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776434_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776445_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776468_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776661_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776405_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456681_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183460_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183457_X_P-D      atggctgataggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ464182_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674430_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183448_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183449_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183450_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183451_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183452_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183453_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183454_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183455_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183456_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183458_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183459_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183461_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183462_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183464_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183465_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183466_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183467_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183468_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183469_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776444_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MG776450_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MG776453_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MG776454_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MG776768_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776619_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776585_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776779_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776563_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776614_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776615_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776620_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgcccc
MG776490_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776493_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776513_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776537_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776538_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776584_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776607_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776622_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776764_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776767_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776625_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875292_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX357637_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754612_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754609_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
M32138_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040817_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601322_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097783_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040810_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040815_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040816_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX357638_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB188242_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776449_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097799_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097800_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT114169_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtctacgtccc
MG776397_X_P-D      atggctgctaggctgtgctgccaactgggtcctgcgcgggacgtcctttgtctacgtccc
JN257153_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257195_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776442_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040820_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700473_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700474_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF103280_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700472_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700454_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700455_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366499_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700477_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776464_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700468_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700483_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700480_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700481_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456672_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700439_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700463_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700444_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700489_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776462_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700482_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700445_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700446_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598643_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776544_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700467_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700459_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700471_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700466_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700440_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700453_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700464_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700488_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700469_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700470_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700484_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT235630_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT235632_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366498_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366500_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366501_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366502_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700487_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700479_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700448_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB246347_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700442_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700443_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700447_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700449_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700450_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700451_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642133_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
MZ097803_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776509_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN844882_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776765_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471660_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040802_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456642_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904445_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF754611_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456679_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ876255_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ876253_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ876257_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ876256_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ876242_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ876254_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097670_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776630_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ904427_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
FJ904426_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097818_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456677_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097677_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776498_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF061170_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF061167_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF061168_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF061169_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776742_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
AB674419_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754604_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257209_X_P-D      atggctgctaggatgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
MZ097673_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097858_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097841_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097796_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097679_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257193_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257194_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN585095_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097787_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642136_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754603_X_P-D      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
FJ904418_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601312_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097778_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097682_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776757_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776628_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776433_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097827_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642150_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040826_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN040809_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB104712_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776529_X_P-D      atggctgctagggtatgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
MG776530_X_P-D      atggctgctagggtatgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
GU456684_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754630_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456637_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776718_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY741797_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ518361_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097798_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601326_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097791_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904446_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtccc
FJ904402_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904432_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776664_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601325_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097790_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601249_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097733_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtktacgtccc
MZ097837_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097686_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK507911_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MG776680_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776574_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776559_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776484_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776424_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776409_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN040819_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754593_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904443_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601256_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097738_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776670_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776671_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN574725_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT235624_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776393_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776394_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776631_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097657_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776687_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776495_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097671_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776654_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776386_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471644_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097852_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601318_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097782_X_P-D      atggctgctaggmtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776676_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776571_X_P-D      atggctactaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC875279_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754610_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601300_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097771_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776443_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097734_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456656_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776404_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776423_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776455_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776469_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776481_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601250_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
X02496_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY629633_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097772_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598640_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776723_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257185_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040830_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904412_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097874_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP317981_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776788_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097795_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097650_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097631_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097630_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK598645_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598644_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK507913_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776755_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776692_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776548_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
MG776487_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776412_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF925363_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX827291_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471652_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875304_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642130_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JN040823_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040808_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040806_X_P-D      atggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040792_X_P-D      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754601_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ904431_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB188244_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY661792_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY661793_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ477459_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097666_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366508_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642126_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674407_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183470_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK507910_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK507914_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY161150_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY161151_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY161152_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY161153_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY161154_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY161155_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY161156_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU787446_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776775_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776554_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776560_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776561_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776527_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776384_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642132_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
GU456655_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594397_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB104709_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB104711_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349228_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754633_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN507853_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF584161_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF584162_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF584163_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF584164_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF584165_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF584166_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY382412_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY382414_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN310705_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642164_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF584160_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776518_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642129_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097817_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY161159_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY373431_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY161160_X_P-D      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU736924_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU736925_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875306_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875302_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875282_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY721612_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF103277_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875277_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875280_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875285_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875290_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196209_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196212_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX196215_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776743_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU414136_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776662_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776739_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776483_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776586_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776587_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598639_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776753_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776417_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776421_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776506_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776502_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776402_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF471646_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776583_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776589_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776401_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776448_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776591_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776598_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776701_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618430_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040807_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040805_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456649_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618429_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618432_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875301_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618433_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601313_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776738_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776482_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776452_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776415_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040765_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040791_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040793_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KP322600_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776395_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776430_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776437_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776479_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776486_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776499_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776730_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776406_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776407_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601320_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097701_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754632_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AJ627224_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtccc
JQ687530_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040766_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ997861_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ997860_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ997852_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ997853_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ997855_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ997857_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ997859_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ997854_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ997858_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT963508_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
KT151620_X_P-D      atggctgctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtccc
AB205128_X_P-D      atggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtccc
JQ707687_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707703_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707692_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707688_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707685_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707684_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707682_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707686_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707689_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707690_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707691_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707693_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707694_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707695_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707696_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707697_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707698_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707699_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707700_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707701_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707702_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707704_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707705_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707706_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707683_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF925390_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MW601231_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX276856_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456668_X_P-D      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AJ627223_X_P-D      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB222713_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618431_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618437_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX276857_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066390_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598674_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX096954_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX096957_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF925383_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423695_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB270541_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ707508_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707505_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707494_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707476_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707478_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707479_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707480_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707481_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707482_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707484_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707485_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707487_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707488_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707490_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707496_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707499_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707500_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707502_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707503_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707507_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707489_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MK618424_X_P-D      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707530_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707528_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707526_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttccgtccc
JQ707483_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707486_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707512_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707513_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707514_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707515_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707516_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707517_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707518_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707519_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707520_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707521_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707522_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707523_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707524_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707525_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707527_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707529_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MK618435_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707491_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707511_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707510_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707509_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707498_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707477_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707495_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707501_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707504_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707492_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707493_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MK618434_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MK618436_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MK618423_X_P-D      atggctgctaggctgtgctgccaactggatcctccgcgggacgtcctttgtttacgtccc
JQ707497_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
JQ707506_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MK618425_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
EU594433_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097820_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM606753_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423710_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423719_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066406_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066408_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182675_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182662_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182663_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182670_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601270_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MT114172_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK516278_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT235621_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ687531_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN574728_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700511_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ386590_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU414135_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366491_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040784_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754600_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066385_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182682_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594430_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB270543_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AJ627220_X_P-D      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
MK598662_X_P-D      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AF280817_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN507838_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183474_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524344_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524346_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524351_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066401_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182659_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182673_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182691_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601280_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097754_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598668_X_P-D      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
MG776732_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776616_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776567_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776569_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776672_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF925393_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423696_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423693_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT235629_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524355_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664941_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664939_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN574723_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtccc
EF594774_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB119252_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB110075_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB120308_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524347_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN257152_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183471_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066381_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182690_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366465_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF925364_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183480_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183472_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183479_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB116266_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423698_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KX423715_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KF679994_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183482_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183483_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN574729_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF679996_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF679998_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423723_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598663_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423717_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423718_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875312_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875311_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU357846_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN507851_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594399_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY090453_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB119254_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB109479_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB109476_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB090270_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB078031_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB078032_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB078033_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB267090_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB109475_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB109477_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB205126_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB210821_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB210822_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB471856_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB471857_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875310_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776722_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT114173_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066386_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX712265_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF594776_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF925358_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366493_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066389_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066407_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182661_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182668_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182676_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183476_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598665_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183473_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183475_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183485_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066392_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182677_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT235619_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggatgtcctttgtttacgtccc
KM524354_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524353_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524341_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF679997_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664918_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183477_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183481_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ924652_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KR905424_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT235620_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT235623_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT235626_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT235631_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT235637_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366494_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366495_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366496_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366506_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366509_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366510_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT366511_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182660_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182678_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182692_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097859_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601332_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB555496_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182685_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB555497_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB555500_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601268_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097683_X_P-D      atggctgctaggctgtrctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB555501_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097651_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097847_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097633_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN839643_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ477458_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF594775_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB119256_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgagacgtcctttgtttacgtccc
MN066395_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097749_X_P-D      atggstggtaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349208_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601273_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066394_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066382_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601333_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776796_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066387_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066402_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ399006_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB119253_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB119251_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB109478_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH932714_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423702_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB090268_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598664_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB119255_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN066398_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182693_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601238_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349206_X_P-D      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT749821_X_P-D      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601263_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097744_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754621_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097844_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601281_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097755_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601271_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097748_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601246_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097729_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097751_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MZ097685_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097668_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EF103275_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
X72702_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097641_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ477455_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ477457_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
MZ097828_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097831_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601337_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097808_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601253_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097737_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097714_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MN182664_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN664927_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU668449_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097708_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754597_X_P-D      atggctgctcggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KM524352_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX423721_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097672_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097655_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097659_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097710_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ272897_X_P-D      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ183484_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
X97848_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
X97849_X_P-D        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097829_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601316_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097781_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598661_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KT749828_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU414139_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598660_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349205_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601293_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097872_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097669_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
MG776612_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776785_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776736_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776746_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776582_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776731_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776653_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776792_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776592_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776595_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH724244_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097846_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097867_X_P-D      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
MZ097689_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtccc
MZ097700_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674425_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097675_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
EU414140_X_P-D      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097836_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724247_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ647352_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN642167_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB210820_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601339_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040797_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601303_X_P-D      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MZ097665_X_P-D      atggctgctaggctgtgctgccaactggatcctrcgcgggacgtcctttgtttacgtccc
MH724231_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724217_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724223_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598669_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724238_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MH724216_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776382_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776383_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ477452_X_P-D      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594412_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT579903_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594415_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594421_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594398_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594422_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594423_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598672_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601266_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097747_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX827301_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX827290_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX096958_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ477456_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594431_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594432_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594411_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594401_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594402_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594416_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618420_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618422_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT579900_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594409_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT579901_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX096955_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598673_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097785_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT579899_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618426_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598679_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040790_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594400_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594403_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594405_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594407_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594408_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594410_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594427_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618418_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618419_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK618421_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594428_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX096956_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598666_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598667_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK598675_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT579898_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT579902_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097883_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097839_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097645_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097690_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754607_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674423_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097709_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601315_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097780_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY796030_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754596_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MW601251_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097681_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097735_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ097695_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674422_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JF754602_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN040812_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB674428_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB674427_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ349235_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GU456641_X_P-D      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
                     ***      **       **     *     *    *     **  *  * * ** ** 

MF925366_X_P-D      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgtcccct
MF925379_X_P-D      gtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgtcccct
KC774445_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggattctcttgtccctt
LT992444_X_P-D      gtcggcgctgaatccnnnnnnnnnnnnnnnnnnnnnnngcttgggactatgtcgtcctct
GQ922004_X_P-D      ctcggcgctgaatcccgcggacgacccatctcgrggccgcttgggtccctgtcgtcctct
JN688683_X_P-D      gtcggcgctgaatcccgcggacgacccytctcggggycgcttgggactctctcgtcccct
GQ922003_X_P-D      ctcagcgctgaatcccgcggacgacccrtctcggggccgcttgggcccctgtcgtcctct
MT591281_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgattgggggtctatcgccccct
JN664947_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggcctcggtcgtcctct
JN664924_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
KX423706_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
KX423707_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
KX423722_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
JN664913_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctatcgtcctct
JN664926_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
KU668447_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
MZ097869_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgyttgggtctctgtcgtcctct
GQ205384_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttaggtctctgtcgtcctct
GQ205382_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
KC875342_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
KX196229_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
GQ205388_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
KU668439_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
KU668448_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
MF618342_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
KM524345_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
KC875340_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
GQ205380_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
GQ205389_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
KM524340_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
GQ205385_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
KC875341_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctct
JN688708_X_P-D      gtcggcgctgaatcccgcggacgacccytctcggggycgcttgggactytctcgtcccct
GQ922005_X_P-D      ctcggcgctgaatcccgcggacgacccctctcggggccgcttgggcccctgtcgtcctct
MW601305_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JQ927384_X_P-D      gtcggcgctgaatcctgcggacgacccgtctcgaggccgcttgggactctaccgtcccct
KP168419_X_P-D      gtcggcgctgaatcctgcggacgacccgtctcgaggccgcttgggactctaccgtcccct
GQ922000_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
FJ904433_X_C-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcctgggggtctctcgtcccct
MN476100_X_P-D      gtcagcgctgaatcctgcggacgacccttctcggggccgcttggggatctctcgtcccct
HQ700458_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttggggccttatcgtcccct
FJ904439_X_P-D      ctcggcgctgaatcctgcggacgacccttctcggggccgcttggggatctctcgtcctct
FJ904410_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtcctct
FJ904435_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcctggggatctatcgtcctct
FJ904438_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttggggatctctcgtcctct
FJ904395_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttggggatctctcgtcctct
FJ904419_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtcctct
FJ904422_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtcctct
MZ097884_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttggggatcyatcgtcccct
JF754625_X_P-D      gtcggcactgaatcccgcggacgatccttctcggggtcgcttgggactttctcgtcccct
MW601314_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggccgtgtcgtcctct
KJ470894_X_P-D      gtcgacgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcccct
KJ470895_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtcccct
MF618348_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctct
KM524338_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctct
MF618349_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctct
KM524358_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctct
KU668441_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctct
JN664912_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctct
KF192830_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctct
KF192831_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctct
KF192832_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctct
KF192834_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctct
KM606752_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttgggaccctgtcgtcctct
KM606754_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttgggaccctgtcgtcctcg
MW601323_X_P-D      gtcggcgctgaatcccgcggacgacccttctcgcggccgcttgggtccctgtcgtcccct
MZ097784_X_P-D      gtcggcgctgaatcccgcggacgacccttctcgcggccgcttgggtccctgtcgtcccct
KM606755_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggtctcttgggaccctgtcgtcctcg
AB048701_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggccctgtcgtcctct
KF922432_X_P-D      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggccctgtcgtcctct
FJ692533_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttaggaccctgtcgtcctct
AJ627219_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggccctgtcgtcctct
FJ692532_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggccctgtcgtcctct
KJ470885_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctatcgtcccct
KJ470889_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtcccct
MH724251_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcccct
KJ470893_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcccct
KJ470896_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcccct
MZ097627_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcccct
MZ097697_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcccct
GU456651_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactatctcgtcctct
DQ464175_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MK052972_X_P-D      gtcggcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052960_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052961_X_P-D      gtcggcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052952_X_P-D      gtcggcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052954_X_P-D      gtcggcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052974_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052959_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcctgggactctctcgtcccct
MK052956_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052950_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052949_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052948_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcttgggactctatcgtcccct
MK052951_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcttgggactctatcgtcccct
MK052947_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052955_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052958_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052953_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052963_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052966_X_P-D      gtcagcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052971_X_P-D      gtcggcgctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052973_X_P-D      gtcggcgccgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK052975_X_P-D      gtcggcgccgaatccggcggacgacccgtctcggggccgcttgggactctctcgtcccct
X85254_X_P-D        gtcggcgctgaatcccgcggacgacccctctcggggtcgcttgggactttctcgtcccct
JN688678_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtcccct
FJ562338_X_P-D      gtcggcgctgaatcccgcggacgacccttcgaggggtcgcttgggactctctcgtcccct
MW601267_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctttcgtcccct
KF679990_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgtttgggactctcacgtcccct
EU414141_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
AB270537_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
GQ922001_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
GQ922002_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MN310715_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactgtctcgtcccct
EU414142_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MK598655_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097802_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtcccct
KJ647353_X_P-D      gtcggcgctgaatcccgcggacgacccttctcgaggtcgcttgggactctctcgtcccct
MZ097789_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MW601295_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KT347090_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KJ647355_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
FJ349213_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgactgggactctctcgtcccct
EU594434_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
EU155893_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724245_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KM606744_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttgggaccctctcgtcctct
AY233291_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggtctctctcgtcccct
MZ097656_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactgtctcgtcccct
MK598657_X_P-D      ctcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MW601275_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttggggctctctcgtcccct
KP090179_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtcccct
JN688722_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097882_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttggggctctctcggcccct
MN310714_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH464854_X_P-D      gtcggcgctgaatcccgcagacgacccctctcggggtcgcttgggactctctcgtcccct
DQ464178_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccact
MW601308_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097776_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
X65257_X_P-D        gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttgggactctctcgtcccct
MW601257_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097739_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097752_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH464834_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MW601286_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttggggctttctcgtcccct
MZ097760_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttggggctttctcgtcccct
MH464841_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH464836_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KM606745_X_P-D      gtcggcgctgaatccagcggacgacccttctcggggtcgcttgggactctctcgtcccct
MN310708_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MN310710_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MN310709_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MN310711_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MN310712_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
EU921418_X_P-D      gtcggcgctgaatcccgcggacgacccctctcggggtcgcttggggctctctcgtcccct
MZ097809_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097632_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MW601290_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MW601242_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097725_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724233_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724232_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtcccct
MH464844_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875316_X_P-D      gtcggcgctgaatcccgcggacgacccttgtcggggtcgcttgggactctctcgtcccct
KC875315_X_P-D      ggcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC774437_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtcccct
EU594382_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MK598651_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
AY236160_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
AY233294_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724226_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724249_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724250_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097684_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN688679_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH464839_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
AY236164_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ486022_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ486021_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ464174_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ336690_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ336686_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ336687_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ336688_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ336689_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ336692_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ336685_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ336674_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ336675_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ336676_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ336677_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ336678_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ336679_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ464172_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ464173_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
HQ236014_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MN507852_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724215_X_P-D      gtcggcgctgaatcccgcggacgacccttttcggggtcgcttgggactttctcgtcccct
MH724220_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtcccct
MZ097696_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtcccct
MK598658_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724225_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KM524356_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtcccct
KM519455_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875337_X_P-D      gtcggcgctgaatcccgcggacgacccttctccgggtcgcttgggactctctcgtcccct
KX196220_X_P-D      gtcggcgctgaatcccgcggacgacccttctccgggtcgcttgggactctctcgtcccct
KX196232_X_P-D      gtcggcgctgaatcccgcggacgacccttctccgggtcgcttgggactctctcgtcccct
KC875335_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX196218_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX196230_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875325_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875326_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875313_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875317_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875319_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875321_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875334_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875336_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX196216_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX196219_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX196221_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX196222_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX196231_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX196233_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX196234_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
HM750151_X_P-D      gtcggcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctctcgtcccct
FJ692506_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
FJ692507_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
AY233292_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
AB493846_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
EU921419_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
EU414143_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KP090180_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
FJ349232_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KP090181_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724214_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724221_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724224_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724227_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724228_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724229_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724230_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724248_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MN310713_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MW601327_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097793_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH464840_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN688713_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
GU456652_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtcccct
MZ097864_X_P-D      gtcggcgctgaatcccgcggacgacccttcccggggtcgcttgggactttcgcgtcccct
AB270539_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
MH464838_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN688685_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctaccgtcccct
JN688712_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN688711_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664919_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctcacgtcccct
KU736926_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
KU736927_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
DQ486025_X_P-D      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttgggactctctcgtcccct
MZ097879_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MW601234_X_P-D      gtcgacgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097720_X_P-D      gtcgacgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MW601324_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MW601287_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097761_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724242_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724237_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724235_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875318_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN688710_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
HQ236015_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875333_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875331_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875329_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX196235_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875320_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875322_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875323_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX196217_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX196224_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX196225_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875330_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724234_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MW601233_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875328_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875324_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875314_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC875332_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MF618343_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctgtcgtcccct
MW601237_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097722_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ329356_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcccttgggactctctcgtcccct
DQ329357_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcccttgggactctctcgtcccct
MG877718_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactttctcgtcccct
MG877720_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactttctcgtcccct
MG877719_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactttctcgtcccct
MZ097804_X_P-D      gtcggcgctgaatcctgcggacgacccatctcggggtcgcttgggactctctcgtcccct
DQ464169_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
S77748_X_P-D        gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MG877709_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MG877710_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KJ843187_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JX470760_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC012652_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KT749845_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097694_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JX898697_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KX827292_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KM524349_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
FJ349214_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctatcgtcccct
KP090177_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KP090178_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724219_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MH724218_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
AJ131956_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MK618441_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactccctcgtcccct
JX898689_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JX898691_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JX898692_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JX898694_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MK618443_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KU668434_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KM524361_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664909_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctgtcgtcccct
AY233296_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KU668436_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
FJ349211_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664936_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MF618341_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MF488704_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
LC705462_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KU668444_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KM524350_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KU668438_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664921_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664914_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664920_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664910_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcctct
JN257181_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
EU939680_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
FJ349209_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
AM422939_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ315776_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ464170_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664911_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664917_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664922_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664928_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664930_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664937_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JN664938_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KU668433_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KU668435_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KU668437_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KU668442_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KU668445_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KU668446_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MF618339_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MN507839_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
V01460_X_P-D        gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
DQ464168_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
EF103279_X_P-D      gtgggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MW601328_X_P-D      gtcggcgctgaatcccgcggacgacccatctcggggtcgcttgggggtctttcgtcccct
MZ097794_X_P-D      gtcggcgctgaatcccgcggacgacccatctcggggtcgcttgggggtctttcgtcccct
MT603388_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttaggactctctcgtcctct
MT603387_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
MT603397_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
JN792911_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctatcgtcccct
MT603404_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctatcgtcccct
MT603389_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctatcgtcccct
MT603392_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcgaggcaggttgggactctctcgtcccct
MT603390_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
MT603391_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
MT603395_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
JN792904_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
MT603394_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
MT603398_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttaggactctctcgtcccct
MT603396_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttrggactctctcgtcccct
MT603393_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
MT603385_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttaggactctctcgtcccct
JN792908_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
MT603383_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttaggactctctcgtcccct
JN792912_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
MT603384_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
MT603400_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttaggactctctcgtcccct
JN792903_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
JN792905_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
JN792906_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
JN792907_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
JN792909_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
JN792910_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
MT603401_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
MT603402_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
MT603403_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
MT603399_X_P-D      gtcagcgctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccct
DQ486023_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttggggatcttccgtcccct
MG776535_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MG776668_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MW601278_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgattgggactctatcgtcccct
MK693108_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgttccct
JQ032006_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
KC774477_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctcttgtcccct
AB674424_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtcccct
KX357622_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctatcgtcccct
X65258_X_P-D        gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MW601288_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtcccct
JN040762_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggcctttctcgtcccct
X80924_X_P-D        gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctttcgtcccct
X80926_X_P-D        gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctttcgtcccct
MG776623_X_P-D      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AY090452_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctttcgtcccct
MW601247_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttggggctctctcgtcccct
MZ097731_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttggggctctctcgtcccct
MZ097833_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtcccct
KM577670_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctcgcgtcccct
MZ097713_X_P-D      gtcggcgctgaatcccgccgacgacccgtctcggggccgcttgggactctgtcgtcccct
MW601301_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctttcgtcccct
MZ097773_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctttcgtcccct
JN040828_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtcccct
MG776624_X_P-D      gtcagcgctgaatcccgcagacgacccttctcggggccgcttgggtctctctcgtcccct
JN642147_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaatctttcgtcccct
DQ304547_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
DQ304550_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
DQ304551_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
AY236162_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
DQ304549_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
DQ304548_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
KX827300_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtcccct
JN642128_X_P-D      gtcggcgatgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
GU456682_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MN844881_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttgggactttctcgtcccct
MG776473_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
FJ349215_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
MZ097768_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtcccct
GU456639_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
AJ627218_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
AJ627215_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
AJ627216_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
AY161158_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MZ097661_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
KF471645_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
JN040752_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctatcgtcccct
JF754614_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtcccct
GU456674_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttgggactctctcgacccct
JF911683_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtcccct
JF911685_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtcccct
MW601321_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggacgcctgggactctctcgtcccct
MW601245_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcctgggactctttcgtcccct
MZ097728_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcctgggactctttcgtcccct
JQ032005_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
JN257190_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctcacgtcccct
JN040753_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtcccct
MZ097877_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MG776387_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
JF911682_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctcttgtcccct
GU456676_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggycgcttgggactctctcgtcccct
AJ344116_X_P-D      gtcagcgctgaatcccgcggacgacccctctcggggccgcttgggactatctcgtcccct
AB674408_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MT591276_X_P-D      gtcggcgctgaatccagcggacgacccttctcggggccgcttgggactctctcgtcccct
MT591277_X_P-D      gtcggcgctgaatccagcggacgacccttctcggggccgcttgggactctctcgtcccct
KM524348_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaccctctcgtcccct
JN664931_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctatcgtcccct
MG776794_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MG776784_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MG776778_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MG776790_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MG776476_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
JN642155_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
KF170739_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtcccct
MN507836_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtcccct
MW455166_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtcccct
MZ097873_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
MZ097823_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtcccct
MZ097691_X_P-D      gtcggcgctgaatcctgcggacgacccttctcgtgggcgcttgggactctctcgtcccct
MZ097637_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MG776549_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
JQ032007_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
JN040774_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactttctcgtcccct
JF754631_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttgggactctctcgtcccct
HM750156_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
DQ315778_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
AY721610_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
AB270548_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactgtctcgtcccct
MZ097639_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggrctctctcgtcccct
MG776547_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MG776681_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
KX423711_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KM577669_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctcgcgtcccct
JN642154_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttggggctctctcgtcccct
JN257170_X_P-D      gtcgacgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
AY161157_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MG776497_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactatatcgtcccct
MG776640_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactatatcgtcccct
MG776754_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactttctcgtcccct
MG776555_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctgtcgtcccct
JF911687_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggatctatcgtcccct
JF754629_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
JF754619_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
AB674431_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
GU456673_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
MG776691_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
EU787440_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
EU787442_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
KY629630_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtcccct
HQ833470_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
GU456671_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
HQ833469_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MN066388_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MN066403_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MZ097830_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
KC774462_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MG776759_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtcccct
MG776760_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtcccct
MG776717_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
JN040772_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
KF471654_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MW601334_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MZ097805_X_P-D      ctcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KC774436_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccggctgggactctctcgtcccct
KC774460_X_P-D      gtcggcgctgaatcccgcggacgacccttccaggggccggctgggactctctcgtcccct
MG776389_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctctcgcgtcccct
KM524339_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggctatctcgtcccct
JN642135_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
JF754598_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtcccct
MZ097743_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttaggcctctctcgtcccct
AY945307_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
KF471656_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
FJ349230_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggtctctctcgtcccct
MK598638_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtcccct
EU594396_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtcccct
MK598636_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtcccct
MW601297_X_P-D      gtcggcgctgaatcccgcggacgacccttcccggggccgcttgggactctctcgtcccct
MZ097764_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtcccct
MW601292_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtcccct
MZ097788_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtcccct
JN040761_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MZ097849_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MW601311_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
JF754592_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
AB330367_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgattgggactctctcgtcccct
Y07587_X_P-D        gtcggcgctgaatcccacggacgacccttctcggggtcgcttggggctctctcgtcccct
MK618428_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MK618427_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttggggctctctcgtcccct
S41175_X_P-D        gtcggcgctgaatcccgcggacgacccttctcggggtcgcttggggctctctcgtcccct
FJ349219_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
FJ349216_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
FJ349220_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
FJ349217_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
MZ097638_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MZ097626_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactttctcgtcccct
MW601309_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtcccct
MK693109_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MG776522_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactttctcgtcccct
KF018210_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
JN688695_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
JN664932_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
JN040781_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
JF754624_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcctgggactctctcgtcccct
JF754605_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggtctctctcgtcccct
HM750153_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
GU456664_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctctcgtcccct
GU456662_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
GU456635_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
FJ904424_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtcccct
FJ904399_X_P-D      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactttctcgtcccct
EU787443_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
HQ700478_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
HQ700553_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MW601307_X_P-D      gtcggcgctgaatcccgccgacgacccttctcggggccgcttgggactctctcgtcccct
MZ097775_X_P-D      gtcggcgctgaatcccgccgacgacccttctcggggccgcttgggactctctcgtcccct
KF679995_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
KR905423_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
KF679992_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KF679993_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KT366497_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KT366507_X_P-D      gtcagcgctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccct
MK355501_X_P-D      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtcccct
EU787438_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
EU787439_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
HM750155_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
EU939681_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
FJ899792_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MW601285_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MZ097759_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
JN642146_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
JF754628_X_P-D      gtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtcccct
HQ833467_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MZ097712_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccct
MK598648_X_P-D      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggtctttctc