HBVdb

Dataset for nucleotide sequence PreS2 of genotype D

[Download (right click)] [Edit] [Sequences] [Repertoires]

1609 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


EU155895_PreS2_P-D      atgcagtggaattccacaaccttccaccacactctgcaagatcccagagt
JX310727_PreS2_P-D      atacagtggaactccactactttccaccaaactctgcaagatcccagggt
KF170769_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU414140_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
X65258_PreS2_P-D        gtgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
MF925366_PreS2_P-D      atgcagtggaactccaccacattccaccaaactctgcaagatcccagagt
EU155893_PreS2_P-D      atgcaatggaattccaaaaccttccaccaaactctacaagatcccagagt
JN604152_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707689_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707683_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707697_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707699_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707702_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707706_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707703_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707693_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707682_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707684_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707685_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707686_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707687_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707688_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707691_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707692_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707694_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707695_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707696_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707698_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707700_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707701_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707704_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707705_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JQ707690_PreS2_P-D      atacagtggaactacaaaaccttccaccaaactctacaagatcccaaagt
JX090648_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ477454_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
JX090690_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KF170760_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JN604139_PreS2_P-D      gtgcagtggaactctacaaccttccaccaaactctacaaaatcccagggt
KT366494_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
DQ399006_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF925390_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaaaatcccagggt
KX276856_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaggatcccagrgt
JN642163_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT151620_PreS2_P-D      atgcagtggaannccacaacctttcaccaaactctgcaagatcccagagt
JN664941_PreS2_P-D      atgcagtggaattccacaacattccaccaaactctgcaagatcccagggt
KF053178_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN604120_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagggt
KT366465_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB119255_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JN642144_PreS2_P-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagggt
KX276857_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AY090453_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KU668449_PreS2_P-D      atgcagtggaactccacaaacttccaccaaactctgcaagatcccagggt
KT366511_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
JN664927_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JQ707511_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT366510_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MF925379_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707491_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JN664928_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KM524346_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KM524351_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK598663_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JQ707529_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707519_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707517_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707516_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707513_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707512_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707514_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707515_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707518_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707520_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707521_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707522_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707523_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707526_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707528_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707530_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707524_PreS2_P-D      atggagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707525_PreS2_P-D      atggagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB119256_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MH932714_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT366493_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KM524344_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ183471_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JQ707505_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707499_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707494_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707490_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707487_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707485_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707484_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707481_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707479_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707476_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707478_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707482_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707489_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707496_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707500_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707502_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707507_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707508_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707480_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707488_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707503_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KM524347_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN664918_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MF618349_PreS2_P-D      atgcagtggaactccacagccttccaccaagttctgcaagatcccagggt
KF679998_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ183481_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KF679997_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagggt
JQ707506_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ183479_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183477_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ183476_PreS2_P-D      atgcagtggaactccacaatcttccaccaaactctgcaagatcccagagt
KP165604_PreS2_P-D      atgcagtggaactccacaatcttccaccaaactctgcaagatcccagagt
GQ183472_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB119254_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KM524341_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707483_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707486_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707527_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MF925363_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT366496_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT366491_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagggt
KC875311_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC875310_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagagcccagggt
JQ707504_PreS2_P-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagggt
JQ707493_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ924652_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB119252_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB109479_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB090268_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB120308_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ183474_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KM524352_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KM524353_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KF679994_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KF679996_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707498_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707509_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB090269_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB116266_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ183482_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ183483_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP184499_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP202937_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP202938_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP202939_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP202940_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP202943_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT962021_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT962023_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT962024_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MF925364_PreS2_P-D      atgcagtggaactccgcaaccttccaccaaactctgcaagatcccagggt
JQ707510_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707501_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707497_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707492_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707477_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ707495_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JN664930_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MF925383_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MF925393_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ183475_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB109478_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB109475_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB109476_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB109477_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB110075_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB119251_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB119253_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB205126_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB210821_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB210822_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB267090_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB471856_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB471857_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC875312_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KM524354_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KM524355_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KR905424_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT366495_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT366506_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT366509_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MF925358_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB078031_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatccaagggt
AB078033_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatccaagggt
AB078032_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatccaagggt
KJ647352_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX090714_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
KJ647350_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ477453_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JN604175_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX090614_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
AB188242_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
MK598672_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK618423_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK618424_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK618425_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagaacccagggt
JX090712_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MH724216_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ477452_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
MK598665_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK598664_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ477456_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK618422_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594416_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594417_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
EU594409_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594401_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX096958_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP184497_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP202941_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP202942_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP202944_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT962022_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594402_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594429_PreS2_P-D      atgcagtggaactccactaccttccaccaaactctgcaagatcccagggt
EU594431_PreS2_P-D      atgcagtggaactccactaccttccaccaaactctgcaagatcccagggt
EU594432_PreS2_P-D      atgcagtggaactccactaccttccaccaaactctgcaagatcccagggt
KP184495_PreS2_P-D      atgcagtggaactccactaccttccaccaaactctgcaagatcccagggt
KP184496_PreS2_P-D      atgcagtggaactccactaccttccaccaaactctgcaagatcccagggt
KP184498_PreS2_P-D      atgcagtggaactccactaccttccaccaaactctgcaagatcccagggt
AB090270_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagg
JF815668_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090715_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK598667_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MH724247_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactatgcaagatcccagggt
MH724241_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JN642143_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AF043594_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KF779220_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
MK598679_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK598678_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK598677_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK598676_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK598675_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaggga
MK598671_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK618421_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK618426_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK598669_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP230541_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT962025_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594408_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP165599_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
Z35716_PreS2_P-D        atgcagtggaactccacaaccttccaccaaactcttcaagatcccagggt
MH724217_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MH724223_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN507837_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX090717_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX090675_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX090711_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594419_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594420_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594423_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594428_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP143745_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP165598_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP165601_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP165602_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP202945_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594422_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU159677_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX096956_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP143744_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK618420_PreS2_P-D      atgcaatggaactccacaaccttccaccaaactctgcaagatcccagggt
MK598673_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK598666_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcacagggt
MH724238_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MH724231_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KX827290_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594421_PreS2_P-D      atgcagtggaactccacgaccttccaccaaactctacaagatcccagggt
EU594415_PreS2_P-D      atgcagtggaactccacgaccttccaccaaactctgcaagatcccagggt
EU594410_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594407_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594427_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594400_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594403_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594413_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594414_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594424_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP165605_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KX827301_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MH724244_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MH724246_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK618418_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK618419_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN507839_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594405_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KF170761_PreS2_P-D      atgcagtggaattccacaaccttccatcaaactctgcaagatcccagggt
JX090677_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AJ627215_PreS2_P-D      atgcagtggaattccacgaccttccaccaaactctgcaagatcccagggt
AJ627216_PreS2_P-D      atgcagtggaattccacgaccttccaccaaactctgcaagatcccagggt
AJ627218_PreS2_P-D      atgcagtggaattccacgaccttccaccaaactctgcaagatcccagggt
KM108592_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagggt
AY090452_PreS2_P-D      atgcagtggaactccacaaccttccaacaaactctgcaagatcccagggt
JN604238_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
KT749827_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
KF170744_PreS2_P-D      gtgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
MK598661_PreS2_P-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccagggt
JX090700_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AY796031_PreS2_P-D      atgcagtggaacaccacaactttccaccaaactctgcaagatcccagggt
JX310728_PreS2_P-D      atgcaatggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ477455_PreS2_P-D      ---cagtggaagtccacaactttccaccaaactctgcaagatcccagggt
JX090701_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
JN642148_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagggt
JN257190_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagggt
JF754597_PreS2_P-D      atgcagtggaattccacaacgttccatcaaactctgcaagatcccagggt
KM577671_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB205128_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX310729_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
JQ687530_PreS2_P-D      atgcagtggaactccacaacgttccaccaaactctgcaagatcccagggt
KM577670_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacactgcaagatcccagagt
JN604161_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
AB188241_PreS2_P-D      atgcagtggaattcaacaaccttccaccaaactctgcaagatcccagggt
KM577669_PreS2_P-D      atgcagtggaattccacgaccttccaccaaactctgcaagatcccagggt
KM577668_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
JX090693_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
JF754621_PreS2_P-D      atgcagtggaactccacaactttccaccaaagtctgcaagatcccagggt
FJ349218_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
JX090606_PreS2_P-D      atgaagtggaactccacaaccttccaccaaactctgcaagatcccagggt
GQ183485_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctccaagatcccagagt
JX090683_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX090625_PreS2_P-D      atgcagtggaactctacaactttccaccaaactctgcaagatcccagggt
AJ627222_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KU736924_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KU736925_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
X72702_PreS2_P-D        atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
KM108593_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX090692_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
JX090685_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
EU594425_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB210820_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX090663_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MK598674_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctccaagatcccagggt
KX357637_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183484_PreS2_P-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccagggt
MK516278_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
JN664939_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX090688_PreS2_P-D      gcacagtggaacttcactaccttccaccaagctctgcaagatcccagggt
JX090619_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
MK598670_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
X97849_PreS2_P-D        atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
MK598660_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagataccagggt
MK517518_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
KX357639_PreS2_P-D      atgcagtggaactccacaatcttccaccaaactctgcaagatcccagggt
KX357638_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT749828_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
KT749821_PreS2_P-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagggt
JX090686_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JN642159_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagggt
FJ349206_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
EU594398_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU414138_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AJ627223_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB330369_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
AB205127_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
JX090718_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
AJ627220_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KF679995_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagagt
KR905423_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagggt
EU414139_PreS2_P-D      atgcagtggaaytccacaactttccatcaaactctgcaagatcccagggt
GQ477457_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
FJ349205_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
JN604295_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
FJ349208_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
MK598662_PreS2_P-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccagggt
MK598659_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
JX090699_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090679_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagaccccagggt
JX090617_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
HQ700510_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
EU594399_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagggt
JX090696_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagggt
EU594426_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagggt
MK598668_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP322601_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX090713_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
HQ700513_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
HQ700514_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX090702_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX096954_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP165600_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP165603_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594433_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594418_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594404_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594430_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
HQ700512_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX090618_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX096957_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KF170749_PreS2_P-D      atgcagtggaactccacaactttccaacaaattctgccagattccaaagt
GQ922004_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108608_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108609_PreS2_P-D      atgcagtggaattctacaaccttccaccaaactctgcaagatcccagagt
AB048701_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN604196_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
FJ904395_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904419_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700458_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
GQ922005_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM524358_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
MF618348_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KJ470896_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ470889_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ470895_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN664912_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH724251_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF192834_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF192830_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF192831_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF192832_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX310726_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX357622_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108621_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN604207_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaggatcccagagt
KF170774_PreS2_P-D      atacagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ470893_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ470885_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM606755_PreS2_P-D      atgcagtggaactccacaaccttcccacaaactctgcaagatcccagagt
KJ470894_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactytgcaagatcccagagt
KM108594_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP168419_PreS2_P-D      atacagtggaactccactaccttccaacaaactctgcaagatcccagagt
AB786650_PreS2_P-D      ------tggaactccactaccttccaacaaactctgcaagatcccagagt
JQ927384_PreS2_P-D      atacaktggaactccactaccttccaacaaactctgcaagatcccagagt
JN604174_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctacaagatcccagagt
GQ922003_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904438_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AF214659_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KF170778_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108620_PreS2_P-D      atgcagtggaattctacaaccttccaccaaactctgcaagatcccagagt
KM606754_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM606744_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM606752_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AF214661_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccaaagt
FJ904410_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108598_PreS2_P-D      atgcagtggaactccacaaccatccaccaaactctgcaagatcccagagt
KM108597_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaggatcccagagt
KM108604_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaggatcccagagt
KM108599_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaggatcccagagt
KF922432_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AJ627219_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
FJ692532_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ692533_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF170767_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904439_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904433_PreS2_C-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
LT992444_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904435_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF170763_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN688711_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagact
JN664947_PreS2_P-D      acgcagtggacctccacaaccttccaccaacctctgcaaaatcccagagt
JN604250_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF476030_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JX090623_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
JX090615_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MF979166_PreS2_P-D      atgcaatggaattctgcaactttccaccaaactctgcaagatcccagagt
MF979155_PreS2_P-D      atgcagtggaatttcgcaactttccaccaaactctgcaagatcccagagt
MF979165_PreS2_P-D      ttgcagtggaattatgcaaatttccaccaaactctgcaagatcccagagt
KM212957_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP143742_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP143743_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP165597_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF439719_PreS2_P-D      atgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagt
JF439713_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439717_PreS2_P-D      atgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagt
JF439694_PreS2_P-D      atgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagt
JF439715_PreS2_P-D      atgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagt
JF439712_PreS2_P-D      atgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagt
JF439707_PreS2_P-D      atgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagt
JF439702_PreS2_P-D      atgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagt
JF439693_PreS2_P-D      atgcagtgaaattccacaaccttttaccaaactctgcaagatcccagagt
JF439695_PreS2_P-D      atgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagt
JF439716_PreS2_P-D      atgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagt
JF439692_PreS2_P-D      gtgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JF439699_PreS2_P-D      atgcagtggaattccacaacccttcaccaaactctgcaagatcccagagt
JF439718_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439710_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439708_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439706_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439711_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439700_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439701_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439704_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439705_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439709_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439696_PreS2_P-D      gtgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JF439703_PreS2_P-D      gtgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KM524340_PreS2_P-D      -tgaggtggacctccaaaaccttccaccaagctctgcaagatcccagagt
JN664932_PreS2_P-D      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagagt
JN664926_PreS2_P-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
KC875340_PreS2_P-D      atgcagtggacttccacaaccttccaccaagctctgcaagatcccagagt
JN664924_PreS2_P-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
KM524345_PreS2_P-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
KX196229_PreS2_P-D      atgcagtggacctccacaaccttccaccaaggtctgcaagatcccagagt
KC875342_PreS2_P-D      atgcagtggacctccacaaccttccaccaaggtctgcaagatcccagagt
GQ205385_PreS2_P-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
KU668447_PreS2_P-D      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagagt
GQ205389_PreS2_P-D      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagagt
GQ205388_PreS2_P-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
MF618342_PreS2_P-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
KU668448_PreS2_P-D      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagagt
GQ205382_PreS2_P-D      atgcagtggacatccacaaccttccaccaagctctgcaagatcccagagt
GQ205384_PreS2_P-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
DQ336691_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ336689_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ486021_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ336686_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ336687_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ336688_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ336692_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY236160_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ336690_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ464176_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ464177_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY236164_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ486022_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ336685_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ464175_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ464178_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ464174_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ464173_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
DQ464172_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ336678_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ336674_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ336675_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ336679_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ336676_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ336677_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MF979168_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF979173_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF979174_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF979171_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF979157_PreS2_P-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagagt
MF979163_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
U87737_PreS2_P-D        atgcagtggaattccacaaccttccaccaaactctgacagatcccagagt
MH724235_PreS2_P-D      atgcagtggaattccacaaccttccatcaaactctgcaagatcccagagt
KR139748_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464838_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF979167_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF979156_PreS2_P-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagagt
MF979161_PreS2_P-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagagt
MF979175_PreS2_P-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagagt
MF979176_PreS2_P-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagagt
AY233294_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464844_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464833_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AY233292_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AY233291_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464840_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464842_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464841_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464849_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464836_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF979172_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF979154_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF979158_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF979160_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF979164_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KF476029_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464843_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464848_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464834_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF979170_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF979162_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KF476028_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KM519455_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KR139747_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KT347090_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464831_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464832_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464837_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464839_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464845_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464847_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464853_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464854_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN664922_PreS2_P-D      atgcagtggaattccacaaccttccaccaagctctgcaagatcccagagt
DQ131123_PreS2_P-D      atgcagtagaactccacaaccttccaccaaactctgcaagatcccagagt
DQ131122_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724226_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724249_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724250_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ329356_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
DQ329357_PreS2_P-D      atgcagtggaactcctcaaccttccaccaaactctgcaagatcccagagt
KF779289_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779222_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatccaagagt
DQ464168_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN604275_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KU668439_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF618343_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JX470760_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagggt
KC012652_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagggt
JN664913_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN664921_PreS2_P-D      atgcagtggaattccacaaccttccaccaagctctgcaagatcccagagt
MF488704_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN604272_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
DQ464169_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AY233296_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
DQ464170_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AY230116_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN664909_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN664917_PreS2_P-D      atgcagtggaattccacaaccttccaccaagctcctgcagatcccagagt
KU668436_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatctcagagt
KU668435_PreS2_P-D      atgcagtggacttccacaaccttccaccaaactctgcaagatcccagagt
KM524350_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KM524349_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN664938_PreS2_P-D      atgcagtggaattccacaaccttccaccaagctctgcaagatcccagagt
KM524361_PreS2_P-D      atgcagtggaattccacaaccttccaccaagctctgcaagatcccagagt
JN664937_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN664936_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
JN664914_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KU668442_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN664910_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN257181_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AM422939_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
DQ315776_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN664911_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KF170746_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KU668433_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KU668434_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KU668437_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KU668438_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KU668445_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KU668446_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF618339_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF618340_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF618341_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
V01460_PreS2_P-D        atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
FJ349214_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KJ843187_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779301_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779302_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779296_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779288_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779212_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779216_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779285_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779303_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779318_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779218_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779219_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779209_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779230_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KM606745_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KF779223_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JX898691_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JX898692_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JN604301_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
AJ131956_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KP090177_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KP090178_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH724218_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH724219_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KF779217_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779225_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JX898694_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
FJ349209_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN604313_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KX827292_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779377_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779376_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779341_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779292_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779340_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779228_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779229_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KF779224_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JX898697_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JN604170_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JX898689_PreS2_P-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JN604318_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090611_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ647355_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090622_PreS2_P-D      atgcagtggaactccacaaccttccaccaaaccctgcaagatcccagagt
JX090680_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ647353_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
MK693109_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JX090664_PreS2_P-D      atgcagtggaactccacaaccttccaacaaactctgcaagatcccagagt
EU939680_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN688685_PreS2_P-D      ---cagtggacctcctcaaccttccaccaaactctgcaagatcccagagt
U87851_PreS2_P-D        atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JX090689_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
DQ486025_PreS2_P-D      gtgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
X85254_PreS2_P-D        atgcagtggaactccacaaccttccaacacactctgcaagatcccagagt
FJ349213_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM524356_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090658_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN370954_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU921418_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN688710_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF679990_PreS2_P-D      atgcagtggaactcaactaccttccaccaaactctacaagatcccagagt
JX090616_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
EU414142_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
MN507852_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
MK618441_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
MK618443_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
MK598657_PreS2_P-D      atgcagtggaactccacaacattccatcaaactctgcaagatcccagagt
MK598651_PreS2_P-D      atgcagtggaactccacaacattccatcaaactctgcaagatcccagagt
MK598655_PreS2_P-D      atgcagtggaactccacaacattccatcaaactctgcaagatcccagagt
JX090605_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
JX090698_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
JX090620_PreS2_P-D      atgcagtggaactccacaaccttccgtcaaactctgcaagatcccagagt
JX090639_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
JX090657_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
KF779214_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
EU414141_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
JX090691_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
JX090709_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
JX090710_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
EU594382_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
MH724245_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF779382_PreS2_P-D      atgcagtggaactccacaaccttccaccaaaccctgcaagatcccagagt
KM108619_PreS2_P-D      atgcagtggaattccaaaacctccaacaaaactctgcaagatcccagagt
U87738_PreS2_P-D        atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
EU594434_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY221115_PreS2_P-D      atgcagtggaactccacaaccttccaccaagctctgcaggatcccagagt
KX276998_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JX090656_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090624_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctgcaagatcccagagt
GQ183473_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EF103277_PreS2_P-D      atgcagtggaactctccaaacttccaccaaactttgcaagatcccagagt
KP090179_PreS2_P-D      atggggaggaactccacaaccttccaccaaactctgcaagatcccagagt
EU921419_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090670_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
JX090607_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090608_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090612_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724232_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
LT992438_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KU736927_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KU736926_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090682_PreS2_P-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagagt
JN688679_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ236016_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
FJ562338_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875314_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875337_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196232_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196220_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875325_PreS2_P-D      atgcagtggaactccacaaccctccaccaaactctgcaagatcccaaagt
KC875326_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
KX196222_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875318_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
KC875316_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875315_PreS2_P-D      atgcagtggaactccagaaccttccaccaaactctgcaagatcccagagt
KC875313_PreS2_P-D      atgctgtggaactccacaaccttccaccgaactctgcaagatcccagagt
KX196233_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcgagatcccagagt
KX196231_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196219_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196218_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196216_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875336_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875334_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcgagatcccagagt
KX196221_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcgagatcccagagt
KC875333_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875332_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875320_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcgcagagt
KX196217_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcgcagagt
KC875317_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875335_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196230_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196234_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875319_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875321_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ236014_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
HQ236015_PreS2_P-D      atgcagtggaactccaccaccattcaccaaactctgcaagatcccagagt
JF815674_PreS2_P-D      atgcagtggaactccacaatcttccaccaaactctgcaagatcccagagt
KC774437_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN688712_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK598658_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090671_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JX090613_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN688683_PreS2_P-D      atgcagtggaaytccacaaccttccaccaaactctgcaagatcccagagt
GQ922000_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EF103275_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
JN688722_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP202936_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
JN688713_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875329_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196235_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN664920_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JX090659_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH724237_PreS2_P-D      atgcagtggagctccacaaccttccaccaaactctgcaagatcccagagt
KP090180_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF679992_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF679993_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KT366497_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KT366507_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875324_PreS2_P-D      atgcagtggaactccacaaccttccaccacactctgcaagatcccagagt
JX090694_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN688708_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB493846_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB270539_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
JX090672_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
GQ183478_PreS2_P-D      atgcagtggaactccactaccttccaccaaactctgcaagatcccagagt
EU414143_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875322_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
KC875323_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
KX196225_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
KX196224_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
JX090628_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF815673_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF815672_PreS2_P-D      atgcagtggaactccacaatcttccaccaaactctgcaagatcccagagt
JF815665_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF815666_PreS2_P-D      atgcagtggaactccacaatcttccaccaaactctgcaagatcccagagt
JF815670_PreS2_P-D      atgcagtggaactccacaatcttccaccaaactctgcaagatcccagagt
JF815678_PreS2_P-D      atgcagtggaactccacaatcttccaccaaactctgcaagatcccagagt
JF815679_PreS2_P-D      atgcagtggaactccacaatcttccaccaaactctgcaagatcccagagt
MH724242_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724224_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724225_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724227_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724228_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724229_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724230_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724248_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875331_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875328_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagattccagagt
JX090669_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN688678_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF815676_PreS2_P-D      atgcagtggaactccacaatcttccaccaaactctgcaagatcccagagt
HM750151_PreS2_P-D      atgcagtggaactccacaaacttccaccaaactctgcaagatcccagagt
FJ349232_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724215_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724220_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC774436_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC774460_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
LT992454_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
X65257_PreS2_P-D        atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK541688_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK507912_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF679989_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090673_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JX090667_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JX090662_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN370949_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN370950_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN370951_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN370952_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN370953_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090661_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JX090666_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JX090674_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
FJ692506_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ692507_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724234_PreS2_P-D      atgcagtggaactccaccaccttccaccaaactctgcaagatcccagagt
MH724233_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875330_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ922002_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ922001_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP090181_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724214_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724221_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN604245_PreS2_P-D      atgcagtggaactccaaaatcttccaccaaactctgcaagttcccagagt
JN257153_PreS2_P-D      ---cagtggamywscamarmctttcaccaaactctgcaagatcccagagt
JN257195_PreS2_P-D      ---cagtggamywscamarmctttcaccaaactctgcaagatcccagagt
JN257214_PreS2_P-D      atgcagtggaaytccacaaccttccaccaaactctgcaagatcccagagt
MK052949_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagggt
MK052950_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052959_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052973_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052975_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052951_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052974_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052948_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052963_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052971_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052966_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052955_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052956_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052958_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052960_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052952_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagggt
MK052961_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052972_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052954_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagggt
MK052947_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagggt
MK052953_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctacaagagcccagggt
AB674420_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KT749823_PreS2_P-D      atacagtggaacctcaaaaccttccaccaaactctgcaagatcccagagt
JF754598_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
GU456678_PreS2_P-D      atgcagtggaactccacaaacttccaccaaactctgcaagatcccagagt
JX090697_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
JN257162_PreS2_P-D      atgcagtggaaytccacaaccttccaccaaactctgcaagatcccagagt
KF170768_PreS2_P-D      atacagtggaactctacaaccttccaccaaactctacaagatcccaaagt
AY741798_PreS2_P-D      atgcagtggaactcaacaacattccaccaaactctgcaagatcccaaagt
JX090637_PreS2_P-D      atgcagtggaattccacaaccttccatcaaactctgcaagatccccgagt
DQ464181_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctgcaagatcccggagt
JX310734_PreS2_P-D      atgcagtggaa---cacaacctttcgccaaactctgcaagatcccagagt
JX310733_PreS2_P-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
JN040804_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754611_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AB674424_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaaaatcccagagt
JF754631_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX310735_PreS2_P-D      atgcagtggaactccacaacctttcgcaaaactctgcaagatcccagagt
JX090610_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctgcaagatcccagagt
EU787445_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU939681_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ899792_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090719_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
JX090723_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU787443_PreS2_P-D      atgcagtggaactccacaaccttcaaccaaactctgcaagatcccagagt
JX090720_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090707_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MK598637_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
MK598640_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
MK598636_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
MK598638_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
MK598639_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
MK598641_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
JX090724_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090722_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN507838_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
MN507853_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
HM750155_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HM750156_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactccgcaagatcccagagt
JX090644_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ833467_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU787437_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU787438_PreS2_P-D      ---cagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JX090629_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ833465_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU787447_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HM750154_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KY629630_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090705_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ833469_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HM750153_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU919197_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ833468_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC774462_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090708_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090703_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090646_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ833471_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090626_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090630_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090631_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090632_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090638_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090642_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090643_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090645_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090704_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU787440_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU787442_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX276999_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ833470_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642154_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642128_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040818_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctgcaagatcccagagt
JF754617_PreS2_P-D      atgcagtggaacaccataaacttccatcaaactctgcaagatcccagagt
AB188244_PreS2_P-D      atgcagtggaactctacaaccttccaccaaactctgcaagatcccagagt
AB330367_PreS2_P-D      atgcagtggaattccacgaccttccaccaaactctgcaagattccagagt
JN664919_PreS2_P-D      atgcagtggaactccacaaacttccaccaaactctgcaagatcccagggt
MK355501_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754629_PreS2_P-D      atgcagtggaactcaacaaccttccatcaaactctgcaagatcccagagt
GQ184322_PreS2_P-D      gtgcagtggaactccacaactttccaacaaactctgcaagattccagagt
GQ167301_PreS2_P-D      gcgcagtggaactccacaactttccaacaaactctgcaagatcccagagt
GQ167302_PreS2_P-D      gtgcagtggaactccacaactttccaacaaactctgcaagatcccagagt
JN642138_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
JF754588_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456665_PreS2_P-D      atgcagtggacttccacaactttccaccaaactctgcaagatcccagagt
DQ464182_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642133_PreS2_P-D      gtgcagtggaattccacagccttccaccaaactctgcaagatcccagagt
JN040782_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN040768_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642155_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642165_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724236_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN040822_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040776_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
JN040769_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
AB270550_PreS2_P-D      atgcagtggaactccacaaccttccaacaaactctgcaagatcccagagt
GQ183467_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183460_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183469_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183461_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183456_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183459_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183468_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183458_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183455_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183452_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183449_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183448_PreS2_P-D      atgcagtggaactccacaatcttccaccaaactctgcaagatcccagagt
GQ183450_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183451_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183453_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183454_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183457_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183462_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183463_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183464_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183465_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183466_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257165_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
JN257166_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
JN257160_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaaratcccavagt
JN040772_PreS2_P-D      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagagt
JN040753_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaaaatcccagagt
JF754632_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090609_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257176_PreS2_P-D      atgcagtggaactmcacaaccttccaccaaactctgcaagatcccagagt
JN257177_PreS2_P-D      atgcagtggaactmcacaaccttccaccaaactctgcaagatcccagagt
AB674406_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EF103276_PreS2_P-D      atgcagtggaaccccacaaccttccaccaaactctgcaagatcccagagt
MK618429_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagtgt
MK618430_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagtgt
MK618432_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagataccagagt
MK618433_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagataccagagt
AB674419_PreS2_P-D      atacagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JX090634_PreS2_P-D      atgcagtggaactccacaaccttccaacaaactctgcaagatcccagagt
JN040766_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456657_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagagt
AB674416_PreS2_P-D      attcagtggaactccacgaccttccaccaaactctgcaagatcccagagt
JF754630_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456643_PreS2_P-D      atgcagtggaactccacaacctttcatcaaactctgcaagatcccagagt
JN642126_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
JN040820_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AB674431_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
JN040775_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456642_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
L27106_PreS2_P-D        atgcactggaattacacaaccttccaccaaactctgcaagatcccagagt
JN642150_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
HQ700449_PreS2_P-D      atgcagtggaactcyacaaccttccaccaaackctgcaagatcccagagt
FJ349215_PreS2_P-D      atgaagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754599_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754623_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456645_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
X80924_PreS2_P-D        atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
X80926_PreS2_P-D        atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
KM108595_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642164_PreS2_P-D      atgcaatggaattccacaaccttccaccaacctctgcaagatcccaaagt
KF471644_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040779_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
GU456639_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB555500_PreS2_P-D      atgcagtggaactccacgaacttccaccaaactctgcaagatcccagagt
JX090678_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
JX036331_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JN604239_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257186_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040790_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040755_PreS2_P-D      atgcagtggaattccacaacattccaccaaactctgcaagatcccagagt
M32138_PreS2_P-D        atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456682_PreS2_P-D      atgcagtggaactccacaaccttccaccgaactctgcaagatcccagagt
GU456674_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM524348_PreS2_P-D      atgcagtggaaatccctgaccttccaccaaactctgcaagatcttgtagt
AB674425_PreS2_P-D      gtgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456676_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccggagt
JN642135_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
FJ562309_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaaaatcccggagt
AB674411_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AB270541_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
KU668441_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KU668444_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456675_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456651_PreS2_P-D      atgcagtggaattccacaacattccaccaaactctgcaagatcccagagt
JX090721_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456684_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456635_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB674428_PreS2_P-D      acacagtggaactccacaactttccaccaaactttgcaagatcccagagt
MK355500_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK693107_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN040788_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040786_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040787_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471642_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
KF170775_PreS2_P-D      atgcagtggaattccacaaccttccaccaagctctgcaagatcccagagt
JX090635_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642149_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642142_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JN642134_PreS2_P-D      gtgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642132_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040773_PreS2_P-D      atgcagtggaactccgcaaccttccaccaaactctgcaagatcccagagt
GU456649_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904429_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN792905_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257148_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700472_PreS2_P-D      atgcagtggaactccacaaccttccgccaaacgctgcaagatcccagagt
AB674423_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KT201292_PreS2_P-D      ---------aactccacaaccttccaccaaactctgcaagatcccagagt
JF754606_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642166_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108596_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642147_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaggatcccagagt
GQ477458_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904426_PreS2_P-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
JX090640_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642131_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257159_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040830_PreS2_P-D      atgcagtggaattccacaacatttcaccaaactctgcaagatcccagagt
AB555501_PreS2_P-D      atgcagtggaactccacaaacttccaccaaactctgcaagatcccagagt
AB555497_PreS2_P-D      atgcagtggaaatccacgaacttccagcaaactctgcaagatcccagagt
JF754635_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754626_PreS2_P-D      atccagtggaactccagaaacttccaccaaactctgcaagatcccagagt
JN040800_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040801_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MF925391_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
KF170772_PreS2_P-D      atgcagtggaactctacaaccttccaccaaactctgcaagatcccagagt
JN642158_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257211_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257150_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040757_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
JN040750_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904427_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ349219_PreS2_P-D      atgcagtggaactccacaaccttcaaccaaactctgcaagatcccagagt
AJ344116_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN792912_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
JN257172_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040809_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040784_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754600_PreS2_P-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagagt
GU456679_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456672_PreS2_P-D      atgcagtggaactccacaaccttccaacaaactctgcaagatcccagagt
GU456667_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ991752_PreS2_P-D      gtgcagtggaactccacaaccttcaaccaaactctgcaagatcccagagt
AB555496_PreS2_P-D      atgcagtggaactccacaaacttccaccaaactctgcaagatcccagagt
JN040751_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700481_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700463_PreS2_P-D      atgcaatggaacgccacaaccttccaccaaacgctgcaagatcccagagt
EF103280_PreS2_P-D      atgcagtgaaactccacaactttccaccaaactctgcaagatcccagagt
MK507913_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF061170_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700444_PreS2_P-D      atgcagtggaattccacaaccttccaccaaacgctgcaagatcccagagt
HQ700480_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700477_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700474_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700478_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700553_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
KT366499_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB786644_PreS2_P-D      ------tggaactccacaaccttccaccaaactctgcaagatcccagagt
AB246347_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KT366498_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KT366500_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KT366501_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KT366502_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700473_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700483_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700468_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700448_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700445_PreS2_P-D      atgcagtggaactccacaaccttccatcaaacgctgcaagatcccagagt
HQ700446_PreS2_P-D      atgcagtggaactccacaaccttccatcaaacgctgcaagatcccagagt
HQ700487_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700455_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700454_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700440_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700441_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700442_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700443_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700447_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700450_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700451_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700459_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700464_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700466_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700469_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700470_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700471_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700479_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700482_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700484_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700488_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
HQ700453_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagt
KP995100_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
KM524338_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF061169_PreS2_P-D      atgcagtggamcbccacaaccttccaccaaactytgcaagatcccagagt
JX036334_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcatgatcccagagt
JN642136_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KY629633_PreS2_P-D      atgcagtggaactcaacaaccttccaycaaactctgcaagatcccagagt
JX090665_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
JN688695_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
JN040814_PreS2_P-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccagagt
JN040762_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904415_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaggatccaagagt
FJ904420_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcargatccmagagt
FJ904421_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcargatccmagagt
EF103281_PreS2_P-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagagg
DQ304548_PreS2_P-D      acgaagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ304547_PreS2_P-D      acgaagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ304550_PreS2_P-D      acgaagtggaactccacaaccttccaccaaactctacaagatcccagagt
DQ304551_PreS2_P-D      acgaagtggaactccacaaccttccaccaaactctacaagatcccagagt
AY236162_PreS2_P-D      acgaagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ304549_PreS2_P-D      acgaagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KT201241_PreS2_P-D      ---------aactccamaaccttccaccaaactctgcaagatcccagagt
JN642129_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456658_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
GU456654_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
X97848_PreS2_P-D        atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JN664931_PreS2_P-D      atacagtggaactccacaaccttccaacaatctctgcaagatcccaaagt
JN642140_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN604312_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904446_PreS2_P-D      atgcagtggaacatcacaaccttccaccaaactctgcaagatcccagagt
AY721611_PreS2_P-D      atgcagtggaactccgcaaccttccacgaaactctgcaagatcccagagt
MK693108_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KX276975_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF170770_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090660_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642156_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257200_PreS2_P-D      atgcagtggaactccacaaccttccaacaaactctgcaagatcccagagt
JN257188_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257183_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257163_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040812_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040793_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040774_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
JF754610_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccggagt
GU456677_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456637_PreS2_P-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccagagt
GU357846_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904422_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904402_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ111986_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
AY945307_PreS2_P-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagggt
AY373431_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB674403_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagagt
AB126581_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471657_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471655_PreS2_P-D      atgcagtggaactccacgacttttcaccaaactctgcaagatcccagagt
KF471650_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040810_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
JN040802_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754619_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456671_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456636_PreS2_P-D      atgcagtggaacaccacaactttccaccaaactctgcaagatcccagagt
KF471659_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090676_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090641_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX036333_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN642157_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
JF754614_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ349235_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
AB104711_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471645_PreS2_P-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccagagt
JN040819_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754634_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatccaagagt
EF103279_PreS2_P-D      atgcagtgaaattccacaactttccaccaaactctgcaagatcccagagt
AY161153_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY161155_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY161154_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY161156_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY161151_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY161150_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY161152_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108602_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108603_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471640_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
MK618431_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK618437_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754605_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642145_PreS2_P-D      atgcagtggaactccacaaccttccaccaaacactgcaagatcccaaagt
GU456650_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
AB674427_PreS2_P-D      atgcagtggaaytccacaacctttcaccaaactctgcaagatcccagagt
AB270547_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KT201240_PreS2_P-D      ---------aactccacaaccttccaccaaactctgcaagatcccagagt
LT992439_PreS2_P-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
KT963508_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF170756_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcacagagt
JX096955_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090668_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
JN792906_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctgcaagatcccagagt
JN642161_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN604189_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040821_PreS2_P-D      atgcagtggaacaccacaaccttccaccaaactctgcaagatcccagagt
JN040817_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040811_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
JN040759_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754592_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JF754590_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagaccccagagt
GU456669_PreS2_P-D      atgcagtggaactccacaaccttccaccaaaccctgcaagatcccagagt
GU456653_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ349234_PreS2_P-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
AY741797_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
AF151735_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB674408_PreS2_P-D      atgcagtggaacagcacaaccttccaccaaactctgcaagatcccagagt
AB674404_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaaaatcccagagt
AB270546_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875299_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
KX196208_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875293_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875294_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875306_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875308_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875305_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196228_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196211_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875288_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875296_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875309_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196209_PreS2_P-D      atgcagtggaactccacaaccctccaccaaactctgcaagatcccagagt
KC875290_PreS2_P-D      atgcagtggaactccacaaccctccaccaaactctgcaagatcccagagt
KX196212_PreS2_P-D      atgcagtggaactccacaaccctccaccaaactctgcaagatcccagagt
AB222710_PreS2_P-D      ---cagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642153_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040824_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040808_PreS2_P-D      atgcagtggaactccgcaaccttccaccaaactctgcaagatcccagagt
JF754633_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456673_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456666_PreS2_P-D      atgcagtggaactccaccaccttccaccaaactctgcaagatcccagagt
JF754612_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754609_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
JF754603_PreS2_P-D      ctgcagtggaactccacaaccttccacaacactctgcaagatcccagagt
AB246348_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB104710_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108600_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108601_PreS2_P-D      atgcagtggaactccacaaccttccaacaaactctgcaagatcccagagt
AB786653_PreS2_P-D      ------tggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090647_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090621_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456659_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatccaagagt
GU456652_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257203_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257202_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
GU456661_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904431_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904418_PreS2_P-D      atgcagtggaactccacacccttccaccaaactctgcaagatcccaaagt
AB270548_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471656_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257201_PreS2_P-D      atgcagtggggctccacaaccttccaccaaactctgcaagatcccaaagt
JN040823_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040777_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN792911_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN792908_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN792907_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN792903_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN792909_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN792910_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN792904_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KT201234_PreS2_P-D      ---------aactccacaaccttccaccaaactctgcaagatcccagagt
KX827300_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
KF471654_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471647_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF170757_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagagt
KF170755_PreS2_P-D      atgcagtggaattccaccaccttccaccaaactctgcaagatcccagagt
KF061167_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090716_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX090695_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
JX090681_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090636_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257170_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257152_PreS2_P-D      atgcagtggagctccacaaccttccaccaaactctgcaagatcccagagt
JN257149_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040827_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040826_PreS2_P-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccagagt
JN040815_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040806_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040795_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040771_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456683_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctgcaagatcccagagt
GU456681_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456680_PreS2_P-D      atgcagtggaactcaacaaccttccaccaagctctgcaagatcccagagt
GQ205380_PreS2_P-D      atgcagtggacctccacaaccttccaccaaactctgcaagatcccagagt
KM524342_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183480_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904445_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
FJ349231_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB330370_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MK618427_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
KX827291_PreS2_P-D      atgcagtggaactctacaaccttccaccaaactctgcaagatcccagagt
KF471660_PreS2_P-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
JN040799_PreS2_P-D      atgcagtggaactccaaaaccttccaccaaactctgcaagatcccagagt
JN040758_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754593_PreS2_P-D      atgcagtggaactccacaaccttccatcaaactctccaagatcccagagt
GU456638_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754602_PreS2_P-D      atacagtggaactccacaatcttccaccaaactctgcaagatcccagagt
GU456668_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875304_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
KC875303_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
KC875302_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
KC875285_PreS2_P-D      atgcagtggaactccacaaccctccaccaaactctgcaagatcccagggt
KC875281_PreS2_P-D      atgcagtggaactccacaaccctccaccaaactctgcaagatcccagagt
KC875280_PreS2_P-D      atgcagtggaactccacaacctgccaccaaactctgcaagatcccagagt
KC875275_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196226_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196213_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
KX196210_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
KC875291_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
KC875284_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcgcagagt
KC875278_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875300_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875298_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK618435_PreS2_P-D      gtgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK618434_PreS2_P-D      gtgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK618436_PreS2_P-D      gtgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090655_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagagt
JX090649_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagagt
JX090650_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagagt
JX090651_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagagt
JX090652_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagagt
JX090653_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagagt
JX090654_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagagt
MK598647_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatacgagagt
GU456655_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB222712_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456647_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875276_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196214_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK598650_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagataccagagt
MK598649_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagataccagagt
MK598646_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagataccagagt
MK598645_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK598644_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF584160_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471649_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471646_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471641_PreS2_P-D      atgcagtggaactccacaaccttccaccaaaatctgcaagatcccagagt
KF170776_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF170773_PreS2_P-D      atgcagtggaactctacaaccttccaccaaactctgcaagatcccagagt
KF061168_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875301_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875289_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
JX090706_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642151_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642146_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN604259_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257199_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN040813_PreS2_P-D      atgcagtggaactccacaaccttccaccaaaccctgcaagatcccagagt
JN040805_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
JN040794_PreS2_P-D      atgcagtggaactcaacaaccttccaccaaactctgcaagatcccagagt
JN040791_PreS2_P-D      atgcagtggaactccacaaacttccaccaaactctgcaagatcccagagt
JN040781_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040767_PreS2_P-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccagagt
JN040765_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040761_PreS2_P-D      atgcagtggaactccacaaccttcaaccaaactctgcaagatcccagagt
JF754601_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456670_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456664_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456646_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754607_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456641_PreS2_P-D      atgcagtggaactccacaaccttcaaccaaactctgcaagatcccagagt
FJ904424_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ349233_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU787441_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU594396_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
AF214660_PreS2_P-D      atgcagtggaattccactaccttccaccaaactctgcaagatcccagagt
AF121239_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB674429_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB674407_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB270542_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB104709_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK598642_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754594_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AF280817_PreS2_P-D      atgcagtggaactccacaatcttccaccaaactctgcaagatcccagagt
AY721608_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KY382412_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ477459_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF584161_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF584163_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF584164_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF584165_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF584166_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KY382414_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF584162_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY741794_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY741795_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY741796_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF170771_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904432_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB674405_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090633_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456656_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875277_PreS2_P-D      atgcagttgaactccacaaccttccaccaaactctgcaagagcccagagt
KX196215_PreS2_P-D      atgcagttgaactccacaaccttccaccaaactctgcaagagcccagagt
AY161157_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY161158_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK618428_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
MN507851_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
MN507836_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
AY721610_PreS2_P-D      ---------aactccacaaccttccaccaaactctgcaagatcccagagt
MK598648_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagataccagagt
MK598643_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724252_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagagt
KT366508_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM606753_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108605_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875297_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196236_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875292_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875287_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875282_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875279_PreS2_P-D      atgcagtggaactccacaaccttccgccaaactctgcaagatcccagagt
KC774477_PreS2_P-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
KC774459_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC774445_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC774444_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC774440_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JQ687531_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642130_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN604265_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257205_PreS2_P-D      atgcagtggaactccacaaccttccaacaaactctgcaagatcccagagt
JN257182_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257151_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040829_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040828_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040797_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
JN040796_PreS2_P-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
JN040778_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccggagt
JN040770_PreS2_P-D      atgcagtggaacttcacaaccttccaccaaactctgcaagatcccagagt
JF754627_PreS2_P-D      atgtactggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754624_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754615_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754608_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754595_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700511_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456663_PreS2_P-D      atgcagtggaactctacaaccttccaccaaactctgcaagatcccagagt
GU456640_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
FJ386590_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ349228_PreS2_P-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccagagt
FJ349217_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ349216_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU414136_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU414135_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaaratcccaragt
DQ991754_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY721612_PreS2_P-D      atgcagtggaactccacaacctaccaccaaactctgcaagatcccagagt
AY721609_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY721607_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY721606_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY721605_PreS2_P-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AY661792_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
AY661793_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
AY161159_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY161160_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AF121242_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB674422_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB222713_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB222709_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB104712_PreS2_P-D      atgcagtggaactccactaccttccaccaaactctgcaagatcccagagt
JX090684_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040783_PreS2_P-D      atgcagtggaacaccacaaccttccaccaaactctgcaagatcccagagt
JX090687_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ349229_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK517524_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK507910_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
LC365689_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KY629634_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF170766_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX090627_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642167_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN604278_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN604263_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN604206_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040792_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HM750152_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ349230_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU787446_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB270543_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB222711_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB583680_PreS2_P-D      atgaagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU594397_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU787436_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183470_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ377589_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257179_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257185_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK507911_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK507914_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM524339_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF170765_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257196_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257169_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754618_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754591_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ315778_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257155_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AJ627224_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF170758_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF170759_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108591_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108606_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM108607_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904412_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456660_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK517521_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471658_PreS2_P-D      atgcagtggaactccacaaccttccaccagactctgcaagatcccagagt
KF170764_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257209_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257171_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904443_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ349220_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754604_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754628_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF170747_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP322600_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK517520_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875295_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX196227_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
Y07587_PreS2_P-D        atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
X02496_PreS2_P-D        atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040807_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY796030_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU456648_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JF754596_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471651_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471652_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AF121240_PreS2_C-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AF121241_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257193_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK517522_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK517523_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC875286_PreS2_P-D      atgcagtggaactccacaaccttcaaccaaactctgcaagatcccagagt
KC875283_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY796032_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904399_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN040785_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP322599_PreS2_P-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
                                                                          

EU155895_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
JX310727_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
KF170769_PreS2_P-D      caggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU414140_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
X65258_PreS2_P-D        gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MF925366_PreS2_P-D      gagaggcctgtactttcctgctggtggctccagttccggaacagtaaacc
EU155893_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN604152_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacastaaacc
JQ707689_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707683_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707697_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707699_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707702_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707706_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707703_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707693_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707682_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707684_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707685_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707686_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707687_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707688_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707691_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707692_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707694_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707695_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707696_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707698_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707700_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707701_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707704_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707705_PreS2_P-D      gagtggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707690_PreS2_P-D      gagtggcctgtatttccctgctggtggcttcagttcaggaacagtaaacc
JX090648_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ477454_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090690_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170760_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN604139_PreS2_P-D      gaaaggcctgcatccccctgctggtggctccagttcaggaacagtaaacc
KT366494_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
DQ399006_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MF925390_PreS2_P-D      gaaaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KX276856_PreS2_P-D      gagrggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642163_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT151620_PreS2_P-D      gagaggcctgtctttccctgctggtggctccagttcaggagcagtaaacc
JN664941_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacaccaaacc
KF053178_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
JN604120_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggracagtaaacc
KT366465_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagggacagtaaacc
AB119255_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtcaacc
JN642144_PreS2_P-D      gagggggctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX276857_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcgggaacagtaagcc
AY090453_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU668449_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcgggaacagtgaacc
KT366511_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664927_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
JQ707511_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366510_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF925379_PreS2_P-D      gaggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707491_PreS2_P-D      gagatgcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664928_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524346_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524351_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598663_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707529_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707519_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707517_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707516_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707513_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707512_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707514_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707515_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707518_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707520_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707521_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707522_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707523_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707526_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707528_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707530_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707524_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707525_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB119256_PreS2_P-D      gagaggcctgtgtttccctgctggtggctccagttcaggaacagtaaacc
MH932714_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KT366493_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524344_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183471_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707505_PreS2_P-D      cagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707499_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707494_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707490_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707487_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707485_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707484_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707481_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707479_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707476_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707478_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707482_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707489_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707496_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707500_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707502_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707507_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707508_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707480_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707488_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707503_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524347_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664918_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF618349_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF679998_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183481_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF679997_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707506_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183479_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183477_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183476_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP165604_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183472_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB119254_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524341_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtacacc
JQ707483_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707486_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707527_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF925363_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT366496_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT366491_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875311_PreS2_P-D      gagaggcctgtatttccctgctggtggctccacttcaggaacagtaaacc
KC875310_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707504_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707493_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ924652_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB119252_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB109479_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB090268_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB120308_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183474_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524352_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524353_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF679994_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF679996_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707498_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707509_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB090269_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB116266_PreS2_P-D      gaggagcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183482_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183483_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP184499_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP202937_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP202938_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP202939_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP202940_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP202943_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT962021_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT962023_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT962024_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF925364_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707510_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707501_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707497_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707492_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707477_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ707495_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664930_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
MF925383_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
MF925393_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ183475_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB109478_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB109475_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB109476_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB109477_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB110075_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB119251_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB119253_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB205126_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB210821_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB210822_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB267090_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB471856_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB471857_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875312_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524354_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524355_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KR905424_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366495_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366506_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366509_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF925358_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB078031_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB078033_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB078032_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ647352_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090714_PreS2_P-D      gagaggcctgtattcccctgctggtggctccagttcaggaacagtaaacc
KJ647350_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagggacagtaaacc
GQ477453_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN604175_PreS2_P-D      gagargcctgtatytccctgctggtggctccagttcaggaacagtaaacc
JX090614_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB188242_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598672_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK618423_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK618424_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK618425_PreS2_P-D      gagaggcctgtatttccctcctggtggctccagttcaggaacagtaaacc
JX090712_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724216_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ477452_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598665_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598664_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
GQ477456_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK618422_PreS2_P-D      aagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594416_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594417_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594409_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594401_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX096958_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP184497_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP202941_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP202942_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP202944_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT962022_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594402_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaagaacagtaaacc
EU594429_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594431_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594432_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP184495_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP184496_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP184498_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB090270_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF815668_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090715_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598667_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724247_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724241_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642143_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AF043594_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779220_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598679_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598678_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598677_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598676_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598675_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598671_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcacgaacagtaaatc
MK618421_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcacgaacagtaaatc
MK618426_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcacgaacagtaaatc
MK598669_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP230541_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT962025_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594408_PreS2_P-D      gagaggcctgtattaccctgctggtggctccagttcaggaacagtaaacc
KP165599_PreS2_P-D      gagaggcctgtattaccctgctggtggctccagttcaggaacagtaaacc
Z35716_PreS2_P-D        gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724217_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724223_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN507837_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090717_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090675_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090711_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594419_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594420_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594423_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594428_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP143745_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP165598_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP165601_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP165602_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP202945_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594422_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU159677_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX096956_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP143744_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK618420_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598673_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598666_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724238_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724231_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX827290_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594421_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594415_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594410_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594407_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594427_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594400_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594403_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594413_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594414_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594424_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP165605_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX827301_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724244_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724246_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK618418_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK618419_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN507839_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594405_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170761_PreS2_P-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
JX090677_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AJ627215_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcgggaacagtaaacc
AJ627216_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcgggaacagtaaacc
AJ627218_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcgggaacagtaaacc
KM108592_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY090452_PreS2_P-D      gaaaggcctgtttctccctgctggtggctccagttcaggaacagtaaacc
JN604238_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT749827_PreS2_P-D      gagaggcctatattcccctgctggtggctccagttcaggaacagcaaacc
KF170744_PreS2_P-D      gagag---------tccctgctggtggctccagttcaggaacagtaaacc
MK598661_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090700_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtacacc
AY796031_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX310728_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ477455_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090701_PreS2_P-D      gagaggcctgtatttacctgctggtggctccagttcaggaacagtaaacc
JN642148_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257190_PreS2_P-D      gcgaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754597_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KM577671_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaagttcaggaacagtaaacc
AB205128_PreS2_P-D      gagaggcctgtatttccctgctggtggttccagttcaggaacagtaaacc
JX310729_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagtttgggaacagtaaacc
JQ687530_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcacgcacagtaaacc
KM577670_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaccc
JN604161_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB188241_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
KM577669_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM577668_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090693_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754621_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349218_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090606_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183485_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090683_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090625_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AJ627222_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU736924_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU736925_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
X72702_PreS2_P-D        gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM108593_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090692_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090685_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594425_PreS2_P-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
AB210820_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaaaagtaaacc
JX090663_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598674_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX357637_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183484_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK516278_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664939_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090688_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090619_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598670_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
X97849_PreS2_P-D        gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
MK598660_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK517518_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX357639_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX357638_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT749828_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT749821_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JX090686_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642159_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349206_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
EU594398_PreS2_P-D      gagaggcctgtattcccctgctggtggctccagttcaggaacagtaaacc
EU414138_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AJ627223_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaccc
AB330369_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB205127_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090718_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AJ627220_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF679995_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KR905423_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU414139_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ477457_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349205_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN604295_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349208_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598662_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598659_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090699_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090679_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090617_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700510_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594399_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090696_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594426_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598668_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP322601_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090713_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700513_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700514_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090702_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX096954_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP165600_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP165603_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594433_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594418_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594404_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594430_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700512_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090618_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX096957_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170749_PreS2_P-D      aaacagcac------ccatgctggtggctccagttcaggaacagtaaacc
GQ922004_PreS2_P-D      gagaggcctgtatttccctgctgtggnnnnnnnnnnnnnnnnnnnaaacc
KM108608_PreS2_P-D      gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
KM108609_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB048701_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN604196_PreS2_P-D      gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
FJ904395_PreS2_P-D      gagaggcctgtacttccctgctggtggctccagttcaggaacaataaacc
FJ904419_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700458_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ922005_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524358_PreS2_P-D      aagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
MF618348_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ470896_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ470889_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ470895_PreS2_P-D      gagaggcctgwatttccctgctggtggctccagttcaggaacagtaaacc
JN664912_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724251_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF192834_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF192830_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF192831_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF192832_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX310726_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX357622_PreS2_P-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaagcc
KM108621_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN604207_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170774_PreS2_P-D      gagaggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KJ470893_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ470885_PreS2_P-D      gagaggcctgta---ccctgctggtggctccagttcaggaacagtaaacc
KM606755_PreS2_P-D      gagaggcctgtatgtccctgctggtggctccagttcaggaacagtaaacc
KJ470894_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM108594_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP168419_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
AB786650_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JQ927384_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN604174_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ922003_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904438_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AF214659_PreS2_P-D      gagaggcctttatttccctgctggtggctccagttcaggaacagtaaacc
KF170778_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM108620_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KM606754_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM606744_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM606752_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AF214661_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904410_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaatagtaaacc
KM108598_PreS2_P-D      gagaggcctgtttttccctgctggtggctccagttcaggaacagtaaacc
KM108597_PreS2_P-D      gagaggcctgtttttccctgctggtggctccagttcaggaacagtaaacc
KM108604_PreS2_P-D      gagaggcctgtttttccctgctggtggctccagttcaggaacagtaaacc
KM108599_PreS2_P-D      gagaggcctgtctttccctgctggtggctccagttcaggaacagtaaacc
KF922432_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AJ627219_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ692532_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ692533_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170767_PreS2_P-D      gagaggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
FJ904439_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904433_PreS2_C-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
LT992444_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904435_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170763_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN688711_PreS2_P-D      gataggcctggatgtctctgctggaggctcaagttcaggaacagtaaacc
JN664947_PreS2_P-D      gagag---------tccctgctggtggctccagttcaggaacagtaaacc
JN604250_PreS2_P-D      gaaaggcctatatttccctgctggtggctccagttccggaacagtaaacc
KF476030_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagcaaacc
JX090623_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090615_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
MF979166_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979155_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979165_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM212957_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP143742_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP143743_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP165597_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF439719_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439713_PreS2_P-D      gaggggcctgtagttccctgctggtggctccagttcaggagcagtaaacc
JF439717_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439694_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439715_PreS2_P-D      gagaggcctgtatttccctgctgatggctccagttcaggagtagtaaacc
JF439712_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439707_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439702_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439693_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439695_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439716_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439692_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439699_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439718_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439710_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439708_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439706_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439711_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439700_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439701_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439704_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439705_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439709_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439696_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439703_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KM524340_PreS2_P-D      gagaggcctgtatctccctgctggtggctcaacttcaggaacagtaaacc
JN664932_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN664926_PreS2_P-D      gagaggcctgtatctccctgctggtggctcaacttcaggaacagtaaacc
KC875340_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaagttcaggaacagtaaacc
JN664924_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
KM524345_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
KX196229_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaagttcaggaacagtaaacc
KC875342_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaagttcaggaacagtaaacc
GQ205385_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
KU668447_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
GQ205389_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
GQ205388_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
MF618342_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
KU668448_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
GQ205382_PreS2_P-D      gagaggcctgtacttccctgctggtggctcaacttcaggaacagtaaacc
GQ205384_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
DQ336691_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagcaaacc
DQ336689_PreS2_P-D      gagaggcctgtattcccctgctggtggctccagttcagaaacagcaaacc
DQ486021_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagcaaacc
DQ336686_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
DQ336687_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
DQ336688_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
DQ336692_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
AY236160_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
DQ336690_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagcaaacc
DQ464176_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagcaaacc
DQ464177_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagcaaacc
AY236164_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
DQ486022_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
DQ336685_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagcaaacc
DQ464175_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagcaaacc
DQ464178_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagcaaacc
DQ464174_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
DQ464173_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ464172_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
DQ336678_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
DQ336674_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
DQ336675_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
DQ336679_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
DQ336676_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
DQ336677_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
MF979168_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979173_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979174_PreS2_P-D      gaaaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MF979171_PreS2_P-D      gagaggcctgtatttccctgctggtggmtccagttcaggaacagtaaacc
MF979157_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979163_PreS2_P-D      gagagccctgtatttccctgctggtggctccagttcaggaacagtaaacc
U87737_PreS2_P-D        gagaggcctgtatcttcctgctggtggctccagttcaggaccagtaaacc
MH724235_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KR139748_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464838_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggracagtaaacc
MF979167_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979156_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979161_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979175_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979176_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagtaacagtaaacc
AY233294_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464844_PreS2_P-D      gaaaggcctgtatccccctgctggtggctccagttcaggaacagtaaacc
MH464833_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY233292_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY233291_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464840_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464842_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464841_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464849_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464836_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979172_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979154_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979158_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979160_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979164_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF476029_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464843_PreS2_P-D      gagaggcctgtatcaccctgctggtggctccagttcaggaacagtaaacc
MH464848_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464834_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979170_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF979162_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF476028_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM519455_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KR139747_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT347090_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464831_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464832_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464837_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464839_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464845_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464847_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464853_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464854_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664922_PreS2_P-D      gagaggcctgtatttccctgctggtggctcaacttccggaacagtaaacc
DQ131123_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ131122_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724226_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724249_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724250_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ329356_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ329357_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
KF779289_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KF779222_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ464168_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaacaagtaaacc
JN604275_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KU668439_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
MF618343_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX470760_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KC012652_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JN664913_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664921_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF488704_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttaaggaacagtaaacc
JN604272_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
DQ464169_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY233296_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ464170_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY230116_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664909_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664917_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU668436_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU668435_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524350_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524349_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagcaaacc
JN664938_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524361_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664937_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664936_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664914_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU668442_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664910_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257181_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AM422939_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ315776_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664911_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170746_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU668433_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU668434_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU668437_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU668438_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU668445_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU668446_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF618339_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF618340_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF618341_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
V01460_PreS2_P-D        gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349214_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KJ843187_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KF779301_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagtacaggagcagtaaacc
KF779302_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagtacaggagcagtaaacc
KF779296_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779288_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779212_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779216_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779285_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779303_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779318_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779218_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KF779219_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779209_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779230_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KM606745_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779223_PreS2_P-D      gagagacctgtatttccctgctggtggctccagttcaggagcagtaaacc
JX898691_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JX898692_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JN604301_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
AJ131956_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KP090177_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KP090178_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
MH724218_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
MH724219_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KF779217_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KF779225_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JX898694_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
FJ349209_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN604313_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggggcagtaaacc
KX827292_PreS2_P-D      gagaggcctgtattatcctgctggtggctccagttcaggaacagtaaacc
KF779377_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779376_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KF779341_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KF779292_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779340_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779228_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggagcagtaaacc
KF779229_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggagcagtaaacc
KF779224_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JX898697_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JN604170_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JX898689_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JN604318_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JX090611_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ647355_PreS2_P-D      gagaggcctgtatcaacctgctggtggctccagttcaggaacagtaaacc
JX090622_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090680_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ647353_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK693109_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090664_PreS2_P-D      gagaggcctgaatttccctgctggtggctccagttcaggaacagtaaacc
EU939680_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN688685_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
U87851_PreS2_P-D        gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX090689_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ486025_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
X85254_PreS2_P-D        gaaaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
FJ349213_PreS2_P-D      gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
KM524356_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090658_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN370954_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU921418_PreS2_P-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
JN688710_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF679990_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090616_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU414142_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN507852_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MK618441_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MK618443_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MK598657_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598651_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598655_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090605_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090698_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090620_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090639_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090657_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779214_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU414141_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090691_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090709_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090710_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594382_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724245_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779382_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM108619_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
U87738_PreS2_P-D        gagaggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
EU594434_PreS2_P-D      gagaggcctgtattaccctgctggtggctccagttcaggaacagtaaacc
AY221115_PreS2_P-D      caggggtctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX276998_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090656_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090624_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183473_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EF103277_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP090179_PreS2_P-D      gagaggcctgtatttccgtgttggtggatccagttcaggaacagtaaacc
EU921419_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090670_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090607_PreS2_P-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
JX090608_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090612_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724232_PreS2_P-D      gacaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
LT992438_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU736927_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU736926_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090682_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN688679_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ236016_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
FJ562338_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KC875314_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875337_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196232_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196220_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcacgaacagtaaacc
KC875325_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875326_PreS2_P-D      gagaggcctgtatttccctgctggtggctccacttcaggaacagtaaacc
KX196222_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875318_PreS2_P-D      gagaggcctgtatttccctgctggtggctccacttcaggaacagtaaacc
KC875316_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875315_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875313_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196233_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196231_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196219_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtacacc
KX196218_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196216_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875336_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875334_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196221_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875333_PreS2_P-D      gagaggcctgtatttccctgctggtcgctccagttcaggaacagtaaacc
KC875332_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875320_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196217_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875317_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875335_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196230_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196234_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875319_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875321_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ236014_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ236015_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF815674_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774437_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagcaaacc
JN688712_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598658_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090671_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090613_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN688683_PreS2_P-D      gagrggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ922000_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EF103275_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN688722_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP202936_PreS2_P-D      gagaggcctgtattcccctgctggtggctccagttcaggaacagtaaacc
JN688713_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875329_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196235_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664920_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JX090659_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MH724237_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP090180_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF679992_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF679993_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366497_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366507_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875324_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090694_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN688708_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB493846_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB270539_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090672_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183478_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU414143_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875322_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875323_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196225_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196224_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090628_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF815673_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF815672_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF815665_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF815666_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF815670_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF815678_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF815679_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724242_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724224_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
MH724225_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
MH724227_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
MH724228_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
MH724229_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
MH724230_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
MH724248_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
KC875331_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875328_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090669_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN688678_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF815676_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HM750151_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349232_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724215_PreS2_P-D      aagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724220_PreS2_P-D      aagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774436_PreS2_P-D      gagagggctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774460_PreS2_P-D      gagagggctgtatttccctgctggtggctccagttcaggaacagtaaacc
LT992454_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
X65257_PreS2_P-D        gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK541688_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK507912_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF679989_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090673_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090667_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090662_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN370949_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN370950_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN370951_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN370952_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN370953_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090661_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090666_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090674_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ692506_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ692507_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724234_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724233_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875330_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ922002_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ922001_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP090181_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724214_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724221_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN604245_PreS2_P-D      gaaaggcctgtgtttccctgctggtggctccagttcaggaacagtaaacc
JN257153_PreS2_P-D      garaggcctgtattyccctgctggtggctccagttcaggaacagtaaacc
JN257195_PreS2_P-D      garaggcctgtattyccctgctggtggctccagttcaggaacagtaaacc
JN257214_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052949_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcagggacagtaaacc
MK052950_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052959_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052973_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052975_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052951_PreS2_P-D      gagaggcctgcatttccctgctggtggctccagttcaggaacagtaaacc
MK052974_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052948_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052963_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052971_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052966_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052955_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052956_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052958_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052960_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052952_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcagggacagtaaacc
MK052961_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagggacagtaaacc
MK052972_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagggacagtaaacc
MK052954_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcagggacagtaaacc
MK052947_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcagggacagtaaacc
MK052953_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcagggacagtaaacc
AB674420_PreS2_P-D      gagggacctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT749823_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754598_PreS2_P-D      gagagacctgtatcaacctgctggtggctccagttcagaaacagtgaacc
GU456678_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090697_PreS2_P-D      aagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257162_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170768_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY741798_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090637_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagtacaggaacagtaaacc
DQ464181_PreS2_P-D      gag------gcagttacctgctggtggctccagttcaggaacagtaaacc
JX310734_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX310733_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040804_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754611_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB674424_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754631_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX310735_PreS2_P-D      gagaggcctgtatttccctgctggtggcttcagttcaggaacagtaaacc
JX090610_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU787445_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU939681_PreS2_P-D      gagagacctgtatctccctgctggtggctccagttcaggaacagtaaacc
FJ899792_PreS2_P-D      gagagacctgtatctccctgctggtggctccagttcaggaacagtaaacc
JX090719_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090723_PreS2_P-D      gagagacctgtatttccctgctggtggctccagttcaggaatagtaaacc
EU787443_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090720_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090707_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MK598637_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598640_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598636_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598638_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598639_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598641_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090724_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaatagtaaacc
JX090722_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN507838_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN507853_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HM750155_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HM750156_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090644_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ833467_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU787437_PreS2_P-D      cagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU787438_PreS2_P-D      gagaggcctgactttccctgctggtggctccagttcaggaacagtaaacc
JX090629_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ833465_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU787447_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HM750154_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY629630_PreS2_P-D      cagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090705_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ833469_PreS2_P-D      cagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
HM750153_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagcaaacc
EU919197_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ833468_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagcaaacc
KC774462_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090708_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090703_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090646_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ833471_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090626_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090630_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090631_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090632_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090638_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090642_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090643_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090645_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090704_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU787440_PreS2_P-D      cagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU787442_PreS2_P-D      cagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX276999_PreS2_P-D      cagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ833470_PreS2_P-D      cagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642154_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642128_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040818_PreS2_P-D      gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
JF754617_PreS2_P-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
AB188244_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB330367_PreS2_P-D      aagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664919_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcgggaacagtgaacc
MK355501_PreS2_P-D      gagaggcctgtatttccctgttggtggctccagttcaggaacagtaaacc
JF754629_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ184322_PreS2_P-D      gagaggcctgaatctccctgctggtggctccagttcaggaacagtaaacc
GQ167301_PreS2_P-D      gagaggcctgaatctccctgctggtggctccagttcaggaacagtaaacc
GQ167302_PreS2_P-D      gagaggcctgaatctccctgctggtggctccagttcaggaacagtaaacc
JN642138_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagctcaggaacagtaaacc
JF754588_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456665_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ464182_PreS2_P-D      gagaggcctgtatctccctgctggtggcttcagttcaggaacagtaaacc
JN642133_PreS2_P-D      gaagggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN040782_PreS2_P-D      gagaggcctgaatttccctgctggtggctccagttcaggaacagtaaacc
JN040768_PreS2_P-D      gagaggcctttatttccctgctggtggctccagttcaggaacagtaaacc
JN642155_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagctcaggaacagtaaacc
JN642165_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagctcaggaacagtaaacc
MH724236_PreS2_P-D      aagaggcctgtatttccctgctggtggctccagttcagggacagtaaacc
JN040822_PreS2_P-D      gagagacctgtatttccctgttggtggctccagttcaggaacagtaaacc
JN040776_PreS2_P-D      gagaggcctgtctttccctgctggtggctccagttcaggaacagtaaacc
JN040769_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB270550_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183467_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183460_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183469_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183461_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183456_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183459_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183468_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183458_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183455_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183452_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183449_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183448_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183450_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183451_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183453_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183454_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183457_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183462_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183463_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183464_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183465_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183466_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257165_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257166_PreS2_P-D      gaggggcctgta---ccttgctggtggctccagttcaggaacagtaaacc
JN257160_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggracagtaaacc
JN040772_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040753_PreS2_P-D      gaaaggcctgtatatccctgctggtggctccagttcaggaacagtaaacc
JF754632_PreS2_P-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
JX090609_PreS2_P-D      gagagacctgtatttccctgctggtggctccagttcaggaacagtgaacc
JN257176_PreS2_P-D      gagaggcctgwmtttccctgctggtggctccagttcaggaacagtaaacc
JN257177_PreS2_P-D      gagaggcctgwmtttccctgctggtggctccagttcaggaacagtaaacc
AB674406_PreS2_P-D      gagaggcctgtattcccctgctggtggctccagttcaggaacagtaaacc
EF103276_PreS2_P-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MK618429_PreS2_P-D      gagaggcctttatttccctgctggtggctccagttcaggaacagtaaacc
MK618430_PreS2_P-D      gagaggcctttatttccctggtggtggctccagttcaggaacagtaaacc
MK618432_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK618433_PreS2_P-D      gagaggcctgtatttccctgctggtgggtccagttcaggaacagtaaacc
AB674419_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagggacagtaaacc
JX090634_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagtacaggaacagtaaacc
JN040766_PreS2_P-D      gaggggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
GU456657_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB674416_PreS2_P-D      gagaggcctgtatttacctgctggtggctccagttcaggaacagtaaacc
JF754630_PreS2_P-D      gagaggcttgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456643_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642126_PreS2_P-D      gagagacctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040820_PreS2_P-D      aagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
AB674431_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040775_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
GU456642_PreS2_P-D      gacaagcctatatctccctgctggtggctccagttcaggaatagtaaacc
L27106_PreS2_P-D        gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642150_PreS2_P-D      gagaggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
HQ700449_PreS2_P-D      gagrggcctgtatttycctgctggtggctccagttcaggaacaktaaacc
FJ349215_PreS2_P-D      gaaaggcctgaatctccctgctggtggctccagttcaggaacaggaaacc
JF754599_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JF754623_PreS2_P-D      gagaggcctgaatctccctgctggtggctccagttcaggaacagtaaacc
GU456645_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
X80924_PreS2_P-D        gagaggcctgtatttccctgctggtggctccagttcaggaacagtcaacc
X80926_PreS2_P-D        gagaggcctgtatttccctgctggtggctccagttcaggaacagtcaacc
KM108595_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642164_PreS2_P-D      aagtgaccaatatttccctgctggtggctccagttcaggaacagtaaacc
KF471644_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040779_PreS2_P-D      gacaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456639_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB555500_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090678_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX036331_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN604239_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagraacagtaaacc
JN257186_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN040790_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN040755_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
M32138_PreS2_P-D        gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
GU456682_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456674_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524348_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacattaaacc
AB674425_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagcaaacc
GU456676_PreS2_P-D      gagaggcct------ccctgctggtggctccagttcaggaacagtaaacc
JN642135_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ562309_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaaac
AB674411_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB270541_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KU668441_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU668444_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456675_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456651_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090721_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
GU456684_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456635_PreS2_P-D      gaaaagcctttatcttcctgctggtggctccagttcaggaacagtaaccc
AB674428_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MK355500_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK693107_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040788_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040786_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040787_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaatagtaaacc
KF471642_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170775_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090635_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagtacaggaacagtaaacc
JN642149_PreS2_P-D      gaaaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN642142_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642134_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
JN642132_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
JN040773_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456649_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904429_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN792905_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
JN257148_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700472_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB674423_PreS2_P-D      gaaaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KT201292_PreS2_P-D      gagaggcctgtctttccctgctggtggctccagttcaggaacagtaaacc
JF754606_PreS2_P-D      gagaggcct------ccctgctggtggctccagttcaggaacagtaaacc
JN642166_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM108596_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642147_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ477458_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904426_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090640_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
JN642131_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtagacc
JN257159_PreS2_P-D      gagaggcctgtattcccctgctggtggctccagttcaggaacagtaaacc
JN040830_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB555501_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB555497_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754635_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF754626_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040800_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040801_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
MF925391_PreS2_P-D      gagcggcctgaatttccctgctggtggctccagttcaggaacagtaaacc
KF170772_PreS2_P-D      aagaggcctgaatttccctgctggtggctccagttcaggaacagtaaacc
JN642158_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257211_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257150_PreS2_P-D      gagmggcctgwatttccctgctggtggctccagttcaggaacagtaaacc
JN040757_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040750_PreS2_P-D      gaaaggcctgtatctccatgctggtggctccagttcagaaacagtaaacc
FJ904427_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349219_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AJ344116_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN792912_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
JN257172_PreS2_P-D      gaaaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN040809_PreS2_P-D      gagaggcctgcatttccctgctggtggctccagttcaggaacagtaaacc
JN040784_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754600_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456679_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
GU456672_PreS2_P-D      gagaggcctgcatttccctgctggtggctccagttcaggaacagtaaacc
GU456667_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ991752_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB555496_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040751_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
HQ700481_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
HQ700463_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
EF103280_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK507913_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF061170_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700444_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700480_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
HQ700477_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700474_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700478_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700553_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366499_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB786644_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
AB246347_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366498_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366500_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366501_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366502_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700473_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700483_PreS2_P-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
HQ700468_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700448_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700445_PreS2_P-D      gagaggcctgtatttccctgctggtggctccaattcaggaacagtaaacc
HQ700446_PreS2_P-D      gagaggcctgtatttccctgctggtggctccaattcaggaacagtaaacc
HQ700487_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700455_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700454_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700440_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700441_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700442_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700443_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700447_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700450_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700451_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700459_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700464_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700466_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700469_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700470_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700471_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700479_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700482_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700484_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700488_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700453_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP995100_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KM524338_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF061169_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
JX036334_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642136_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY629633_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090665_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN688695_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040814_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040762_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagcaaacc
FJ904415_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904420_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904421_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EF103281_PreS2_P-D      ggaaggcctgtatttccctgctgggggctccagttccggaacagtaaacc
DQ304548_PreS2_P-D      gagaggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
DQ304547_PreS2_P-D      gagaggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
DQ304550_PreS2_P-D      gagaggcctgtatcttcctgctggtggctccagttcaagaacagtaaacc
DQ304551_PreS2_P-D      gagaggcctgtatcttcctgctggtggctccagttcaagaacagtaaacc
AY236162_PreS2_P-D      gagaggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
DQ304549_PreS2_P-D      gagaggcctgtatcttcctgctggtggctccagttaaggaacagtaaacc
KT201241_PreS2_P-D      garaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
JN642129_PreS2_P-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
GU456658_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456654_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgagcc
X97848_PreS2_P-D        gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664931_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642140_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN604312_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904446_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY721611_PreS2_P-D      gagaagcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK693108_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX276975_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KF170770_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090660_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642156_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN257200_PreS2_P-D      gagaggcctgtattcccctgctggtggctccagttcaggaacagtaaacc
JN257188_PreS2_P-D      gagaggcctgaatttccctgctggtggctccagttcaggaacagtaaacc
JN257183_PreS2_P-D      gagaggcctgtatytccctgctggtggctccagttcaggaacagtaaacc
JN257163_PreS2_P-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
JN040812_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040793_PreS2_P-D      gagagacctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040774_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754610_PreS2_P-D      gagaggcctgcatcacactgctggtggctccagttcaggaacagtaaacc
GU456677_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456637_PreS2_P-D      gggaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU357846_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904422_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904402_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagraacagcaaacc
DQ111986_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY945307_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY373431_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB674403_PreS2_P-D      gaaaggcctgaatttccctgctggtggctccagttcaggaacagtaaacc
AB126581_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF471657_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcagggacagtaaacc
KF471655_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF471650_PreS2_P-D      gaaaggcttgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040810_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040802_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754619_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456671_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456636_PreS2_P-D      gagagacctgtatctccctgctggtggctccagttcaggaacagtaaacc
KF471659_PreS2_P-D      gagaggcctgtttttccctgctggtggctccagttcaggaacagtaaacc
JX090676_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacactaaacc
JX090641_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
JX036333_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642157_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
JF754614_PreS2_P-D      garaggcctgtattcccctgctggtggctccagttcaggaacagtaaacc
FJ349235_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB104711_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF471645_PreS2_P-D      gagaggcctgtatttacctgctggtggctccagttcaggaacagtaaacc
JN040819_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754634_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EF103279_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY161153_PreS2_P-D      gagaggcccgaatttccctgctggtggctccagttcaggaacagtaaacc
AY161155_PreS2_P-D      gagaggcccgaatttccctgctggtggctccagttcaggaacagtaaacc
AY161154_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY161156_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY161151_PreS2_P-D      gagaggcctgaatttccctgctggtggctccagttcaggaacagtaaacc
AY161150_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY161152_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM108602_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM108603_PreS2_P-D      gagaggcctgtattcccctgctggtggctccagttcaggaacagtaaacc
KF471640_PreS2_P-D      gaaagacctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK618431_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK618437_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754605_PreS2_P-D      gagaggc---------cctgctggtggctccagttcaggaacagtaaacc
JN642145_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456650_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB674427_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB270547_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT201240_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtagacc
LT992439_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT963508_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170756_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX096955_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090668_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN792906_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
JN642161_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN604189_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040821_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040817_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040811_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040759_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF754592_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754590_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456669_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456653_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
FJ349234_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY741797_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AF151735_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB674408_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtraacc
AB674404_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB270546_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875299_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196208_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875293_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875294_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875306_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875308_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875305_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196228_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196211_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875288_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875296_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875309_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196209_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875290_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196212_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB222710_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642153_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040824_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
JN040808_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754633_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456673_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456666_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754612_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754609_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtcaacc
JF754603_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB246348_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB104710_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM108600_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaagc
KM108601_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaagc
AB786653_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
JX090647_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090621_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456659_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456652_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257203_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257202_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456661_PreS2_P-D      gagaggcctatttttccctgctggtggctccagttcaggaacagtaaacc
FJ904431_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904418_PreS2_P-D      gagcgacctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB270548_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF471656_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaccagtaaacc
JN257201_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040823_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040777_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN792911_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
JN792908_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
JN792907_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
JN792903_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
JN792909_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
JN792910_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
JN792904_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
KT201234_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagcaaacc
KX827300_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF471654_PreS2_P-D      gagaggcctgtattcccctgctggtggctccagttcaggaacagtaaacc
KF471647_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170757_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170755_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF061167_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtagacc
JX090716_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090695_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090681_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090636_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagtacaggaacagtaaacc
JN257170_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257152_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257149_PreS2_P-D      garaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040827_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacattaaacc
JN040826_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040815_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN040806_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040795_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN040771_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaatagtaaacc
GU456683_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456681_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456680_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ205380_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524342_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183480_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904445_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349231_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB330370_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK618427_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KX827291_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF471660_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040799_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040758_PreS2_P-D      gggaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754593_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456638_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754602_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456668_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875304_PreS2_P-D      gagaggcctgtatttccctgctggtggctccacttcaggaacagtaaacc
KC875303_PreS2_P-D      gagaggcctgtatttccctgctggtggctccacttcaggaacagtaaacc
KC875302_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875285_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875281_PreS2_P-D      gagagccctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875280_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875275_PreS2_P-D      gagaggcctgtatttccctgctgctggctccagttcaggaacagtcaacc
KX196226_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196213_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196210_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875291_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875284_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875278_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875300_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875298_PreS2_P-D      gagaggcctgtat---cctgctggtggctccagttcaggaacagtaaacc
MK618435_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
MK618434_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
MK618436_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JX090655_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX090649_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX090650_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX090651_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX090652_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX090653_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX090654_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
MK598647_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456655_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgagcc
AB222712_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456647_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875276_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196214_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598650_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598649_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagcaacagtaaacc
MK598646_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598645_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagaaacagtaaacc
MK598644_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF584160_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF471649_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF471646_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF471641_PreS2_P-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170776_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KF170773_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF061168_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtagacc
KC875301_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875289_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090706_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642151_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642146_PreS2_P-D      gagagccctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN604259_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257199_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040813_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040805_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040794_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
JN040791_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040781_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040767_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040765_PreS2_P-D      gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
JN040761_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754601_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456670_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
GU456664_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456646_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754607_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456641_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904424_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349233_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU787441_PreS2_P-D      gagaggcttgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594396_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AF214660_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AF121239_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB674429_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB674407_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
AB270542_PreS2_P-D      gagaggcctgtattcccctgctggtggctccagttcaggaacagtaaacc
AB104709_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598642_PreS2_P-D      gagaggcctctatttccctgctggtggctccagttcaggaacagtaaacc
JF754594_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
AF280817_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY721608_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY382412_PreS2_P-D      gagaggcctgtatttccctgctggyggctccagttcaggaacagtaaacc
GQ477459_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF584161_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF584163_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF584164_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF584165_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF584166_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY382414_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF584162_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY741794_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY741795_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY741796_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170771_PreS2_P-D      gagaggcctgtattcccttgctggtggctccagttcaggaacagtaaacc
FJ904432_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB674405_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090633_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagtacaggaacagtaaacc
GU456656_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875277_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196215_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY161157_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY161158_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK618428_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN507851_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN507836_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY721610_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598648_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598643_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724252_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366508_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM606753_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM108605_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875297_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196236_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875292_PreS2_P-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KC875287_PreS2_P-D      gagaggcctgtatttccctgctggtggctccacttcaggaacagtaaacc
KC875282_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875279_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774477_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774459_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774445_PreS2_P-D      gagaggcttgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774444_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774440_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ687531_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642130_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagggacagtaaacc
JN604265_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257205_PreS2_P-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN257182_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257151_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040829_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040828_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040797_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040796_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040778_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040770_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754627_PreS2_P-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
JF754624_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754615_PreS2_P-D      gggaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754608_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754595_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700511_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456663_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456640_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ386590_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349228_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349217_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349216_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU414136_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU414135_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ991754_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY721612_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY721609_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY721607_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY721606_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY721605_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY661792_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY661793_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY161159_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY161160_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AF121242_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB674422_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB222713_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB222709_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB104712_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090684_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040783_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090687_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349229_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtcaacc
MK517524_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK507910_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
LC365689_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcagggacagtaaacc
KY629634_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170766_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX090627_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642167_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN604278_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN604263_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtagacc
JN604206_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040792_PreS2_P-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HM750152_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349230_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU787446_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB270543_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB222711_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB583680_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594397_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU787436_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183470_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ377589_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257179_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257185_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK507911_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK507914_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524339_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170765_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257196_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257169_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF754618_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754591_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ315778_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257155_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AJ627224_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170758_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170759_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM108591_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM108606_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM108607_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904412_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456660_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK517521_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF471658_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170764_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257209_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257171_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904443_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ349220_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754604_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754628_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170747_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP322600_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK517520_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875295_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX196227_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
Y07587_PreS2_P-D        gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
X02496_PreS2_P-D        gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040807_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY796030_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU456648_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754596_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF471651_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF471652_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AF121240_PreS2_C-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AF121241_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257193_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK517522_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK517523_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875286_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC875283_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY796032_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904399_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN040785_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP322599_PreS2_P-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
                                          *  **                          *

EU155895_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX310727_PreS2_P-D      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggattggg
KF170769_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatctcctcgaggattggg
EU414140_PreS2_P-D      ctgttccgactactgcctctcycatatcgtcaatcttctcgaggattggg
X65258_PreS2_P-D        ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF925366_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU155893_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN604152_PreS2_P-D      ctgttccgactactgcctctccaatattgtcaatcttctcgaagattggg
JQ707689_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707683_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707697_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707699_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707702_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707706_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707703_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707693_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707682_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707684_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707685_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707686_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707687_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707688_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707691_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707692_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707694_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707695_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707696_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707698_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707700_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707701_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707704_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707705_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JQ707690_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JX090648_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ477454_PreS2_P-D      ctgttccgactactgcctctcgcatatcgtcaatcttctcgaggattggg
JX090690_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcacacttcgagaggactggg
KF170760_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN604139_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT366494_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
DQ399006_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MF925390_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcgatcttctcgaggattggg
KX276856_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN642163_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT151620_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664941_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KF053178_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN604120_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT366465_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
AB119255_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN642144_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX276857_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AY090453_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KU668449_PreS2_P-D      ctgttccgaccactgcctctcccatatcgtcaatcttctcgaggattggg
KT366511_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN664927_PreS2_P-D      ctgttccgaccactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707511_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT366510_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MF925379_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707491_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN664928_PreS2_P-D      ctgttccgacttctgcctctcccatatcgtcaatcttctcgaggattggg
KM524346_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM524351_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598663_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JQ707529_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707519_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707517_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707516_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707513_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707512_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707514_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707515_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707518_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707520_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707521_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707522_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707523_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707526_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707528_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707530_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707524_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707525_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB119256_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH932714_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT366493_PreS2_P-D      ctgttccgacttctgcctctcccatatcgtcaatcttctcgaggattggg
KM524344_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ183471_PreS2_P-D      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggg
JQ707505_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707499_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707494_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707490_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707487_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707485_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707484_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707481_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707479_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707476_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707478_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707482_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707489_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707496_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707500_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707502_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707507_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707508_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707480_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707488_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707503_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM524347_PreS2_P-D      ctgttccgacttctgcctctcccatatcgtcaatcttctcgaggattggg
JN664918_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MF618349_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KF679998_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ183481_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KF679997_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707506_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ183479_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ183477_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ183476_PreS2_P-D      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggg
KP165604_PreS2_P-D      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggg
GQ183472_PreS2_P-D      ctgttccgactactgcctcgcccatatcgtccatcttctcgaggattggg
AB119254_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM524341_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707483_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707486_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707527_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MF925363_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT366496_PreS2_P-D      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggg
KT366491_PreS2_P-D      ctgttccgaccactgcctctcccatatcgtcaatcttctcgaggattggg
KC875311_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC875310_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707504_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707493_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ924652_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB119252_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB109479_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB090268_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB120308_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ183474_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM524352_PreS2_P-D      ctgttccgaccactgcctctcccatatcgtcaatcttctcgaggattggg
KM524353_PreS2_P-D      ctgttccgaccactgcctctcccatatcgtcaatcttctcgaggattggg
KF679994_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KF679996_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707498_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707509_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB090269_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB116266_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ183482_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ183483_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP184499_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP202937_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP202938_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP202939_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP202940_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP202943_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT962021_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT962023_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT962024_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MF925364_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707510_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707501_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707497_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707492_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707477_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ707495_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN664930_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MF925383_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MF925393_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ183475_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB109478_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB109475_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB109476_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB109477_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB110075_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB119251_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB119253_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB205126_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB210821_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB210822_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB267090_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB471856_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB471857_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC875312_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM524354_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM524355_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KR905424_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT366495_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT366506_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT366509_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MF925358_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB078031_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB078033_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB078032_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KJ647352_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090714_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KJ647350_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ477453_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN604175_PreS2_P-D      ctgttccgactactgcatctcccatatcgtcaatcttctcgaggattggg
JX090614_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB188242_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598672_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK618423_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK618424_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK618425_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090712_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH724216_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatctcctcgaggattggg
GQ477452_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggg
MK598665_PreS2_P-D      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggg
MK598664_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcagtcttctcgaggattggg
GQ477456_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK618422_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594416_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594417_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594409_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
EU594401_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX096958_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP184497_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP202941_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP202942_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP202944_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT962022_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594402_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594429_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594431_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594432_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP184495_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP184496_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP184498_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB090270_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JF815668_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090715_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598667_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH724247_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH724241_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN642143_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AF043594_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KF779220_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598679_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598678_PreS2_P-D      ctgttccgactactgcctctcccataacgtcaatcttctcgaggattggg
MK598677_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598676_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598675_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598671_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK618421_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK618426_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598669_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP230541_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT962025_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594408_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP165599_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
Z35716_PreS2_P-D        ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH724217_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MH724223_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN507837_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090717_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090675_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090711_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594419_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594420_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594423_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594428_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP143745_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP165598_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP165601_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP165602_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP202945_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594422_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU159677_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX096956_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP143744_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK618420_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598673_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598666_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH724238_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH724231_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX827290_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU594421_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594415_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594410_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggg
EU594407_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594427_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594400_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594403_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594413_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594414_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594424_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP165605_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX827301_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH724244_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH724246_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK618418_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK618419_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN507839_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594405_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KF170761_PreS2_P-D      ctgttccgactactgcctcttccatatcgtcaatcttctcgaggattggg
JX090677_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AJ627215_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AJ627216_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AJ627218_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM108592_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AY090452_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN604238_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggg
KT749827_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KF170744_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598661_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JX090700_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AY796031_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX310728_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ477455_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090701_PreS2_P-D      ctgttccgaccactgcctctcccatatcgtcaatcttctcgaggattggg
JN642148_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN257190_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF754597_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM577671_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB205128_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX310729_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ687530_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM577670_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN604161_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB188241_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM577669_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM577668_PreS2_P-D      ctgttccgaccactgcctcttccatatcgtcaatcttctcgaggattggg
JX090693_PreS2_P-D      ctgttcccactactggctctcccatatcgtcaatcttctcgaggaatggg
JF754621_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ349218_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090606_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatctcctcgaggattggg
GQ183485_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090683_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090625_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AJ627222_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcracctccgcgaggattggg
KU736924_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KU736925_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
X72702_PreS2_P-D        ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM108593_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090692_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090685_PreS2_P-D      ctgttccgactactgcctctccaatatcgtcaatcttctcgaggattggg
EU594425_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB210820_PreS2_P-D      ctgttccgactactgcctctccaatatcgtcaatcttctcgaggattggg
JX090663_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598674_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX357637_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ183484_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK516278_PreS2_P-D      ttgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN664939_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
JX090688_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090619_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598670_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
X97849_PreS2_P-D        ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598660_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK517518_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX357639_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX357638_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT749828_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT749821_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttcgcgaggattggg
JX090686_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN642159_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ349206_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttcgcgaggattggg
EU594398_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU414138_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AJ627223_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB330369_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB205127_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090718_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AJ627220_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KF679995_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KR905423_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU414139_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ477457_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ349205_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN604295_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ349208_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598662_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598659_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090699_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090679_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090617_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700510_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594399_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090696_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594426_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK598668_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP322601_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090713_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700513_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700514_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090702_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX096954_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP165600_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP165603_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594433_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594418_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594404_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594430_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700512_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090618_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX096957_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KF170749_PreS2_P-D      ctgttccgactactgtatctcacatatcgtcaatcttctcgaggactggg
GQ922004_PreS2_P-D      ctgttccgactactgcctctcacacatcgttaatcttctcgaggattggg
KM108608_PreS2_P-D      ctgttccgactactgcctctcacatattgtcaatcttctcgaggattggg
KM108609_PreS2_P-D      ctgttccgactattgcctctcacatatcgtcaatcttctcgaggattggg
AB048701_PreS2_P-D      ctgttccgactactgcctctcccacattgtcaacctcctcgaggattggg
JN604196_PreS2_P-D      ctgttccgactactgcctctcacatattgtcaatcttctcgaggattggg
FJ904395_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ904419_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700458_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ922005_PreS2_P-D      ctgttccgactactgcctctcacacatcgtcaatcttctcgaggattggg
KM524358_PreS2_P-D      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggg
MF618348_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KJ470896_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KJ470889_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KJ470895_PreS2_P-D      ctgttccgactactgtctctcacttatcgtcaatcttctcgaggattggg
JN664912_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MH724251_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF192834_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF192830_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF192831_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF192832_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX310726_PreS2_P-D      ctgttccgattactgcctctcccatatcgtcaatcttctcgaggattggg
KX357622_PreS2_P-D      ctgttccgactactgcatctcacatatcgtcaatcttctcgaggattggg
KM108621_PreS2_P-D      ctgttccgactactgcctctcacatattgtcaatcttctcgaggattggg
JN604207_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KF170774_PreS2_P-D      ctgttccgactactgcctctcacacatcgtcaatcttctcgaggattggg
KJ470893_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KJ470885_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KM606755_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggactggg
KJ470894_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KM108594_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggg
KP168419_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB786650_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ927384_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN604174_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GQ922003_PreS2_P-D      ctgttccgactactgcctctcacacatcgtcaatcttctcgaggattggg
FJ904438_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AF214659_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaattttctcgaggattggg
KF170778_PreS2_P-D      ctgttccgactactgcctctcacatattgtcaatcttctcgaggattggg
KM108620_PreS2_P-D      ctgttccgactactgcctctctcatatcgtcaatcttctcgaggattggg
KM606754_PreS2_P-D      ctgttccgactactgcctgtcacatatcgtcaatcttctcgaggattggg
KM606744_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KM606752_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
AF214661_PreS2_P-D      ctgttccgactactgcctctcacatattgtcaatcttctcgaggattggg
FJ904410_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM108598_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttatcgaggattggg
KM108597_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttatcgaggattggg
KM108604_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttatcgaggattggg
KM108599_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttatcgaggattggg
KF922432_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
AJ627219_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
FJ692532_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
FJ692533_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KF170767_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
FJ904439_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ904433_PreS2_C-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
LT992444_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
FJ904435_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KF170763_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
JN688711_PreS2_P-D      ctgttcccactacagcgtctcccttatcgtcgatcgtctcgaggattgtg
JN664947_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
JN604250_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF476030_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX090623_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090615_PreS2_P-D      ctgttcagactactgcctctccctcatcgtcaaccttcttgaggattggg
MF979166_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979155_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979165_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KM212957_PreS2_P-D      ctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggg
KP143742_PreS2_P-D      ctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggg
KP143743_PreS2_P-D      ctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggg
KP165597_PreS2_P-D      ctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggg
JF439719_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439713_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439717_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439694_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF439715_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF439712_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF439707_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF439702_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF439693_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF439695_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF439716_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF439692_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439699_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439718_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439710_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggatcggg
JF439708_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439706_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439711_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439700_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439701_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439704_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439705_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439709_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439696_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439703_PreS2_P-D      ctgttccgactgctgcctctcccttatcgtcaatcttctcgaggattggg
KM524340_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
JN664932_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
JN664926_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
KC875340_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
JN664924_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
KM524345_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
KX196229_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
KC875342_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
GQ205385_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
KU668447_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
GQ205389_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
GQ205388_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
MF618342_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
KU668448_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
GQ205382_PreS2_P-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
GQ205384_PreS2_P-D      ctgttccgactcctgcctctcccatattgtcaatcttctcgaagattggg
DQ336691_PreS2_P-D      ctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggg
DQ336689_PreS2_P-D      ctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggg
DQ486021_PreS2_P-D      ctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggg
DQ336686_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ336687_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ336688_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ336692_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
AY236160_PreS2_P-D      ctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggg
DQ336690_PreS2_P-D      ctgttccgactactgcctctcctttatcgtcaatcttctcgaggatgggg
DQ464176_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ464177_PreS2_P-D      ctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggg
AY236164_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ486022_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ336685_PreS2_P-D      ctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggg
DQ464175_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ464178_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ464174_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ464173_PreS2_P-D      ctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggg
DQ464172_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ336678_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ336674_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ336675_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ336679_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ336676_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ336677_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979168_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979173_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979174_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MF979171_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979157_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979163_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
U87737_PreS2_P-D        ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH724235_PreS2_P-D      ctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggg
KR139748_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464838_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979167_PreS2_P-D      ctgttccgactactgcctctccctcatcgtcaatcttctcgaggattggg
MF979156_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979161_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979175_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979176_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
AY233294_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464844_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464833_PreS2_P-D      atgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
AY233292_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
AY233291_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464840_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH464842_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH464841_PreS2_P-D      ctgttccgactactgcctctcccwtatcgtcaatcttctcgaggattggg
MH464849_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464836_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979172_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979154_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcgatcttctcgaggattggg
MF979158_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcgatcttctcgaggattggg
MF979160_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcgatcttctcgaggattggg
MF979164_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcgatcttctcgaggattggg
KF476029_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464843_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464848_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464834_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979170_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF979162_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF476028_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KM519455_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KR139747_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KT347090_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464831_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464832_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464837_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464839_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464845_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464847_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464853_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464854_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664922_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
DQ131123_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ131122_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH724226_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH724249_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH724250_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ329356_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ329357_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779289_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779222_PreS2_P-D      ctgttccgactactgcctctctcttatcgtcaatcttctcgaggattggg
DQ464168_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN604275_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KU668439_PreS2_P-D      ctgttctgactactgcctctcccttattgtcaatcttctcgaagattggg
MF618343_PreS2_P-D      ctgttctgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX470760_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KC012652_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664913_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664921_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF488704_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN604272_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ464169_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
AY233296_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ464170_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
AY230116_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664909_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664917_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
KU668436_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
KU668435_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
KM524350_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
KM524349_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664938_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
KM524361_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664937_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664936_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664914_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
KU668442_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664910_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN257181_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
AM422939_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ315776_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664911_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF170746_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
KU668433_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
KU668434_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
KU668437_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
KU668438_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
KU668445_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
KU668446_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF618339_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF618340_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF618341_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
V01460_PreS2_P-D        ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
FJ349214_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KJ843187_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779301_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779302_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779296_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779288_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779212_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779216_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779285_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779303_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779318_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779218_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779219_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779209_PreS2_P-D      ctgttccgactactgcctctctcttatcgtcaatcttctcgaggattggg
KF779230_PreS2_P-D      ctgttccgactactgcctctctcttatcgtcaatcttctcgaggattggg
KM606745_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779223_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX898691_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX898692_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN604301_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
AJ131956_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KP090177_PreS2_P-D      ctgttccgattactgcctctcccttatcgtcaatcttctcgaggattggg
KP090178_PreS2_P-D      ctgttccgattactgcctctcccttatcgtcaatcttctcgaggattggg
MH724218_PreS2_P-D      ctgttccgattactgcctctcccttatcgtcaatcttctcgaggattggg
MH724219_PreS2_P-D      ctgttccgattactgcctctcccttatcgtcaatcttctcgaggattggg
KF779217_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779225_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX898694_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
FJ349209_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN604313_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KX827292_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779377_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779376_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779341_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779292_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779340_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779228_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779229_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779224_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX898697_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN604170_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX898689_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN604318_PreS2_P-D      ctgttccgactactgcctctcacttatcatcaatcttctcgaggattggg
JX090611_PreS2_P-D      ctgttccgactactgcctctcatttatcgtcaatcttctcgaggattggg
KJ647355_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090622_PreS2_P-D      ctgttccgactactgcctctcctctatcgtcaatcttctcgaggattggg
JX090680_PreS2_P-D      ctgttccgactactgcctcgcacacatcgtcaatcttctcgaggattggg
KJ647353_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MK693109_PreS2_P-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX090664_PreS2_P-D      ctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggg
EU939680_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
JN688685_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggactggg
U87851_PreS2_P-D        ctgctccgaatattgcctctcacatctcgtcaatcttccgcaggattggg
JX090689_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
DQ486025_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
X85254_PreS2_P-D        ctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggg
FJ349213_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KM524356_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX090658_PreS2_P-D      ctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggg
JN370954_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
EU921418_PreS2_P-D      ctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggg
JN688710_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF679990_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggactggg
JX090616_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
EU414142_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MN507852_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK618441_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK618443_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK598657_PreS2_P-D      ctgttcccactactgcctctcacatatcgtcaatcttctccaggattggg
MK598651_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
MK598655_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
JX090605_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090698_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090620_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090639_PreS2_P-D      ctgttccgaccactgcctctcacttatcgtcaatcttctcgaggattggg
JX090657_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggaatggg
KF779214_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
EU414141_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090691_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090709_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090710_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
EU594382_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggactggg
MH724245_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF779382_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KM108619_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
U87738_PreS2_P-D        ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
EU594434_PreS2_P-D      ctgttccgaccactgcctctcacttatcgtcaatcttctcgaggattggg
AY221115_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KX276998_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090656_PreS2_P-D      ctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggg
JX090624_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
GQ183473_PreS2_P-D      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggg
EF103277_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KP090179_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
EU921419_PreS2_P-D      ctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggg
JX090670_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090607_PreS2_P-D      ctgttccgaatactgcctctcacttatcgtcaatcttctcgaggattggg
JX090608_PreS2_P-D      ctgttccgaatactgcctctcacttatcgtcaatcttctcgaggattggg
JX090612_PreS2_P-D      ctgttccgaatactgcctctcacttatcgtcaatcttctcgaggattggg
MH724232_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
LT992438_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KU736927_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KU736926_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090682_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JN688679_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
HQ236016_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
FJ562338_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KC875314_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875337_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196232_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196220_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875325_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875326_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196222_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875318_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875316_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875315_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875313_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196233_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196231_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196219_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196218_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196216_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875336_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875334_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196221_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875333_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875332_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875320_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196217_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875317_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875335_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196230_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196234_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875319_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875321_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
HQ236014_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
HQ236015_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF815674_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KC774437_PreS2_P-D      ctgttccgactactgcctctcacgtatcgtcaatcttctcgaggattggg
JN688712_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK598658_PreS2_P-D      ctgttccgaccactgcctcgcacttatcgtcaatcttctcgaggattggg
JX090671_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
JX090613_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
JN688683_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
GQ922000_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
EF103275_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JN688722_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KP202936_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JN688713_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KC875329_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196235_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
JN664920_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090659_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
MH724237_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KP090180_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KF679992_PreS2_P-D      ctgttccgactactgcctatcacttatcgtcaatcttctcgaggattggg
KF679993_PreS2_P-D      ctgttccgactactgcctatcacttatcgtcaatcttctcgaggattggg
KT366497_PreS2_P-D      ctgttccgactactgcctatcacttatcgtcaatcttctcgaggattggg
KT366507_PreS2_P-D      ctgttccgactactgcctatcacttatcgtcaatcttctcgaggattggg
KC875324_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
JX090694_PreS2_P-D      ctgttccgaccactgcctctcccatatcgtcaatcttctcgaggattggg
JN688708_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
AB493846_PreS2_P-D      ctgttccgaccactgcctctcccttatcgtcaatctactcgaggattggg
AB270539_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090672_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
GQ183478_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
EU414143_PreS2_P-D      ctgttccgactactgcctcgcacttatcgtcaatcttctcgaggattggg
KC875322_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KC875323_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196225_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
KX196224_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
JX090628_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JF815673_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF815672_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF815665_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF815666_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF815670_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF815678_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF815679_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH724242_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH724224_PreS2_P-D      ctgttccgactactgcctctcccttatcatcaatcttctcgaggattggg
MH724225_PreS2_P-D      ctgttccgactactgcctctcccttatcatcaatcttctcgaggattggg
MH724227_PreS2_P-D      ctgttccgactactgcctctcccttatcatcaatcttctcgaggattggg
MH724228_PreS2_P-D      ctgttccgactactgcctctcccttatcatcaatcttctcgaggattggg
MH724229_PreS2_P-D      ctgttccgactactgcctctcccttatcatcaatcttctcgaggattggg
MH724230_PreS2_P-D      ctgttccgactactgcctctcccttatcatcaatcttctcgaggattggg
MH724248_PreS2_P-D      ctgttccgactactgcctctcccttatcatcaatcttctcgaggattggg
KC875331_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatctgctcgaggactggg
KC875328_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
JX090669_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JN688678_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF815676_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
HM750151_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
FJ349232_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MH724215_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MH724220_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KC774436_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KC774460_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
LT992454_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
X65257_PreS2_P-D        ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK541688_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
MK507912_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF679989_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
JX090673_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090667_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090662_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JN370949_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JN370950_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JN370951_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JN370952_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JN370953_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090661_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090666_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JX090674_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
FJ692506_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
FJ692507_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH724234_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH724233_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KC875330_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
GQ922002_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
GQ922001_PreS2_P-D      ctgtttcgactactgcctctcccttatcgtcaatcttctcgaggattggg
KP090181_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH724214_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH724221_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN604245_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaagattggg
JN257153_PreS2_P-D      ctgttccgactactgyctctcacatatygtcaatcttctcgargaytggg
JN257195_PreS2_P-D      ctgttccgactactgyctctcacatatygtcaatcttctcgargaytggg
JN257214_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK052949_PreS2_P-D      ctgttccgactactgcctctcatttatcgtcaatcttctcgaggattggg
MK052950_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052959_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052973_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052975_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052951_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052974_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052948_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052963_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052971_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052966_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052955_PreS2_P-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MK052956_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052958_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052960_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052952_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052961_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052972_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052954_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052947_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052953_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
AB674420_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KT749823_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754598_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GU456678_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggg
JX090697_PreS2_P-D      ctgttccgaccactgcctctcacatatcgtcaatcttctcgaggattggg
JN257162_PreS2_P-D      ctgttccgaccactgtctctcccatatcgtcaatcttctcgaggattggg
KF170768_PreS2_P-D      ctgttccgactactgtctcacacatatcgtcagccttctcgaggattggg
AY741798_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090637_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
DQ464181_PreS2_P-D      ctgttccgactactgtctctccaatatcgtcaatcttctcgaggattggg
JX310734_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX310733_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040804_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttcgcgaggattggg
JF754611_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB674424_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JF754631_PreS2_P-D      ctgttccgactactgtctctcccatattgtcaatcttctcgaggattggg
JX310735_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090610_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
EU787445_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
EU939681_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
FJ899792_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090719_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090723_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
EU787443_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090720_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090707_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK598637_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK598640_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK598636_PreS2_P-D      ctgttccgagtactgtctctcccatatcgtcaatcttctcgaggattggg
MK598638_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK598639_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK598641_PreS2_P-D      ctgttccgactactgtgtctcccatatcgtcaatcttctcgaggattggg
JX090724_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090722_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN507838_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN507853_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
HM750155_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
HM750156_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090644_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
HQ833467_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
EU787437_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
EU787438_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090629_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
HQ833465_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
EU787447_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
HM750154_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KY629630_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090705_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
HQ833469_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
HM750153_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
EU919197_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
HQ833468_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC774462_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggg
JX090708_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090703_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090646_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
HQ833471_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090626_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090630_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090631_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090632_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090638_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090642_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090643_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090645_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090704_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
EU787440_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
EU787442_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KX276999_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
HQ833470_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN642154_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaaactcctcgacgactggg
JN642128_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040818_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JF754617_PreS2_P-D      ctgttccgactactgtctctcacgcatcgtcaatcttatcgaggattggg
AB188244_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB330367_PreS2_P-D      ctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggg
JN664919_PreS2_P-D      ctgttccgaccactgcctctcccatatcgtcaatcttctcgaggattggg
MK355501_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatctcctcgaggactggg
JF754629_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ184322_PreS2_P-D      ctgttccgactactgtccctcccatatcgtcaatcttctcgaggattggg
GQ167301_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GQ167302_PreS2_P-D      ctgttccgactactgtctctcccacatcgtcaatcttctcgaggattggg
JN642138_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754588_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatctactcgaggattggg
GU456665_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatctcctcgaggactggg
DQ464182_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN642133_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040782_PreS2_P-D      ctgttccgactactgtctctcgcatatcgtcaatcttctcgaggattggg
JN040768_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN642155_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN642165_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MH724236_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
JN040822_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040776_PreS2_P-D      ctgttccgactactgcctctcacacatcgtcaatcttctcgagggttggg
JN040769_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB270550_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
GQ183467_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183460_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183469_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183461_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183456_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183459_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183468_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183458_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183455_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183452_PreS2_P-D      ctgttccgactactgtctctcacatatcgtccatcttctcgaggattggg
GQ183449_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183448_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183450_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183451_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183453_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183454_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183457_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183462_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183463_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183464_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183465_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183466_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257165_PreS2_P-D      ctgttcagactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257166_PreS2_P-D      ctgttcagactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257160_PreS2_P-D      ctgttccgactactgtctctcmcatatcgtcaatcttcwcgaggattggg
JN040772_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040753_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754632_PreS2_P-D      ctgttccgactactgtctctcccatatcatcaatcttcttgaggattggg
JX090609_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257176_PreS2_P-D      ctgttccgactactgtctctcacayatcgtcaatcttctcgaggattggg
JN257177_PreS2_P-D      ctgttccgactactgtctctcacayatcgtcaatcttctcgaggattggg
AB674406_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
EF103276_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK618429_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK618430_PreS2_P-D      ctgttccgagtactgtctctcccatatcgtcaatcttctcgaggattggg
MK618432_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK618433_PreS2_P-D      ctgttccgagtactgtctctcccatatcgtcaatcttctcgaggattggg
AB674419_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090634_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattgcg
JN040766_PreS2_P-D      ctgttccgactactgtctctcgcatatcgtcaatcttctcgaggattggg
GU456657_PreS2_P-D      ctgttccgactactgtatctcccacatcgtcactcttctcgaggattggg
AB674416_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754630_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GU456643_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN642126_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040820_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB674431_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040775_PreS2_P-D      ctgttccgaatactgtctctcccatatcgtcaatcttctcgaggattggg
GU456642_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
L27106_PreS2_P-D        ctgttccgactactgtctctcccatatcgtcaatcttttcgaggattggg
JN642150_PreS2_P-D      ctgctccgactactgtctctcccatatcgtcaatcttctcgaggattggg
HQ700449_PreS2_P-D      ctgttccgactactgyctctcacatatcgtcaatcttctcgaggattggg
FJ349215_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754599_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggg
JF754623_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggg
GU456645_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
X80924_PreS2_P-D        ctgttccgactactgcctctaccatatcgtcaatcttctcgaggattggg
X80926_PreS2_P-D        ctgttccgactactgcctctaccatatcgtcaatcttctcgaggattggg
KM108595_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
JN642164_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF471644_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040779_PreS2_P-D      ctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggg
GU456639_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB555500_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
JX090678_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggg
JX036331_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttcttgaggattggg
JN604239_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257186_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggg
JN040790_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040755_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
M32138_PreS2_P-D        ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GU456682_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456674_PreS2_P-D      ctgttccgactactgtatcacacatatcgtcaatcttctcgaggattggg
KM524348_PreS2_P-D      ctgttccgactactgtctctcacatatcgtgaatcttatccaggattggg
AB674425_PreS2_P-D      ctgttccgactactgtctctcccatatcatcaatcttctcgaggattggg
GU456676_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaaccttctcgaggattggg
JN642135_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ562309_PreS2_P-D      ctgttcccactactgtctctcacatatcgkcaatcttctcgaggattggg
AB674411_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatctcctcgaggattggg
AB270541_PreS2_P-D      ctgttccgaccactgtctctcacatatcgtcaatcttctcgaggattggg
KU668441_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KU668444_PreS2_P-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
GU456675_PreS2_P-D      ctgttccgaccactgtctctcccatatcgtcaatcttctcgaggattggg
GU456651_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090721_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
GU456684_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GU456635_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB674428_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK355500_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggataggg
MK693107_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040788_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040786_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040787_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KF471642_PreS2_P-D      ctgttccgactactgtctctcccatattgtcaatcttctcgaggattggg
KF170775_PreS2_P-D      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggg
JX090635_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN642149_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN642142_PreS2_P-D      ctgttccgactactgtctctcccatctcgtcaatcttctcgaggattggg
JN642134_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggg
JN642132_PreS2_P-D      ctgttccgaccactgtctctcacatatcgtcaatcttctcgaagattggg
JN040773_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaaccttctcgaggattggg
GU456649_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
FJ904429_PreS2_P-D      ctgttccgactactgtctctccaatatcgtcaatcttctcgaagattggg
JN792905_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN257148_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700472_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB674423_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttatcgaggattggg
KT201292_PreS2_P-D      ctgttccgactactgtctctcacayatcgtcaatcttctcgaggattggg
JF754606_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
JN642166_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KM108596_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN642147_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ477458_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ904426_PreS2_P-D      ctgttccgactactgtctctcacatatcatcaatcttctcgaggattggg
JX090640_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN642131_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggagtggg
JN257159_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggaytggg
JN040830_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggg
AB555501_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
AB555497_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaagattggg
JF754635_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754626_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
JN040800_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040801_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MF925391_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttatcgaggattggg
KF170772_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN642158_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257211_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN257150_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040757_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040750_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ904427_PreS2_P-D      ctgttccgaccactgtatctcacatatcgtcaatcttctcgaggattggg
FJ349219_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
AJ344116_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN792912_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN257172_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcaaggattggg
JN040809_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040784_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754600_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456679_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
GU456672_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456667_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
DQ991752_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
AB555496_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
JN040751_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
HQ700481_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700463_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
EF103280_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK507913_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF061170_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcagtcttctcgaggattggg
HQ700444_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700480_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700477_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700474_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700478_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700553_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KT366499_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB786644_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB246347_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KT366498_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KT366500_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KT366501_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KT366502_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700473_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700483_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700468_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700448_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700445_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700446_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700487_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700455_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700454_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700440_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700441_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700442_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700443_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700447_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700450_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700451_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700459_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700464_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700466_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700469_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700470_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700471_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700479_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700482_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700484_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700488_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HQ700453_PreS2_P-D      ctgttccgactactgtctctcatatatcgtcaatcttctcgaggattggg
KP995100_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
KM524338_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF061169_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX036334_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN642136_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KY629633_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090665_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN688695_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
JN040814_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaagattggg
JN040762_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ904415_PreS2_P-D      ctgttccgactactgtctctcacatatcatcaatcttctcgaggattggg
FJ904420_PreS2_P-D      ctgttccgactactgtctctcacatatcatcaatcttctcgaggattggg
FJ904421_PreS2_P-D      ctgttccgactactgtctctcacatatcatcaatcttctcgaggattggg
EF103281_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
DQ304548_PreS2_P-D      ctgttccgactactgtctctcacatatcgacaatcttctcgaggattggg
DQ304547_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
DQ304550_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
DQ304551_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY236162_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
DQ304549_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KT201241_PreS2_P-D      ctgttccgactactgtctctcrcatatcgtcaatcttctcgaggattggg
JN642129_PreS2_P-D      ctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggg
GU456658_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456654_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
X97848_PreS2_P-D        ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN664931_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttatcgaggattggg
JN642140_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN604312_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
FJ904446_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AY721611_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK693108_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KX276975_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KF170770_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
JX090660_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN642156_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN257200_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257188_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257183_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttatcgaggattggg
JN257163_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040812_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040793_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040774_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754610_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456677_PreS2_P-D      ctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggg
GU456637_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU357846_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ904422_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ904402_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
DQ111986_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY945307_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
AY373431_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB674403_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB126581_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KF471657_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF471655_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KF471650_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040810_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040802_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JF754619_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GU456671_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456636_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF471659_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
JX090676_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090641_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX036333_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN642157_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754614_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ349235_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB104711_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KF471645_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040819_PreS2_P-D      ctgttccgactactgtctctcccacattgtcaatcttctcgaggattggg
JF754634_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
EF103279_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY161153_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY161155_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY161154_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY161156_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY161151_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY161150_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY161152_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KM108602_PreS2_P-D      ctgttccgactactgtctctcacatatcgacaatcttctcgaagattggg
KM108603_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggg
KF471640_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttatcgaggattggg
MK618431_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK618437_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JF754605_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN642145_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GU456650_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB674427_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB270547_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KT201240_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
LT992439_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KT963508_PreS2_P-D      ctgttccgactactgtatctcccatatcgtcaatcttctcgaggattggg
KF170756_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX096955_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090668_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN792906_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN642161_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN604189_PreS2_P-D      ctgttccgactactgcctctcayatatcgtcaatcttatcgaggattggg
JN040821_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040817_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040811_PreS2_P-D      ctgttccgactactgtctctcccggatcgtcaatcttctcgaggattggg
JN040759_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754592_PreS2_P-D      ctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggg
JF754590_PreS2_P-D      ctgttccgaccactgtctctcatatatcgtcaatcttctcgaggattggg
GU456669_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456653_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ349234_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AY741797_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AF151735_PreS2_P-D      ctgttccgactactgtctctcccatatcgttaatcttctcgaagattggg
AB674408_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB674404_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB270546_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KC875299_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttgg
KX196208_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcactcttctcgaggattggg
KC875293_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttgg
KC875294_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttgg
KC875306_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttgg
KC875308_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttgg
KC875305_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttgg
KX196228_PreS2_P-D      ctgttccgactactgtcactcccatatcgtcaatcttctcgaggattggg
KX196211_PreS2_P-D      ctgttccaactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875288_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875296_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875309_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KX196209_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttgg
KC875290_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttgg
KX196212_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttgg
AB222710_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN642153_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040824_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040808_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JF754633_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GU456673_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaaccttctcgaggattggg
GU456666_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754612_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754609_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754603_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB246348_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB104710_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KM108600_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KM108601_PreS2_P-D      ctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggg
AB786653_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090647_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090621_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456659_PreS2_P-D      ctgttccgactactgtctcacacatatcgtcaatcttctcgaggattggg
GU456652_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN257203_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN257202_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GU456661_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ904431_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ904418_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB270548_PreS2_P-D      ctgttccgaccactgtctctcacatatcgtcaatcttctcgaggattggg
KF471656_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257201_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040823_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040777_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN792911_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN792908_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN792907_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN792903_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN792909_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN792910_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN792904_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT201234_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KX827300_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KF471654_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF471647_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KF170757_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF170755_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF061167_PreS2_P-D      gtgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090716_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX090695_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090681_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090636_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257170_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257152_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN257149_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040827_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040826_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
JN040815_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040806_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040795_PreS2_P-D      ctgttccgactactgtctctcccacatcgtcaatcttctcgaggattggg
JN040771_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456683_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456681_PreS2_P-D      ctgttccgaccactgtctctcacacatcgtcaatcttctcgaggattggg
GU456680_PreS2_P-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
GQ205380_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KM524342_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183480_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ904445_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ349231_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB330370_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MK618427_PreS2_P-D      ctgttacgactactgtctctcccatatcgtcaatcttctcgaggattggg
KX827291_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KF471660_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040799_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040758_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754593_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456638_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JF754602_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GU456668_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KC875304_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875303_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875302_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875285_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875281_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875280_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875275_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KX196226_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KX196213_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KX196210_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875291_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875284_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875278_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875300_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875298_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK618435_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK618434_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK618436_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090655_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090649_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090650_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090651_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090652_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090653_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090654_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK598647_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctggaggattggg
GU456655_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB222712_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GU456647_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875276_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KX196214_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK598650_PreS2_P-D      ctgttcccactactgtctctcacatatcgtcaatcttctcgaggattggg
MK598649_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK598646_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK598645_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK598644_PreS2_P-D      ctgttccgactactgtctctcccatatcctcaatcttctcgaggattggg
KF584160_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF471649_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KF471646_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF471641_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF170776_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggg
KF170773_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF061168_PreS2_P-D      gtgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KC875301_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875289_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JX090706_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN642151_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggg
JN642146_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN604259_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN257199_PreS2_P-D      ctgttccgactattgtctctcccatatcgtcaatcttctcgaggattggg
JN040813_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040805_PreS2_P-D      ctgttccgactattgtctctcccatatcgtcaatcttctcgaggattggg
JN040794_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040791_PreS2_P-D      ctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggg
JN040781_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
JN040767_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040765_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040761_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754601_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456670_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456664_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456646_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JF754607_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GU456641_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
FJ904424_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ349233_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
EU787441_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
EU594396_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AF214660_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AF121239_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB674429_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB674407_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB270542_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB104709_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MK598642_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JF754594_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AF280817_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY721608_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KY382412_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ477459_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF584161_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF584163_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF584164_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF584165_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF584166_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KY382414_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF584162_PreS2_P-D      ctgttccgactactgtctctcmcatatcgtcaatcttctcgaggattggg
AY741794_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY741795_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY741796_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF170771_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ904432_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB674405_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090633_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456656_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KC875277_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KX196215_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AY161157_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY161158_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK618428_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN507851_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN507836_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AY721610_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK598648_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK598643_PreS2_P-D      ctgttcccactactgtctctcccatatcgtcaatcttctcgaggattggg
MH724252_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KT366508_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KM606753_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KM108605_PreS2_P-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC875297_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KX196236_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875292_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KC875287_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875282_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875279_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC774477_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KC774459_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KC774445_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KC774444_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KC774440_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JQ687531_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN642130_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggg
JN604265_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257205_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN257182_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257151_PreS2_P-D      ctgttccgacaactgtctctcacatatcgtcaatcttctcgaggattggg
JN040829_PreS2_P-D      ctgttccgactactgtatctcccatatcgtcaatcttctcgaggattggg
JN040828_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040797_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040796_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040778_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN040770_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JF754627_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754624_PreS2_P-D      ctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggg
JF754615_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754608_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754595_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
HQ700511_PreS2_P-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
GU456663_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GU456640_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
FJ386590_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ349228_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ349217_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ349216_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
EU414136_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
EU414135_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
DQ991754_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY721612_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AY721609_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AY721607_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AY721606_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AY721605_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AY661792_PreS2_P-D      ctgttccgactactgtctctcccatatcttcaatcttctcgaggattggg
AY661793_PreS2_P-D      ctgttccgactactgtctctcccatatcttcaatcttctcgaggattggg
AY161159_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AY161160_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AF121242_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB674422_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB222713_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB222709_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB104712_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090684_PreS2_P-D      ctgttccgactactgtctctcacatatcatcaatcttctcgaggattggg
JN040783_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090687_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
FJ349229_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK517524_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK507910_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
LC365689_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KY629634_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KF170766_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JX090627_PreS2_P-D      ctgttccgactactgtctctcacttatcgtcaatcttctcgaggattggg
JN642167_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN604278_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN604263_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN604206_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttatcgaggattggg
JN040792_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
HM750152_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
FJ349230_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
EU787446_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB270543_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB222711_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB583680_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
EU594397_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
EU787436_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ183470_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GQ377589_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257179_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257185_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK507911_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK507914_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KM524339_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF170765_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257196_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257169_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754618_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754591_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
DQ315778_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257155_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AJ627224_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF170758_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF170759_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KM108591_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KM108606_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KM108607_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ904412_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
GU456660_PreS2_P-D      ctgttccgactactgtctcacacatatcgtcaatcttctcgaggattggg
MK517521_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF471658_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF170764_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257209_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257171_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ904443_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
FJ349220_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754604_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF754628_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF170747_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KP322600_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK517520_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KC875295_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttgg
KX196227_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttgg
Y07587_PreS2_P-D        ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
X02496_PreS2_P-D        ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040807_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AY796030_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
GU456648_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JF754596_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KF471651_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KF471652_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AF121240_PreS2_C-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AF121241_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257193_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK517522_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MK517523_PreS2_P-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KC875286_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC875283_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AY796032_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
FJ904399_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN040785_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KP322599_PreS2_P-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
                         ** *   *     *                          * *     *

EU155895_PreS2_P-D      gaccctgcgctgagcatggagaacatcacatcaggattcctaggacccct
JX310727_PreS2_P-D      gaccctgcgctgaacatggagaacattacatcaggattcctaggacccct
KF170769_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
EU414140_PreS2_P-D      gaccctgtgccgaacatggagagcatcacatcaggattcctaggacccct
X65258_PreS2_P-D        gaccctgtgacgaatatggagaacatcacatcaggattcctaggacccct
MF925366_PreS2_P-D      gaccctgcaccgaacatggagaacatcgcatcaggactcctaggacccct
EU155893_PreS2_P-D      gaccctgcgctgaacatggggaacatcacatcaggactcctaggacccct
JN604152_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707689_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707683_PreS2_P-D      gaccttgtactgaacatggagaacatcacatcaggattcctaggacccct
JQ707697_PreS2_P-D      gaccttgtactgaacatggagaacatcacatcaggattcctaggacccct
JQ707699_PreS2_P-D      gaccttgtactgaacatggagaacatcacatcaggattcctaggacccct
JQ707702_PreS2_P-D      gaccttgtactgaacatggagaacatcacatcaggattcctaggacccct
JQ707706_PreS2_P-D      gaccttgtactgaacatggagaacatcacatcaggattcctaggacccct
JQ707703_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707693_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707682_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707684_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707685_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707686_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707687_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707688_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707691_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707692_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707694_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707695_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707696_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707698_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707700_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707701_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707704_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707705_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ707690_PreS2_P-D      gaccttgcactgaacatggagaacatcacatcaggattcctaggacccct
JX090648_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ477454_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090690_PreS2_P-D      gaccttgcgaggaacatggagaacatcacatcaggattcctaggacccct
KF170760_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN604139_PreS2_P-D      ggccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT366494_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
DQ399006_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925390_PreS2_P-D      gtccctgcgatgaacatggagaacatcacatcaggattcctaagacccct
KX276856_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN642163_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT151620_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN664941_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KF053178_PreS2_P-D      gtccctgcgatgaacatggagaacatcacatcaggattcctaggacccct
JN604120_PreS2_P-D      gaccctgcgctgaacatggagaacatctcatcaggattcctaggacccct
KT366465_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB119255_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JN642144_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctagaacccct
KX276857_PreS2_P-D      gtccctgcgctgaacatggaaaacatcacatcaggattcctaggacccct
AY090453_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
KU668449_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT366511_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN664927_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707511_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT366510_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925379_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707491_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN664928_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM524346_PreS2_P-D      gaccctgcgctgaacatggagaaaatcacatcaggattcctaggacccct
KM524351_PreS2_P-D      gaccctgcgctgaacatggagaaaatcacatcaggattcctaggacccct
MK598663_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707529_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707519_PreS2_P-D      gaccctgcgctgaacatggaaaacatcacatcaggattcctaggacccct
JQ707517_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707516_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707513_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707512_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707514_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707515_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707518_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707520_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707521_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707522_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707523_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707526_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707528_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707530_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707524_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707525_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB119256_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH932714_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT366493_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM524344_PreS2_P-D      gaccctgcgctgaacatggagaaaatcacatcaggattcctaggacccct
GQ183471_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707505_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707499_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707494_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707490_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707487_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707485_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707484_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707481_PreS2_P-D      gaccttgcgctgaacatggaaaacatcacatcaggattcctaggacccct
JQ707479_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707476_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707478_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707482_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707489_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707496_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707500_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707502_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707507_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707508_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707480_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707488_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707503_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM524347_PreS2_P-D      gaccctgcactgaacatggagaacatcacatcaggattcctaggacccct
JN664918_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF618349_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KF679998_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ183481_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KF679997_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707506_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ183479_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ183477_PreS2_P-D      gaccctgcgctgaatatggagaacatcacatcaggattcctaggacccct
GQ183476_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP165604_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ183472_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB119254_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM524341_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707483_PreS2_P-D      gaccctgcgctgaacatggagaacatcatatcaggattcctaggacccct
JQ707486_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707527_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925363_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT366496_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT366491_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KC875311_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KC875310_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707504_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707493_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ924652_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
AB119252_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB109479_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB090268_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB120308_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ183474_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM524352_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM524353_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KF679994_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KF679996_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707498_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707509_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB090269_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB116266_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ183482_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ183483_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP184499_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP202937_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP202938_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP202939_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP202940_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP202943_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT962021_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT962023_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT962024_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925364_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707510_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707501_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707497_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707492_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707477_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ707495_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN664930_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925383_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925393_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ183475_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB109478_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB109475_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB109476_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB109477_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB110075_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB119251_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB119253_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB205126_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB210821_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB210822_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB267090_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB471856_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB471857_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KC875312_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM524354_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM524355_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KR905424_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT366495_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT366506_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT366509_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925358_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB078031_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB078033_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB078032_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KJ647352_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090714_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KJ647350_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ477453_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
JN604175_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090614_PreS2_P-D      gaccctgtgctgaacatgtagaacatcacatcaggattcctaggacccct
AB188242_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598672_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK618423_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK618424_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggaccctt
MK618425_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggaccctt
JX090712_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH724216_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ477452_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
MK598665_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598664_PreS2_P-D      gaccctgtgaagaacatggagaacatcacatcaggattcctaggacccct
GQ477456_PreS2_P-D      gaccctgcactgaacatggagaacatcacatcaggattcctaggacccct
MK618422_PreS2_P-D      gaccctgcgctgaacatggagaacattacatcaggactcctaggacccct
EU594416_PreS2_P-D      gaccctgcgttgaacatggagaacatcacatcaggactcctaggacccct
EU594417_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
EU594409_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
EU594401_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JX096958_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
KP184497_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
KP202941_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
KP202942_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
KP202944_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
KT962022_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
EU594402_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
EU594429_PreS2_P-D      gaccctgcgttgaacatggagaacatcacatcaggactcctaggacccct
EU594431_PreS2_P-D      gaccctgcgttgaacatggagaacatcacatcaggactcctaggacccct
EU594432_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
KP184495_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
KP184496_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
KP184498_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
AB090270_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JF815668_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090715_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
MK598667_PreS2_P-D      gaccctgggctgaacatggagaacatcacatcaggattcctaggacccct
MH724247_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH724241_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN642143_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AF043594_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
KF779220_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598679_PreS2_P-D      gaccctgcgctgaacatggagaacatcacaccaggattcctaggacccct
MK598678_PreS2_P-D      gaccctgcgctgaacatggagaacatcacaccaggattcctaggacccct
MK598677_PreS2_P-D      gaccctgcgctgaacatggagaacatcacaccaggattcctaggacccct
MK598676_PreS2_P-D      gaccctgcgctgaacatggagaacatcacaccaggattcctaggacccct
MK598675_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598671_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK618421_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK618426_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598669_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP230541_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
KT962025_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
EU594408_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
KP165599_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
Z35716_PreS2_P-D        gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH724217_PreS2_P-D      gaccctgctctgaacatggagaacatcacatcaggattcctaggacccct
MH724223_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN507837_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090717_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
JX090675_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
JX090711_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
EU594419_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
EU594420_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
EU594423_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
EU594428_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
KP143745_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
KP165598_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
KP165601_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
KP165602_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
KP202945_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
EU594422_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
EU159677_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
JX096956_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
KP143744_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
MK618420_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598673_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598666_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH724238_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH724231_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX827290_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594421_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594415_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594410_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594407_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594427_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594400_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594403_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594413_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594414_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594424_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP165605_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX827301_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH724244_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH724246_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK618418_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK618419_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN507839_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594405_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KF170761_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090677_PreS2_P-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
AJ627215_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AJ627216_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AJ627218_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM108592_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
AY090452_PreS2_P-D      gcccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN604238_PreS2_P-D      gaccctgtgcggaacatggagaacatcacatcaggattcctaggacccct
KT749827_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KF170744_PreS2_P-D      gaccctgcgcggaacatggagaacatcacatcaggattcctcggacccct
MK598661_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090700_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AY796031_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JX310728_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ477455_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090701_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN642148_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN257190_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JF754597_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM577671_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB205128_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX310729_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JQ687530_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM577670_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN604161_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB188241_PreS2_P-D      gaccctgcgatgaacatggagaacatcacatcaggattcctaggacccct
KM577669_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM577668_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090693_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JF754621_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ349218_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090606_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ183485_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090683_PreS2_P-D      gaccctgcgttgaacatggagaacatcacatcaggattcctaggacccct
JX090625_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AJ627222_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KU736924_PreS2_P-D      gaccctgcgttgaacatggagaacatcacatcaggattcctaggacccct
KU736925_PreS2_P-D      gaccctgcgttgaacatggagaacatcacatcaggattcctaggacccct
X72702_PreS2_P-D        gaccctgcactgaacatggagaacatcacatcaggattcctaggacccct
KM108593_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090692_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090685_PreS2_P-D      gaccctgcgctgaacatggagtacatcacatcaggattcctaggacccct
EU594425_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB210820_PreS2_P-D      gaccctgcactgaacatggagaacatcacatcaggattcctaggacccct
JX090663_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598674_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357637_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ183484_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK516278_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN664939_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090688_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090619_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598670_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
X97849_PreS2_P-D        gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598660_PreS2_P-D      gaccctgcgttgaacatggagaacatcacatcaggattcctaggacccct
MK517518_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357639_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357638_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT749828_PreS2_P-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT749821_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090686_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN642159_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ349206_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594398_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU414138_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AJ627223_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB330369_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB205127_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX090718_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AJ627220_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KF679995_PreS2_P-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KR905423_PreS2_P-D &nbs