HBVdb

Dataset for nucleotide sequence PreC of genotype D

[Download (right click)] [Edit] [Sequences] [Repertoires]

2353 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


AB555500_PreC_P-D      atgcaactttttcacctctgccta---atcatatcttgttcatgtcctac
MG877726_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG877727_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG877728_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601320_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904439_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097636_PreC_P-D      atgcaactttttcacctctgccta---atcagctcttgttcatgtcctac
MZ097644_PreC_P-D      atgcaactttttcacctctgccta---atcakctcttgttcatgtcctac
JX036342_PreC_P-D      --------ttttcacctctgccta---atcatctcttgttcatgtcctac
JX036343_PreC_P-D      --------ttttcacctctgccta---atcatctcttgttcatgtcctac
JX036344_PreC_P-D      --------ttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097662_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040766_PreC_P-D      atgcaactttttcacctctgccta---atcagctcttgttcatgtcctac
MZ097880_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674416_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725171_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674415_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491172_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097798_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601338_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491159_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754612_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754594_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754617_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726891_PreC_P-D      ctgcaactttttcacctctgccta---atcacctcttgttcatgtcctac
JN040773_PreC_P-D      ctgcaactttttcacctctgccta---atcacctcttgttcatgtcctac
MZ097713_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB330367_PreC_P-D      atgcaactttttcacctctgccta---atcacctcttgttcatgtcctac
JF754609_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097730_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456677_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097698_PreC_P-D      atgyaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642135_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
JN642128_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857028_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097874_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456679_PreC_P-D      attcgactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754622_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726979_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754626_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725153_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257165_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257166_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF018181_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491126_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857031_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725126_PreC_P-D      atgcgactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257153_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257195_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456657_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904426_PreC_P-D      atgcacctttttcacctctgccta---atcagctcttgttcatgtcctac
EU726884_PreC_P-D      atgtaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK355501_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456651_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491158_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097692_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097691_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857032_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857018_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257176_PreC_P-D      atgcaactttttcmcctctgccta---ktcatctcttgttcatgtcctac
JN257177_PreC_P-D      atgcaactttttcmcctctgccta---ktcatctcttgttcatgtcctac
X85278_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601299_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097770_PreC_P-D      atrcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601245_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097728_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097637_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904438_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097665_PreC_P-D      atgcaactttttcacctctgccta---atcacctcttgttcatgtcctac
MZ097631_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724978_PreC_P-D      atgcaactttttcacctctgccta---atcacctcttgttcatgtcctac
JF754600_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB270541_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB104710_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT114169_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725199_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725189_PreC_P-D      atgcgactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601288_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725135_PreC_P-D      atgcgactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726952_PreC_P-D      atgcatctttttcacctctgccta---atcatctcttgttcatgtcctac
JN040774_PreC_P-D      atgcatctttttcacctctgccta---atcatctcttgttcatgtcctac
KP857024_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB270542_PreC_P-D      aggcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097682_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857039_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF018177_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642146_PreC_P-D      atgcacctttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904429_PreC_P-D      atgcayywttttcacctctgccta---atcatctcttgttcatgtcctac
X80924_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X80926_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371909_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ167302_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ167301_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ184322_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097653_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097638_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097629_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601331_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857019_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ486023_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB270540_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097711_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754619_PreC_P-D      mtgcgactttttcacctctgccta---atcacctcttgttcatgtcctac
GU456664_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097843_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642136_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ833466_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456682_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491188_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097693_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725068_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642147_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456654_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491187_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491162_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491155_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491149_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY236162_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ304550_PreC_P-D      atgcaactttttcatctctgccga---atcatctcttgttcatgtcctac
DQ304551_PreC_P-D      atgcaactttttcatctctgccga---atcatctcttgttcatgtcctac
DQ304547_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ304548_PreC_P-D      atgcaactttttcaccgctgccta---atcatctcttgttcatgtcctat
DQ304549_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT731871_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904402_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X59795_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040772_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040771_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491183_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097795_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040830_PreC_P-D      atggaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700439_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904446_PreC_P-D      ctgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491147_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674417_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674418_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336680_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336682_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336684_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336681_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336683_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097661_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257172_PreC_P-D      atgcaactttttcmcctctgccta---ktcatctcttgttcatgtcctac
JN257173_PreC_P-D      atgcaactttttcmcctctgccta---ktcatctcttgttcatgtcctac
JF754593_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754592_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726912_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674410_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456678_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857033_PreC_P-D      atgcgactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097830_PreC_P-D      attcgactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601279_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097753_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456656_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904431_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF018182_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257160_PreC_P-D      atgcaactttttcmcctctgccta---ktcatctcttgttcatgtcctac
JN257161_PreC_P-D      atgcaactttttcmcctctgccta---ktcatctcttgttcatgtcctac
GU456675_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ205385_PreC_P-D      atgcaactttttgacctctgccta---atcatcttttgttcatgtcctac
MG491173_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491186_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601239_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097723_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097801_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097676_PreC_P-D      acgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097639_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857037_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ477458_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726944_PreC_P-D      attcgactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040776_PreC_P-D      attcgactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904399_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601298_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097769_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726941_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726875_PreC_P-D      atgcatatttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904445_PreC_P-D      aygcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726969_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB270550_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KY629634_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857022_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097823_PreC_P-D      mtgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857025_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642164_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726868_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040779_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AJ627224_PreC_P-D      atgcaactttttcacctctgccta---gtcatctcttgttcatgtcctac
MW601304_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642156_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754634_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456673_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456659_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754604_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EF103281_PreC_P-D      atggaactttttcacctcttccta---atcctctcttggtcctgtcctac
JF754631_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857017_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857015_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857016_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601278_PreC_P-D      aagcgactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601258_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ687531_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642167_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754635_PreC_P-D      acgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491170_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601250_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097734_PreC_P-D      atgcaactttttcacctctgccta---atcayctcttgttcatgtcctac
X85277_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097677_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725202_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724970_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857114_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040781_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700463_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904418_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY796032_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674419_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097870_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097635_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754590_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726850_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601247_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097731_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726885_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040755_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097881_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097646_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KY629633_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857115_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456672_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857021_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU787438_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726848_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857038_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097825_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700472_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674404_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700467_PreC_P-D      ctgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700455_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN687947_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700478_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700553_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700481_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700474_PreC_P-D      atgcacctttttcacctctgccta---atcatctcttgttcatgtcctac
MH725086_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700468_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700470_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700489_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700473_PreC_P-D      atgcacctttttcacctctgccta---atcatctcttgttcatgtcctac
AB222712_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598643_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700444_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700483_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700448_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700477_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700480_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700449_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700469_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700479_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700484_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700440_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700441_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700445_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700446_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700447_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700450_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700451_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700454_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700459_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700464_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700466_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700471_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700482_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700487_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700488_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700442_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700443_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097786_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097707_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642158_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726864_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725096_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725110_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725118_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725097_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725172_PreC_P-D      atgcaactttttcacctttgccta---atcatcttttgttcatgtcctac
MH724959_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726906_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ464182_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371913_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097634_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725139_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU787439_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF419522_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB270549_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85273_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097868_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097705_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725094_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF618349_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KP857034_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257159_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456681_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904427_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097878_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097673_PreC_P-D      atgcaactttttcacctctgccta---atcacctcttgttcatgtcctac
MW601285_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097759_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601267_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601244_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097727_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857035_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456684_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371904_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF419530_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674403_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601325_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097790_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601322_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097783_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857109_PreC_P-D      atgcaactttttcacctctgccta---ctcatctcttgttcatgtcctac
JN642150_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040821_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040752_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371915_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU939681_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ899792_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491144_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097811_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097674_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601339_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724962_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601283_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097757_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097856_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674420_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040778_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097810_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725144_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642153_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040777_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
FJ904424_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726908_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726847_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491174_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097643_PreC_P-D      ctgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642166_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP995100_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040780_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456676_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456668_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725123_PreC_P-D      atgcaactttttcacctctgccta---atcatcttcttttcatgtcctac
JN642133_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257170_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040765_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674408_PreC_P-D      ctgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725088_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040761_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349220_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601307_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097775_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097875_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725054_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724960_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724969_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040753_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904432_PreC_P-D      acgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371916_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AJ344116_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726957_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857040_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT731880_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT591279_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT591277_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471658_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF018195_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040750_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY721605_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601262_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097742_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB716760_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HE805987_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097768_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgytcatgtcctac
M32138_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857023_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF018185_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040754_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726926_PreC_P-D      atgcaactttttcacctctgccta---aacatctcttgttcatgtcctac
EU726910_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726872_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726965_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040757_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674405_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HM042272_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
HM042273_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
HM042283_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287601_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287602_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287604_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287605_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287607_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287608_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287609_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287610_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287611_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287612_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287615_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287617_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287618_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287620_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
JQ287621_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
GQ183449_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183464_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183463_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183459_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183458_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183457_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183460_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183461_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183469_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183450_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183451_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183452_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183453_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183454_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183455_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183456_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183462_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183465_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183466_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183467_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183468_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183448_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097796_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097688_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097625_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642151_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754588_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904415_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642126_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642130_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601303_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471644_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456663_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY161158_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725031_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725033_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040792_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040791_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040793_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097876_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456660_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB222710_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097861_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097690_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601232_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725087_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857036_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857026_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524338_PreC_P-D      atgcaactttttcacctctgccta---atcatcacttgtacatgtcctac
KF061167_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
JN642132_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257211_PreC_P-D      atgcaactttttcccctctgccta---ttcatctcttgttcatgtcctac
JN257179_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040784_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754614_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ562309_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724965_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724966_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725125_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524348_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471660_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726861_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097658_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601335_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725077_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857020_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF018192_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY161150_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY161151_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY161152_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY161153_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY161154_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY161155_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY161156_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ287619_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN507836_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW455166_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF170739_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725198_PreC_P-D      atgcaactttttcacctgtgccta---atcatctctcgttcatgtcctac
MH725079_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724980_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725047_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttggtcatgtcctac
MH725134_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725169_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725133_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725057_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725046_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725053_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725055_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725056_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725052_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724995_PreC_P-D      atgcaactttttcacttttgccta---ttcatctcttgttcatgtcctac
MH724985_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724977_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725064_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725065_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725080_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725081_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724961_PreC_P-D      atgcaactttttcccctctgccta---atcatctcttgttcatgtcccac
MH724971_PreC_P-D      atgcaacttttcttcctctgccta---atcatctcttgttcatgtcctac
MH725208_PreC_P-D      atgcagctttttcacctctgccta---atcatctcttgttcatgtcctac
MH725182_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725174_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725101_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725090_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725016_PreC_P-D      atgcaactttttcccctctgccta---atcatctcttgttcatgtcctac
MH724973_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725181_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725083_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724997_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725191_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725175_PreC_P-D      atgccaatttttcacctctgccta---atcatctcttgttcatgtcctac
MH725211_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725206_PreC_P-D      atgcaactttttcacctctgccta---atcatctcctgttcatgtcctac
MH725205_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctgc
MH725193_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725184_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725180_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725176_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725164_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725148_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725136_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725115_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725085_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724991_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724989_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724976_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724987_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725158_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724979_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725183_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725203_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724954_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724981_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724983_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724986_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725007_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725015_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725131_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725154_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725155_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725166_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725188_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725190_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725195_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724958_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724992_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456683_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN132132_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN132130_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN558561_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN132131_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT591278_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471646_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC774477_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642138_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754606_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349219_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726876_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726844_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ111986_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF419516_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF419524_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601297_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725018_PreC_P-D      atgccaatttttcacctctgccta---atcatctcttgttcatgtcctac
EU726943_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674411_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491177_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097860_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097771_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725194_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725012_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX827291_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754627_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456680_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726905_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB270547_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726961_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040783_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726907_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726909_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601300_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF061169_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642165_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642134_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257182_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754598_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726879_PreC_P-D      atacaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725124_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcatac
MH725168_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725089_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725036_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725075_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725084_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725107_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725004_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904420_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904421_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724996_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471650_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040751_PreC_P-D      atgcaagtttttcacctctgccta---atcatctcttgttcatgtcctac
MH724999_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726917_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN132127_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ641710_PreC_P-D      atgcaactttttcacntctgccta---atcatctcttgttcatgtcctac
JN132128_PreC_P-D      atgcaactttttcacctcttccta---atcatctcttgttcatgtcctac
MK598646_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT749855_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726899_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725045_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725050_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725109_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456653_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU787443_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754599_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754623_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725119_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725120_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725132_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725008_PreC_P-D      atgcacctttttcccctctgccta---atcatctcttgttcatgtcctac
KF061170_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN558562_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257163_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ833467_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456662_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456661_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349230_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349228_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349215_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726853_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EF103279_PreC_P-D      atgcaactttttgaagtctgccta---atcatctcttgttcagctcaggc
AY721609_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
AY161157_PreC_P-D      atgcaacttcttcacctctgccta---atcatctcttgttcatgtcctac
MH725071_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725072_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674406_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ833469_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725098_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725099_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725100_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725103_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725127_PreC_P-D      atgcaacttctttccctctgccta---atcatctcttgttcatgtcctac
MH725165_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725162_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725160_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725093_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725091_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725092_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725104_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725163_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85302_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725173_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725011_PreC_P-D      atgcaactttttcccctctgccta---atcatctcatgttcatgtcctac
KP671698_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904412_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF121239_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB222709_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725030_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725025_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725032_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725082_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725106_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725029_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725095_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725005_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724990_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257200_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725150_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725147_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725151_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725186_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725149_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725187_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725146_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725210_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725159_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725128_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725129_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC774445_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MW601252_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097736_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601309_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725207_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724956_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857106_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724955_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF925391_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF018190_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349217_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU414136_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598645_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725102_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85295_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725209_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725201_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725108_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725061_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725014_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724972_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
LK995390_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857027_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754624_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183470_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349216_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726874_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB126581_PreC_P-D      atgcaactttttcacctctgccta---atcatctcctgttcatgtcctac
MW601280_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097754_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU357846_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN507851_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725113_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725130_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725111_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491137_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724988_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724993_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724994_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725167_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097743_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725112_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB270548_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725177_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HM750155_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HM750156_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726958_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371919_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT591276_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85303_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85304_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725204_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF018191_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC774462_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
FJ349229_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF018194_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725161_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725063_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349234_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN558563_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN558564_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN132126_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY721611_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF121242_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875297_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196236_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725069_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725058_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725060_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725062_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725137_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725078_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601243_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097726_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606753_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097788_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725022_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725157_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491167_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491138_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097849_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097679_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601319_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725076_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724974_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724967_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857107_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524342_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471656_PreC_P-D      atgcaactttttcacctctgccta---atcgtctcttgttcatgtcctac
KF061168_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040823_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040794_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040788_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040785_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040756_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754618_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754615_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754605_PreC_P-D      atgcaactttttcacctctgccta---atcagctcttgttcatgtcctac
HQ833468_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HM750152_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU787446_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU787436_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726960_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EF103275_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY721608_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY721607_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB188244_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725066_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725067_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB104709_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB104711_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725196_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725197_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097820_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725019_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725006_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724968_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85294_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724982_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ205380_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257209_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726959_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598649_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598650_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491136_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491134_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097813_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097648_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097640_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN585095_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598648_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598644_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK507914_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725185_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725156_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725142_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725105_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725028_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725001_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724998_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724984_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KY629630_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX827300_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366499_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857105_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857104_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP322599_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF018180_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257171_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040790_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040786_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183480_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904443_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU919197_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726967_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726964_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EF103280_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY721610_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY721606_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ287603_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ287606_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ287613_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ287614_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ287616_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726900_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726914_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726918_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF121240_PreC_C-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF121241_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371907_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB246347_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366498_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366500_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366502_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601313_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598641_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491169_PreC_P-D      atgcaactttttcacctcagccta---atcatctcttgttcatgtcctac
MG491127_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491168_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671689_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598639_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598637_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU594396_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726962_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598636_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598640_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB222711_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724975_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725002_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491192_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491190_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491157_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491161_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491165_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097858_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097848_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097841_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK693107_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598642_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598638_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK507911_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725178_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725138_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725048_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725041_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725035_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725034_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725026_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725023_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724964_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
LC365689_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP322600_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF798260_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF018184_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642131_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257185_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257150_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754628_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ833470_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ833465_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HM750154_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU787447_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU787442_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU787441_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU787440_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726878_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EF103276_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY945307_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB583680_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725117_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725121_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725049_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725051_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725179_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725037_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725040_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725027_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725116_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725122_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725170_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725013_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725070_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725003_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725009_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725017_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725039_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725044_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725073_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725143_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF798283_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366508_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257193_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257194_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU787437_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU787445_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HM750153_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ833471_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK507910_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK507913_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726923_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725145_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB246348_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU594397_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726862_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724963_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725059_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725074_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601292_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097764_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674407_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM577670_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
FJ904435_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097865_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MZ097715_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642144_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
GQ477453_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601255_PreC_P-D      atgcaactttttcacctctgcctg---atcacctcttgttcatgtcctac
MN844881_PreC_P-D      atgcgactttttcacctctgccta---atcatctcttgttcatgtcctac
KJ647350_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601268_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097867_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ477456_PreC_P-D      ttgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KJ647352_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MZ097857_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB188241_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KP857041_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601308_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097776_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857048_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB555496_PreC_P-D      atgcaacttcttcacctctgccta---atcatctcttgttcatgtcctac
AB210820_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726871_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AJ627222_PreC_P-D      atgcaactttttcacctctgccta---gtcatctcgtgttcatgtcctac
MZ097779_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097624_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097877_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
MZ097819_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JN642163_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097712_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM577671_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257190_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
KP856990_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
JN257178_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
MZ097704_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
MH724238_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642159_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ477454_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
MZ097851_PreC_P-D      atgcacctttttcacctctgcctg---atcatctcttgttcatgtcctac
KP856989_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097626_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
MT603389_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN310706_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KX260231_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MN310707_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MW601274_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MZ097750_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MT603392_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097792_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcgtgttcatgtcctac
AB555501_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP856981_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603390_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603391_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603404_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN792911_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN792912_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN792904_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603393_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601236_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JN642143_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
AF419538_PreC_P-D      atgcaactttttcacctctgccta---gtcatctcttgttcatgtcctac
MT603387_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603388_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724241_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ477452_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MZ097853_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
AF419537_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
AB555497_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601228_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594404_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
AF419512_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
GU456635_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601301_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
MZ097773_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
MT603394_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603395_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB270539_PreC_P-D      atgcaactttttcacctctgccta---atcatctcgtgttcatgtcctac
MZ097628_PreC_P-D      atgcacctttttcacctctgccta---atcatctcatgttcatgtcctac
LT992439_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
JN664936_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF043593_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK598679_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK598678_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK598676_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
AF043594_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK598677_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JN792905_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN792906_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT579901_PreC_P-D      atgcaactttttcacctctgccta---atcatctctttttccggtcctac
HQ700510_PreC_P-D      atgcaactttttcacctctgccta---atcatctcgtgttcatgtcctac
KX357637_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX357638_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU736924_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU736925_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX357639_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85279_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857043_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594398_PreC_P-D      atgcaactttttcacctctgccta---gtcatctcatgttcatgtcctac
MK598674_PreC_P-D      atgcaactttttcacctctgccta---gtcatctcatgttcatgtcctac
JN792908_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603397_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603398_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603383_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603384_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603396_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN792907_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603399_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN792903_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN792909_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN792910_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603385_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603401_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603402_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603403_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT603400_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097663_PreC_P-D      atgcaactttttcacctctgccta---atcatctcgtgttcatgtcctac
MZ097883_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MZ097717_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MW601330_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB188242_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KC774436_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KC774460_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK598670_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349218_PreC_P-D      atgcaactttttcacctctgccta---atcatctcctgttcatgtcctac
AB205127_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK598659_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KF922432_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU594426_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
AY603445_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
AY603433_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KP857111_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JN664914_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700512_PreC_P-D      atgcaactttttcacctctgccta---atcatctcgtgttcatgtcctac
HQ700513_PreC_P-D      atgcaactttttcacctctgccta---atcatctcgtgttcatgtcctac
HQ700514_PreC_P-D      atgcaactttttcacctatgccta---atcatctcgtgttcatgtcctac
LT992454_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700511_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AJ627223_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
AJ627220_PreC_P-D      atgcaactttttcacctctgccta---gtcatctcatgttcatgtcctac
MK598662_PreC_P-D      atgcaactttttcacctctgccta---gtcatctcatgttcatgtcctac
MN507837_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP322601_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598668_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT579899_PreC_P-D      atgcaactttttcacctctgccta---atcatctctttttccggtcctac
MZ097855_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MH724247_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MH724246_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
AB205128_PreC_P-D      atgcaactttttcacctctgccta---atcatctcgtgttcatgtcctac
EU414061_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU414138_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MH724244_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MT579903_PreC_P-D      atgcaactttttcacctctgccta---atcatctcattttccggtgctac
MH724216_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594411_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU594412_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT579900_PreC_P-D      atgcaactttttcacctctgccta---atcatctctttttccggtcctac
MT579898_PreC_P-D      atgcaactttttcacctctgccta---atcatctctttttccggtcctac
MT579902_PreC_P-D      atgcaactttttcacctctgccta---atcatctctttttccggtgctac
AB330369_PreC_P-D      atgcaactttttcacctctgccta---atcatctcgtgttcatgtcctac
AB330370_PreC_P-D      atgcaactttttcacctctgccta---atcatctcgtgttcatgtcctac
AY603427_PreC_P-D      atgcaactttttcacctctgccta---atcatctcgtgttcatgtcctac
EU594399_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
AY603439_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KX827290_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KX827301_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
AY603443_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594430_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594433_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JX096954_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JX096957_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594425_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594424_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MH724231_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MH724217_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MH724223_PreC_P-D      atgcaactttttgacctctgccta---atcatctcatgttcatgtcctac
EU414058_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK618426_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594422_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
Z35716_PreC_P-D        atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK618419_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594415_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK598669_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK598673_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK598666_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JX096958_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594421_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MW601266_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MZ097747_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594400_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594401_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594402_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594403_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594405_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594409_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594410_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594416_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594431_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594432_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK598671_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK618422_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594407_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594427_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK618421_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
AY603434_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JX096955_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
AY603440_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
AY603437_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK598667_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK598672_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU414060_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU414140_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594423_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594428_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JX096956_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK598675_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK618420_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
AY603428_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
EU594408_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK618418_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JN664924_PreC_P-D      gctcttctttttcacctctgccta---atcatctcatgttcatgtcctac
MZ097656_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ922000_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85276_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN688713_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601287_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097761_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85268_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601327_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097793_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK052973_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK052975_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK052974_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK052963_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK052966_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK052971_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK052954_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
MK052959_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
MK052953_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
MK052958_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
MK052955_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
MK052950_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
MK052956_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
MK052948_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
MK052949_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
MK052961_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
MK052951_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
MK052960_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
MK052972_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK052947_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
MK052952_PreC_P-D      atgcaactttttcacctctgcata---atcatctcttgttcatgtcctac
AY090452_PreC_P-D      atgtaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF925366_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
AF419527_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT749845_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601233_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601234_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097720_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN688710_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664920_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KJ647355_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN688711_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF419528_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097804_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724248_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097869_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
MH724245_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601240_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724234_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN688708_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097879_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664932_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
DQ464181_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85270_PreC_P-D        atgccactttttcacctctgccta---atcatctcttgttcatgtcctac
MN310710_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349213_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ464173_PreC_P-D      atgcaactttttcacctctgcgta---atcatctcttgttcatgtcctac
DQ329356_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ464175_PreC_P-D      atgtaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ464172_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ329357_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336690_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ464178_PreC_P-D      atgcaantttttcacctctgccta---atcatctcttgttcatgtcctac
DQ464174_PreC_P-D      atgcaactttttcacctttgccta---atcatctcttgttcatgtcctac
DQ486021_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336686_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY236164_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ486022_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336689_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ464176_PreC_P-D      -------tttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336687_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336685_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336677_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336674_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY236160_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336675_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336676_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336678_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336679_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ464177_PreC_P-D      -------tttttcacctctgccta---atcatctcttgttcatgtcctac
JF754625_PreC_P-D      aggcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF419521_PreC_P-D      atgtaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724230_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN688678_PreC_P-D      ctgcgactttttcacctctgccta---atcatctcttgttcatgtcctac
AB270537_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524361_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
MF488704_PreC_P-D      atgcaactttttcacctccgccta---atcatcttttgttcatgtcctac
KP857042_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG877709_PreC_P-D      atgcaactttttcacctctgccta---gtcatctcttgttcatgtcctac
MG877710_PreC_P-D      atgcaactttttcacctctgccta---gtcatctcttgttcatgtcctac
X85280_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097694_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF419523_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85269_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN310712_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875342_PreC_P-D      atgcaactttttgacctctgccta---atcatcttttgttcatgtcccac
KX196229_PreC_P-D      atgcaactttttgacctctgccta---atcatcttttgttcatgtcccac
KC875340_PreC_P-D      atgcaactttttgacctctgccta---atcatcttttgttcatgtcctac
KC875341_PreC_P-D      atgcaactttttgacctctgccta---atcatcttttgttcatgtcccac
KM524340_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
GQ205389_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
GQ205382_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF618342_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU668433_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU668435_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524345_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ205384_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
JN664926_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
KP857047_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ236015_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KJ647353_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85254_PreC_P-D        atgcgactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097632_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724224_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097684_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU668434_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JN688679_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724227_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724228_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724229_PreC_P-D      atgcaactttttcacctctgccta---atcatctnttgttcatgtcctac
FJ349214_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349211_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ486025_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85264_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097696_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
KF192830_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF192831_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF192832_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF192834_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664909_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN688722_PreC_P-D      atgtaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724232_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724225_PreC_P-D      atgcaactttttgacctctgccta---atcatctcttgttcatgtcctac
MT448619_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724242_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724226_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN310711_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601286_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097760_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724233_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU594434_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN310709_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU155895_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85301_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X65258_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JN664910_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU155893_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524356_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664947_PreC_P-D      atggaactttttcacctctgccta---atcatcttttgttcatgtcctac
EU185779_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgtgcttgtcccac
KJ843187_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JX470760_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC012652_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX827292_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK618441_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AJ131956_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK618443_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JX898689_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JX898691_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JX898692_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JX898694_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JX898697_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU414057_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU414143_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85318_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ922001_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ922002_PreC_P-D      atgcaactttttcacctttgccta---atcatyttttgttcatgtcctac
DQ336692_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ336688_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598658_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857110_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875326_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875330_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875328_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ464170_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257181_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724249_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724250_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097789_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN507852_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664912_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ236016_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875329_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196235_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP090178_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP090177_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724219_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724218_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU668447_PreC_P-D      atgcaactttttcacctcagctta---atcatttcttgttcatgtcctac
MH724214_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724221_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP090179_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ236014_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097809_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN310714_PreC_P-D      atgcaaytttttcacctctgccta---atcatctcttgttcatgtcctac
KM606745_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875331_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349209_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ464168_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AM422939_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY230114_PreC_P-D      -------tttttcacttctgccta---atcatctcttgttcatgtcctac
KU668444_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349232_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875317_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KX196222_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KX196234_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KU668436_PreC_P-D      atgcaacttttttcagcaagatta---atcatctcttgttcatgtcctac
MN310715_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP090181_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875333_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875324_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875315_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875314_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ464169_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875337_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196220_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196232_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875335_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196218_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196230_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875334_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196221_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196233_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF618343_PreC_P-D      acgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY230112_PreC_P-D      -------tttttcacctctgccta---atcatctcttgttcatgtcctac
KU668441_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU668439_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ205388_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664911_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664913_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664917_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664937_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524349_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524350_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU668438_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU668446_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
LC705462_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF618339_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF618340_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF618341_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
V01460_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ315776_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601275_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
LT992438_PreC_P-D      atgyaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875322_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875323_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196224_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196225_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875320_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196217_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875318_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN310708_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN310713_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ692506_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ692507_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP090180_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU668437_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875325_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875316_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875313_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875319_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875321_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875332_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875336_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196216_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196219_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196231_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664938_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857013_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097842_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgtttatgtcctac
MZ097800_PreC_P-D      atgcacctttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097828_PreC_P-D      atgcaactttttcacctctgccta---atcacctcttgttcatgtcctac
MZ097831_PreC_P-D      atgcaactttttcacctctgccta---atcacctcttgttcatgtcctac
MZ097685_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097641_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF419539_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X80928_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X97849_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X80927_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601276_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601328_PreC_P-D      atgtaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097794_PreC_P-D      atgtaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097654_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097683_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097844_PreC_P-D      atgcaactttttcacctctgccta---atcatctcctgttcatgtcctac
MZ097751_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601263_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097744_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601293_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601273_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097749_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097668_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601333_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601281_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097755_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF419529_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097655_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097708_PreC_P-D      atgcaactttttcacctctgccta---atcatcccttgttcatgtcctac
JF754597_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601253_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097737_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097714_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754621_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097710_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097829_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097651_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601316_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097781_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF419532_PreC_P-D      attcgactttttcacctctgccta---atcatctcttgttcatgtcctac
AY796031_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601271_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097748_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X97848_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097872_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349208_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT749827_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097633_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ687530_PreC_P-D      atgcaattttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349205_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT749828_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ477455_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601246_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097729_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349206_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT749821_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ477457_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF419526_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU414059_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU414139_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598660_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598661_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097847_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097659_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097672_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
X72702_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097697_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097627_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcgtgtcctac
AB048701_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601323_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097784_PreC_P-D      atgcaactwtttcacctctgccta---atcatctcttgttcatgtcctac
GQ922003_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ922005_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KJ470895_PreC_P-D      atgcaactttttcacccttgccta---atcatctcttgttcatgtcctac
GQ922004_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KJ470893_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KJ470896_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KJ470894_PreC_P-D      atgcaactttttcacccttgccta---atcatctcttgttcatgtcctac
MH724251_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KJ470885_PreC_P-D      aggcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KJ470889_PreC_P-D      aggcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HQ700458_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606754_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AJ627219_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606755_PreC_P-D      atgcaactttttcacctctgccta---atcatatgttgttcatgtcctac
KM606664_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
KM606670_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606698_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601314_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606675_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606645_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ692532_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ692533_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606682_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606654_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606690_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606686_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606697_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606644_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606744_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606752_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ927384_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP168419_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904410_PreC_P-D      ttgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX357622_PreC_P-D      atgcaactttttcacctctgccta---atcacctcttgttcatgtcctac
MN476100_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904395_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904419_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904422_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097884_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX276856_PreC_P-D      atgcaactttttcamctctgccta---atcatctcttgttcatgtcctac
MT114173_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN688695_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX276857_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664941_PreC_P-D      atgcaactttttcacctctgccta---atcatctattgttcatgtcctac
AB109478_PreC_P-D      atgcacctttttcacctctgccta---atcatctcttgttcatgtcctac
KU668448_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707704_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707702_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707696_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707695_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707689_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707682_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707683_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707684_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707685_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707687_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707688_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707690_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707691_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707692_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707693_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707694_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707697_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707698_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707699_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707700_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707701_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707703_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707705_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707706_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707686_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
AB119255_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598664_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB119253_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB109479_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB119251_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB109477_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB110075_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB119252_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB120308_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB119254_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524358_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF925379_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097859_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097873_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ924652_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB119256_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HM042266_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
AY090453_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF925390_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664931_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664939_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524344_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN839643_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707497_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK618423_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK618425_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK618424_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK618434_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707518_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK618435_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707529_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707521_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707514_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707483_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707486_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707512_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707519_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707520_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707522_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707523_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707525_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707527_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707513_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707515_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707516_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707517_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707524_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707526_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707528_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707530_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MK618436_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707504_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707498_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707509_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707510_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707506_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707491_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707484_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707502_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707500_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707489_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707481_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707485_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707487_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707490_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707494_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707496_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707507_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707476_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707478_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707479_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707482_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707488_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707499_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707503_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707505_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707508_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707480_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707511_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707501_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JQ707477_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707492_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707495_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JQ707493_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KU668442_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF798281_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF925383_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HM042267_PreC_P-D      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
GQ183484_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183479_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH932714_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT151620_PreC_P-D      atgcamctttttcacctctgccta---atcatctcttgttcatgtcctac
KF798301_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK516278_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875312_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183473_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF679994_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF679996_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598663_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF679998_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366491_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT114172_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183475_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601270_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF679997_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664918_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183474_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183472_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF798299_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366493_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366496_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524354_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664927_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
GQ183471_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183477_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF925363_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366494_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
JN664930_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524341_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF925364_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF925393_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183481_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524355_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB267090_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB109476_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB090268_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB210821_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB210822_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB078031_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB078032_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB078033_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB109475_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB116266_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875310_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB090269_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB090270_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875311_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB205126_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB471856_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB471857_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN507839_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU668449_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF618348_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU668445_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366501_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524347_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664928_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF798273_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF679995_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KR905423_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MF925358_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366511_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524346_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF798307_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366465_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183482_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183483_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KR905424_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366506_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ040872_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524353_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598665_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366510_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366495_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183476_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524351_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366509_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524352_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN688712_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM577669_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgatcatgtcctac
MG877719_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG877718_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG877720_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ904433_PreC_C-D      atacaactttttcacctctgccta---atcatctcttgttcatgtcccac
MH464838_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK541688_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
MZ097864_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MT591281_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KF679990_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN688683_PreC_P-D      acgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642162_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85263_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM577668_PreC_P-D      atgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
JN642148_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU921419_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601295_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU921418_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85255_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcacgtcctac
KP857046_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097882_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097802_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724235_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724237_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU736927_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601290_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097752_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB355456_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB355452_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB493846_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN688685_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85261_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU939680_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH464840_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH464844_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtccyac
AY233296_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH464836_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233292_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY233294_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH464834_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgtwcatgtcccac
KT347090_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM519455_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY233291_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH464854_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85260_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KU736926_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601257_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097739_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU414055_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU414142_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC774437_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MW601324_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601242_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097725_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK507912_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF419540_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF419542_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598657_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183478_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598655_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF679989_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU414056_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU414141_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ183485_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598651_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601334_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097805_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU594382_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724215_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724220_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF679992_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF679993_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF798282_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF798306_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366497_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT366507_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ562338_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
HM750151_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X65257_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664922_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664948_PreC_P-D      gtgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN664919_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JN664921_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097642_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ315778_PreC_P-D      ctgcaactttttcacctctgcctg---atcatctcttgttcatgtcctac
MZ097664_PreC_P-D      ctgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726858_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754629_PreC_P-D      attcgactttttcacctctgccta---atcacctcttgttcatgtcctac
MZ097863_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726901_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097815_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MW601318_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097782_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642140_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601249_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MZ097733_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KP856993_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726897_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097686_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF584160_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
JF754611_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491156_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097832_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097701_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP856977_PreC_P-D      atgcaactttttcacctctgccta---atcatctcctgttcatgccctac
KP856997_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097824_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857117_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257162_PreC_P-D      atgcaactttttcmcctctgccta---ktcatctcttgttcatgtcctac
KT749823_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726929_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857049_PreC_P-D      atgcgactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601306_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257183_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601294_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097765_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642161_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642154_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642157_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674430_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY741798_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF584078_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcgtgtcctac
GU456636_PreC_P-D      atgcaacattttcacctctgccta---atcatctcttgttcatgtcctac
MZ097812_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471655_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097772_PreC_P-D      attcgactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674431_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097647_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP856986_PreC_P-D      atgcaactttttcacctctgccta---atcacctcttgttcatgtcctac
KP856976_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097787_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642149_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP856978_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097816_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP856984_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097817_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456652_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040818_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642142_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040819_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456637_PreC_P-D      ctgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456655_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857050_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754610_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097827_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857030_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726881_PreC_P-D      atgtaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097650_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726977_PreC_P-D      atgcaacttcttcacctctgccta---atcatctcttgttcatgtcctac
MW601291_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097763_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KT963508_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097671_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754595_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040796_PreC_P-D      atgcatctttttcacctctgccta---atcatctcttgttcatgtcctac
JN257202_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456650_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456640_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726893_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB270546_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601229_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097718_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601312_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097778_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726849_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
JN040824_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
MW601289_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097762_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC774459_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC774440_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KC774444_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MH725140_PreC_P-D      atgcgactttttcacctctgccta---atcatctcttgttcatgtcctac
LT992444_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349231_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040797_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097845_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040814_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674425_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
JN040795_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857051_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040820_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257205_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456638_PreC_P-D      atgtaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85308_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85259_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85299_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85297_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X85298_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857053_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642145_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF584099_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
GU456648_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257187_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257188_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726947_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040799_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726945_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754601_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257148_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601326_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097791_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257169_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601256_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097738_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097852_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471649_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097797_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ386590_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU414054_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU414135_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ377589_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF280817_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN507838_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB270543_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726946_PreC_P-D      atgcacctttttcacctctgccta---atcatctcttgttcatgtcctac
AY796030_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456641_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040813_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040809_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875301_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KC875302_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KC875299_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875303_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK598647_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875291_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KX196210_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KX196213_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KC875286_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875306_PreC_P-D      acgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875283_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875275_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875281_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875305_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875284_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KC875287_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875300_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KX196226_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KC875307_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097821_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754633_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257201_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097756_PreC_P-D      atgcaactttttcacctctgccta---atsatctcttgttcatgtcctac
MH724252_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ349233_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726919_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY741797_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
KC875290_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KX196209_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KX196212_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JN257186_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257152_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF584163_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KF584165_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MN310705_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KF584161_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KY382412_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN507853_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KY382414_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF584164_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KF584166_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
KF584162_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MZ097702_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754608_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875296_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196228_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875298_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040806_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726845_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB104712_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040827_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875289_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040828_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875304_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KP857097_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257203_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601261_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097741_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726924_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726935_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491181_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040808_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257155_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257196_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257199_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
OK106256_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MZ097666_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK618437_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM524339_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875308_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371920_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB222713_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875295_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KX196227_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KC875276_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KX196214_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KC875309_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875279_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875277_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875280_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875282_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196215_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875278_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601282_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK618433_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK618431_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK618429_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671699_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471647_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875294_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JN040805_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754591_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ477459_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726931_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471651_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471652_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875288_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196208_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KX196211_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875285_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875293_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040807_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK618430_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK618432_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371902_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371914_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371921_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY721612_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EF103277_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726898_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040826_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097669_PreC_P-D      atgcaactttttcacctctgccta---atcaccttttgttcatgtcctac
L27106_PreC_P-D        atgcaactttttcacctctgccta---atcatctcgtgttcatgtcctac
AJ627215_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AJ627216_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AJ627218_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097657_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097866_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456639_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726975_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097871_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471640_PreC_P-D      ctgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726855_PreC_P-D      acgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097835_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601259_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601272_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601237_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097722_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601238_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601311_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097803_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601231_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601305_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601329_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456642_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456644_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674428_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
MZ097675_PreC_P-D      ctgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
MN585094_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097837_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754630_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754603_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674435_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP856975_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601321_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671700_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857006_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040811_PreC_P-D      atgcaactttttcacctctgccta---atcatctattgttcatgtcctac
GU456665_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097670_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371906_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040800_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040801_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456643_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726951_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601265_PreC_P-D      atgcacctttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097746_PreC_P-D      atgcacctttttcacctctgccta---atcatctcttgttcatgtcctac
MW601336_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097807_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040812_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040804_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726970_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040829_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456646_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KC875292_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726921_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726922_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097630_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491191_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456645_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040802_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456649_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726925_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040810_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726856_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726857_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726963_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371918_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726911_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ868005_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ868011_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ868009_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867998_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371911_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ868012_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371908_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867970_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867983_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867957_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867963_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ868013_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ868004_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867999_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867996_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867981_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867968_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867972_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY161159_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY161160_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY373431_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867984_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867982_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867964_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867973_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867974_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867975_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867979_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ868010_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867966_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867965_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867977_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ867953_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097799_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
AB674424_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
KP856996_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
MZ097700_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
AB674427_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
JF754632_PreC_P-D      ctgcgactttttcacctctgccta---atcaccttttgttcatgtcctac
MZ097699_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097846_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
KP857005_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097818_PreC_P-D      ttgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097709_PreC_P-D      ctgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
MZ097645_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
DQ399006_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH724236_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097808_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JF754602_PreC_P-D      ctgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
AB674413_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097678_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674423_PreC_P-D      atgcaactttttcacctctgccta---atcaccttttgttcatgtcctac
KP857000_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
MW601332_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857007_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
MZ097689_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
JF754607_PreC_P-D      atacaactttttcacctctgccta---atcatcttttgttcatgtcctac
GU456647_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097695_PreC_P-D      ctgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
EU726880_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601337_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857004_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AB674429_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
KP857003_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
AY371917_PreC_P-D      atgcaactttttcacctctgccta---atcatttcatgttcatgtcctac
MW601315_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcacgtcctac
MZ097780_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcacgtcctac
KF018187_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF018189_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257149_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601269_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857094_PreC_P-D      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
MW601248_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097732_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097649_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097840_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AF151735_PreC_P-D      atgcaactttttcacctctgccta---atcatttcatgttcatgtcctac
JN040817_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040815_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040816_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857045_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097834_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601302_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097774_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ178017_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MW601251_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
MZ097735_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
FJ349235_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
DQ178012_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ178011_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ178015_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371912_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ178019_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY350614_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371901_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371905_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371922_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
X02496_PreC_P-D        atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ178016_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ178018_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
DQ178020_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857008_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
JF754596_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
AB674426_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
MZ097681_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
AY661792_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
AY661793_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
MK618427_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
KP857099_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
Y07587_PreC_P-D        atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
KP857100_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
MZ097839_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
MK618428_PreC_P-D      atgcaactttttcacctctgccta---atcatcttttgttcatgtcctac
GU456674_PreC_P-D      atgcaacattttcacctctgccta---atcatctcttgttcatgtcctac
EU726973_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857029_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097660_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN844882_PreC_P-D      attcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257214_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257215_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726933_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456669_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456666_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040769_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097836_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040782_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726938_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097785_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726932_PreC_P-D      atgcaactttttcacctctgccta---atcacctcttgttcatgtcctac
EU726904_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040775_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726892_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471642_PreC_P-D      atacgactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040768_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040762_PreC_P-D      atgtaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456658_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642129_PreC_P-D      ttgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726859_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726954_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040770_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491146_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857116_PreC_P-D      ctgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MZ097833_PreC_P-D      ctgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471659_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY371910_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726860_PreC_P-D      acgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456667_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491143_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471641_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726950_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471654_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726886_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MG491148_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456670_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726865_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471645_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726873_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040767_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GU456671_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN642155_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY741795_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY741796_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY741794_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671695_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040822_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671692_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttggtcttgttctac
KF471653_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF471657_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726930_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726940_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH725152_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671697_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671684_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040758_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726937_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK355500_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MK693108_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671691_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671696_PreC_P-D      atgcaactttctcacctctgccta---atcatctcttgttcatgtcctac
KP671686_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671693_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671694_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671688_PreC_P-D      atgcaactttttcacctgtgccta---atcatctcttgttcatgtcctac
MK693109_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671690_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN257151_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726971_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726972_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726894_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726902_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726895_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726854_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726869_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726888_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726887_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
EU726976_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
JN040759_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671685_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP671687_PreC_P-D      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
                                                                         

AB555500_PreC_P-D      tggaatagcctccaagttgtgccttgggtggctttagggcaaggaccttg
MG877726_PreC_P-D      kgttcaagcctccaagctgtgccttgggkggytttaggacatggacattg
MG877727_PreC_P-D      kgttcaagcctccaagctgtgccttgggkggytttaggacatggacattg
MG877728_PreC_P-D      kgttcaagcctccaagctgtgccttgggkggytttaggacatggacattg
MW601320_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
FJ904439_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097636_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097644_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JX036342_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JX036343_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JX036344_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097662_PreC_P-D      ttttcaagcctccgagctgtgccttgggtggctttaggacatggacattg
JN040766_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatag
MZ097880_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacctcg
AB674416_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725171_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB674415_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG491172_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097798_PreC_P-D      tkttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
MW601338_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491159_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JF754612_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754594_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754617_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
EU726891_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040773_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097713_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AB330367_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JF754609_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggatattg
MZ097730_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatyg
GU456677_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
MZ097698_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JN642135_PreC_P-D      tgttcaagcctccaagttgtgccttgggtggctttagggcatggacatcg
JN642128_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857028_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097874_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttg
GU456679_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754622_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726979_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JF754626_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH725153_PreC_P-D      tgttcaagcctccaagctgggccttgggtggctttggggcatggacattg
JN257165_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
JN257166_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KF018181_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttg
MG491126_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857031_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH725126_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257153_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN257195_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GU456657_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ904426_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
EU726884_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK355501_PreC_P-D      tgttcaagcctccaagttgtgccttgggtggctttagggcatggacattg
GU456651_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MG491158_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097692_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097691_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857032_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP857018_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN257176_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN257177_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
X85278_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601299_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097770_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601245_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097728_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097637_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ904438_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097665_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097631_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH724978_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF754600_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB270541_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB104710_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MT114169_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MH725199_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggaacttg
MH725189_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601288_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725135_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726952_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040774_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP857024_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB270542_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097682_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857039_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
KF018177_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642146_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ904429_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
X80924_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
X80926_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY371909_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ167302_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
GQ167301_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ184322_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggcttaaggacatggacattg
MZ097653_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097638_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097629_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601331_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP857019_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ486023_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
AB270540_PreC_P-D      tgttcaagcctctaagctgtgccttgggtggctttaggacatggacattg
MZ097711_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JF754619_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggayatyg
GU456664_PreC_P-D      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacattg
MZ097843_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642136_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
HQ833466_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456682_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG491188_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097693_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725068_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN642147_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GU456654_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG491187_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MG491162_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG491155_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MG491149_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY236162_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ304550_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ304551_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ304547_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ304548_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ304549_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT731871_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ904402_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X59795_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040772_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040771_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491183_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097795_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040830_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
HQ700439_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
FJ904446_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491147_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB674417_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB674418_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ336680_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
DQ336682_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
DQ336684_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
DQ336681_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
DQ336683_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097661_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JN257172_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN257173_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754593_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JF754592_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726912_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB674410_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456678_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP857033_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097830_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601279_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097753_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456656_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ904431_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KF018182_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN257160_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN257161_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GU456675_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ205385_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491173_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG491186_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601239_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097723_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097801_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttg
MZ097676_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097639_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857037_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ477458_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726944_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040776_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ904399_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601298_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097769_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726941_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726875_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ904445_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726969_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB270550_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY629634_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KP857022_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097823_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP857025_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642164_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726868_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040779_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AJ627224_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601304_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggcttttggacatggacattg
JN642156_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JF754634_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggatattg
GU456673_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GU456659_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754604_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EF103281_PreC_P-D      tggtccaacctcccagctgtgccttgggtggctttgggggatggacattg
JF754631_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857017_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857015_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857016_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601278_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MW601258_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ687531_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642167_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754635_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491170_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601250_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097734_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
X85277_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097677_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH725202_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724970_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KP857114_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040781_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HQ700463_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ904418_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY796032_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AB674419_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097870_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097635_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754590_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726850_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MW601247_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097731_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726885_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040755_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097881_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097646_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY629633_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857115_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU456672_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857021_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU787438_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726848_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857038_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097825_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
HQ700472_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB674404_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
HQ700467_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
HQ700455_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN687947_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700478_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HQ700553_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HQ700481_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HQ700474_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725086_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700468_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
HQ700470_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700489_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggrcatggacattg
HQ700473_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB222712_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598643_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700444_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700483_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700448_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700477_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700480_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700449_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700469_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700479_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700484_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700440_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700441_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700445_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700446_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700447_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700450_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700451_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700454_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700459_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700464_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700466_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700471_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700482_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700487_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700488_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700442_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700443_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097786_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097707_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642158_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726864_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH725096_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725110_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725118_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725097_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725172_PreC_P-D      tgttcaagccttccagctgtgccttgggtggctttggggcatggaccttg
MH724959_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
EU726906_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ464182_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AY371913_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097634_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH725139_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
EU787439_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF419522_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB270549_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
X85273_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097868_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097705_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH725094_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF618349_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP857034_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN257159_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456681_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ904427_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097878_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097673_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601285_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097759_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601267_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601244_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097727_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857035_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456684_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
AY371904_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF419530_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB674403_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601325_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097790_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601322_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097783_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857109_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JN642150_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040821_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040752_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AY371915_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939681_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ899792_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491144_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097811_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097674_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601339_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MH724962_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601283_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097757_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097856_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB674420_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040778_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097810_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
MH725144_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JN642153_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040777_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ904424_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726908_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726847_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG491174_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097643_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642166_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP995100_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040780_PreC_P-D      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU456676_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GU456668_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH725123_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcaagggcattg
JN642133_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN257170_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040765_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB674408_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MH725088_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JN040761_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ349220_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601307_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097775_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097875_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH725054_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724960_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724969_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040753_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ904432_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY371916_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AJ344116_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726957_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP857040_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MT731880_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MT591279_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MT591277_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF471658_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF018195_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040750_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY721605_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601262_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097742_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AB716760_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcttggtcatgg
HE805987_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcttggtcatgg
MZ097768_PreC_P-D      tgttcaagcctccaagctgtgccttgkgtggctttggggcatggacattg
M32138_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP857023_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF018185_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040754_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726926_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726910_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726872_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726965_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040757_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB674405_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatyg
HM042272_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HM042273_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HM042283_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287601_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287602_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287604_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287605_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287607_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287608_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287609_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287610_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287611_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287612_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287615_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287617_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287618_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287620_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287621_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ183449_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183464_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183463_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183459_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183458_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183457_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183460_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183461_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183469_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183450_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183451_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183452_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183453_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183454_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183455_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183456_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183462_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183465_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183466_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183467_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183468_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183448_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097796_PreC_P-D      wgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097688_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097625_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642151_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754588_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ904415_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642126_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JN642130_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601303_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KF471644_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456663_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY161158_PreC_P-D      tgtttaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725031_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MH725033_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JN040792_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040791_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040793_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097876_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456660_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB222710_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097861_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097690_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601232_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MH725087_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857036_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857026_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KM524338_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF061167_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN642132_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN257211_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN257179_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040784_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754614_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ562309_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724965_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MH724966_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MH725125_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM524348_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF471660_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726861_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097658_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MW601335_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725077_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857020_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF018192_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY161150_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY161151_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY161152_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY161153_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY161154_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY161155_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY161156_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287619_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MN507836_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW455166_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF170739_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH725198_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggttttggggcatggacattg
MH725079_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724980_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctgtggggcatggacattg
MH725047_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725134_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725169_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725133_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725057_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725046_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725053_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725055_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725056_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725052_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724995_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724985_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724977_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725064_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725065_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725080_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725081_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724961_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724971_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725208_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725182_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725174_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725101_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725090_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725016_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724973_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725181_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725083_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724997_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725191_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725175_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725211_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725206_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725205_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725193_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725184_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725180_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725176_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725164_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725148_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcgtggacattg
MH725136_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725115_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725085_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724991_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724989_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724976_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724987_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725158_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724979_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725183_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725203_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724954_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724981_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724983_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724986_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725007_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725015_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725131_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725154_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725155_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725166_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725188_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725190_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725195_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724958_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724992_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU456683_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN132132_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN132130_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN558561_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN132131_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT591278_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KF471646_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC774477_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JN642138_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JF754606_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ349219_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726876_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726844_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ111986_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF419516_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF419524_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601297_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725018_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726943_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB674411_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG491177_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097860_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
MZ097771_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
MH725194_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725012_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX827291_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF754627_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456680_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726905_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB270547_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726961_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040783_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726907_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726909_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601300_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KF061169_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggrcatggacattg
JN642165_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642134_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN257182_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF754598_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726879_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MH725124_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725168_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725089_PreC_P-D      tgttcaagcctccaagccgtgccttgggtggctttggggcatggacattg
MH725036_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725075_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725084_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725107_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725004_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ904420_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
FJ904421_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH724996_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KF471650_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040751_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH724999_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726917_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN132127_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ641710_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN132128_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598646_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749855_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726899_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725045_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725050_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725109_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU456653_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU787443_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JF754599_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754623_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH725119_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725120_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725132_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725008_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF061170_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN558562_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257163_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HQ833467_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU456662_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456661_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ349230_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ349228_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ349215_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726853_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EF103279_PreC_P-D      tgtccggacctccaagctgtgccttgggtggctttggggcatggacattg
AY721609_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY161157_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacactg
MH725071_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725072_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB674406_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HQ833469_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725098_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725099_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725100_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725103_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725127_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725165_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725162_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725160_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725093_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725091_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725092_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725104_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725163_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X85302_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725173_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725011_PreC_P-D      tgttcaagcctcccagctgtgccttgggtggctttggggcatggacattg
KP671698_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ904412_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF121239_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB222709_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH725030_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725025_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725032_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725082_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725106_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725029_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725095_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725005_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724990_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257200_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH725150_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725147_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725151_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725186_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725149_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725187_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725146_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725210_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725159_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725128_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725129_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774445_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601252_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097736_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601309_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725207_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724956_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857106_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724955_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF925391_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF018190_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ349217_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414136_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598645_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725102_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X85295_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725209_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725201_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725108_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725061_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725014_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724972_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LK995390_PreC_P-D      tgttcaagcctccaagctgtgccttgagtggctttggggcatggacattg
KP857027_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754624_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ183470_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ349216_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726874_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB126581_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601280_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097754_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU357846_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MN507851_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725113_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725130_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725111_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491137_PreC_P-D      tgctcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724988_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724993_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724994_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725167_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097743_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725112_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB270548_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725177_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HM750155_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HM750156_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726958_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY371919_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MT591276_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
X85303_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X85304_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725204_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF018191_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KC774462_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ349229_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF018194_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725161_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725063_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ349234_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN558563_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN558564_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN132126_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY721611_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF121242_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC875297_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196236_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725069_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725058_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725060_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725062_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725137_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725078_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601243_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097726_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM606753_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097788_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH725022_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725157_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491167_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG491138_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097849_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097679_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601319_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725076_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724974_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724967_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857107_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM524342_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF471656_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF061168_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggrcatggacattg
JN040823_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JN040794_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040788_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040785_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040756_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF754618_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF754615_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754605_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HQ833468_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HM750152_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU787446_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU787436_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726960_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EF103275_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY721608_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY721607_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB188244_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725066_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725067_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB104709_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB104711_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725196_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725197_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097820_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725019_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725006_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724968_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X85294_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724982_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ205380_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257209_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726959_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598649_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598650_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491136_PreC_P-D      tgttcaagcctccaagctgtgcctcgggtggctttggggcatggacattg
MG491134_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097813_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097648_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097640_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MN585095_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598648_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598644_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK507914_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725185_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725156_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725142_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725105_PreC_P-D      tgttcaagcctctaagctgtgccttgggtggctttggggcatggacattg
MH725028_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725001_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724998_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724984_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY629630_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX827300_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT366499_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857105_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857104_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP322599_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF018180_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JN257171_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040790_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040786_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ183480_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ904443_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU919197_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726967_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726964_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EF103280_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY721610_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY721606_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ287603_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287606_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287613_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287614_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ287616_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726900_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726914_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726918_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF121240_PreC_C-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF121241_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY371907_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB246347_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT366498_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT366500_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT366502_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601313_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598641_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491169_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491127_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491168_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP671689_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598639_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598637_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594396_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726962_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598636_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598640_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB222711_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724975_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725002_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491192_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491190_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491157_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491161_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491165_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097858_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097848_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097841_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK693107_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598642_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598638_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK507911_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725178_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725138_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725048_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725041_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725035_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725034_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725026_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725023_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724964_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC365689_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP322600_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF798260_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF018184_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN642131_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257185_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257150_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF754628_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ833470_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ833465_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HM750154_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU787447_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU787442_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU787441_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU787440_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726878_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EF103276_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY945307_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB583680_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725117_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725121_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725049_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725051_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725179_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725037_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725040_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725027_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725116_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725122_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725170_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725013_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725070_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725003_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725009_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725017_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725039_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725044_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725073_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725143_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF798283_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT366508_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257193_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257194_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU787437_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU787445_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HM750153_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ833471_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK507910_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK507913_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726923_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725145_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB246348_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594397_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726862_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724963_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725059_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725074_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601292_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097764_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB674407_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM577670_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ904435_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097865_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097715_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JN642144_PreC_P-D      tgttcaagcctccaagttgtgccttgagtggctttaggacatggacattg
GQ477453_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601255_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
MN844881_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KJ647350_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601268_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097867_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
GQ477456_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KJ647352_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097857_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB188241_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857041_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MW601308_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097776_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP857048_PreC_P-D      tgttcaagcctccaagctgtgccttgagtggctttaggacatggacattg
AB555496_PreC_P-D      tgttcaagcctccaagttgtgccttgggtggctttagggcatggaccttg
AB210820_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726871_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AJ627222_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatyg
MZ097779_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatyg
MZ097624_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097877_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097819_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JN642163_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097712_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM577671_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JN257190_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP856990_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JN257178_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
MZ097704_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MH724238_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642159_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttg
GQ477454_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097851_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP856989_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097626_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MT603389_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MN310706_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KX260231_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MN310707_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601274_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggaccttg
MZ097750_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggaccttg
MT603392_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097792_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AB555501_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP856981_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MT603390_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MT603391_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MT603404_PreC_P-D      tgttcaagcctccaagctgtgacttgaacggatatgatgcatggacattg
JN792911_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN792912_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN792904_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MT603393_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601236_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN642143_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttg
AF419538_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MT603387_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MT603388_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MH724241_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
GQ477452_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097853_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AF419537_PreC_P-D      tgttcaagcctccaagctgtgccttaggtggctttagggcatggacatcg
AB555497_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601228_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
EU594404_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AF419512_PreC_P-D      tgttcaagcctccaagctgtgccttaggtggctttaggacatggacattg
GU456635_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601301_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097773_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MT603394_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT603395_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB270539_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097628_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
LT992439_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664936_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AF043593_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MK598679_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MK598678_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MK598676_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AF043594_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MK598677_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JN792905_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN792906_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MT579901_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
HQ700510_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX357637_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX357638_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU736924_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU736925_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX357639_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
X85279_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP857043_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU594398_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MK598674_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN792908_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MT603397_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MT603398_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MT603383_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MT603384_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MT603396_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
JN792907_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT603399_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN792903_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN792909_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN792910_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT603385_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT603401_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT603402_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT603403_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT603400_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097663_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097883_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097717_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MW601330_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB188242_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774436_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC774460_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598670_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ349218_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB205127_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598659_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF922432_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594426_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY603445_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
AY603433_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KP857111_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664914_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
HQ700512_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700513_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700514_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LT992454_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700511_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AJ627223_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AJ627220_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598662_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MN507837_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP322601_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598668_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT579899_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097855_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724247_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724246_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB205128_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414061_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
EU414138_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MH724244_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT579903_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
MH724216_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594411_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594412_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MT579900_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MT579898_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT579902_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB330369_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB330370_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603427_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594399_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603439_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX827290_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX827301_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603443_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594430_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594433_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX096954_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX096957_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594425_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594424_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724231_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724217_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724223_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414058_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618426_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594422_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
Z35716_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MK618419_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594415_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MK598669_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MK598673_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MK598666_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JX096958_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594421_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MW601266_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MZ097747_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594400_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594401_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594402_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594403_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594405_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594409_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594410_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594416_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594431_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594432_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MK598671_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MK618422_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594407_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU594427_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MK618421_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
AY603434_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JX096955_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603440_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603437_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598667_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598672_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414060_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414140_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594423_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594428_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX096956_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598675_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618420_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603428_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594408_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618418_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664924_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097656_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ922000_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
X85276_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
JN688713_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MW601287_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097761_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
X85268_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatta
MW601327_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097793_PreC_P-D      tgktcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MK052973_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK052975_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK052974_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK052963_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK052966_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK052971_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK052954_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK052959_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK052953_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK052958_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK052955_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK052950_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK052956_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK052948_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK052949_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK052961_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK052951_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK052960_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK052972_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK052947_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK052952_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY090452_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MF925366_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF419527_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
KT749845_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601233_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601234_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097720_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN688710_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
JN664920_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KJ647355_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN688711_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AF419528_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097804_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
MH724248_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggaccttg
MZ097869_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH724245_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601240_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggaccttg
MH724234_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JN688708_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097879_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN664932_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ464181_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
X85270_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MN310710_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
FJ349213_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ464173_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ329356_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ464175_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ464172_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ329357_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ336690_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ464178_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ464174_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ486021_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggcttagggacatggacattg
DQ336686_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY236164_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ486022_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ336689_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ464176_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ336687_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ336685_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ336677_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ336674_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY236160_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ336675_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ336676_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ336678_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ336679_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ464177_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JF754625_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF419521_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MH724230_PreC_P-D      tgttcaaaccttccaactgtgccttgggtgggtttggggcatggaccttt
JN688678_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB270537_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KM524361_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF488704_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857042_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MG877709_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
MG877710_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
X85280_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097694_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AF419523_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
X85269_PreC_P-D        tgttcaagcctccaagctgtgccttgagtggctttaggacatggacattg
MN310712_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KC875342_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196229_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875340_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875341_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KM524340_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ205389_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ205382_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MF618342_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KU668433_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KU668435_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KM524345_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ205384_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664926_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857047_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
HQ236015_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttg
KJ647353_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
X85254_PreC_P-D        tgttcaagcctctaagctgtgccttaggtggctttagggcatggacattg
MZ097632_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH724224_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattt
MZ097684_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU668434_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN688679_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MH724227_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724228_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724229_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ349214_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ349211_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
DQ486025_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
X85264_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097696_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KF192830_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KF192831_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KF192832_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KF192834_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JN664909_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JN688722_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724232_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MH724225_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT448619_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
MH724242_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH724226_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttngggcatggacattg
MN310711_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MW601286_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097760_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724233_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU594434_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MN310709_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU155895_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
X85301_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X65258_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664910_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU155893_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM524356_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664947_PreC_P-D      tgttcaagtctccaagctgtgccttgggtggctttggggcatggacattg
EU185779_PreC_P-D      tggtaaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KJ843187_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JX470760_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KC012652_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KX827292_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MK618441_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
AJ131956_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MK618443_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JX898689_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JX898691_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JX898692_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JX898694_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JX898697_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU414057_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414143_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X85318_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ922001_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ922002_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ336692_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
DQ336688_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MK598658_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857110_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875326_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875330_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875328_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ464170_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JN257181_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MH724249_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MH724250_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097789_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MN507852_PreC_P-D      tgttcaagcctccaacctgtgccttgggtggctttggggcatggacattg
JN664912_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
HQ236016_PreC_P-D      tgttcaagcctccaggctgtgccttgggtggctttggggcatggacattg
KC875329_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196235_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP090178_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP090177_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724219_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724218_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668447_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MH724214_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724221_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP090179_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ236014_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097809_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MN310714_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606745_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875331_PreC_P-D      tgttcaagcgtccaagctgtgccttgggtggctttggggcatggacattg
FJ349209_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ464168_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
AM422939_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
AY230114_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KU668444_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
FJ349232_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875317_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196222_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196234_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668436_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MN310715_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP090181_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875333_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875324_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875315_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875314_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ464169_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KC875337_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196220_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196232_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875335_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196218_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196230_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875334_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196221_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196233_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF618343_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
AY230112_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KU668441_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KU668439_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
GQ205388_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JN664911_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JN664913_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JN664917_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JN664937_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KM524349_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KM524350_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KU668438_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KU668446_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
LC705462_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MF618339_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MF618340_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MF618341_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
V01460_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
DQ315776_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatagacatcg
MW601275_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LT992438_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875322_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875323_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196224_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196225_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875320_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196217_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875318_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MN310708_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MN310713_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692506_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692507_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP090180_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668437_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcagggacattg
KC875325_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875316_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875313_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875319_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875321_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875332_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875336_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196216_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196219_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196231_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664938_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857013_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacmttg
MZ097842_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggaccttg
MZ097800_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097828_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
MZ097831_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
MZ097685_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097641_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggayattg
AF419539_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggtcatggacgttg
X80928_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
X97849_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
X80927_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601276_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601328_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
MZ097794_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
MZ097654_PreC_P-D      tgttcaagcctccaagctgtgccttaggtggctttgggacatggacatcg
MZ097683_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097844_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097751_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601263_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097744_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601293_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601273_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097749_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097668_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601333_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601281_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097755_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AF419529_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttg
MZ097655_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097708_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JF754597_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601253_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097737_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097714_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JF754621_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097710_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097829_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097651_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601316_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097781_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF419532_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggatattg
AY796031_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MW601271_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097748_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
X97848_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097872_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ349208_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749827_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097633_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ687530_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
FJ349205_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749828_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ477455_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601246_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097729_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ349206_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KT749821_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ477457_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF419526_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414059_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414139_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598660_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598661_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097847_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097659_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097672_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X72702_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097697_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097627_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggaccttg
AB048701_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MW601323_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097784_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ922003_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ922005_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KJ470895_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ922004_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ470893_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KJ470896_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
KJ470894_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MH724251_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ470885_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KJ470889_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HQ700458_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KM606754_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AJ627219_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM606755_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM606664_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KM606670_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KM606698_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttg
MW601314_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM606675_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttg
KM606645_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
FJ692532_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692533_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606682_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM606654_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM606690_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM606686_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM606697_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM606644_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM606744_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606752_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ927384_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
KP168419_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
FJ904410_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX357622_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MN476100_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ904395_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ904419_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ904422_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097884_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX276856_PreC_P-D      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacattg
MT114173_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN688695_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX276857_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN664941_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB109478_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668448_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707704_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707702_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707696_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707695_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707689_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707682_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707683_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707684_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707685_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707687_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707688_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707690_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707691_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707692_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707693_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707694_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707697_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707698_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707699_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707700_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707701_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707703_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707705_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707706_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ707686_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AB119255_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598664_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB119253_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB109479_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB119251_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB109477_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB110075_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB119252_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB120308_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB119254_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KM524358_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MF925379_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097859_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097873_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ924652_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB119256_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HM042266_PreC_P-D      tgttcaagcctccaagctgtgcctcgggtggctttaggacatggacattg
AY090453_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF925390_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JN664931_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JN664939_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KM524344_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MN839643_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacctcg
JQ707497_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618423_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618425_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618424_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618434_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707518_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618435_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707529_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707521_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707514_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707483_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707486_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707512_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707519_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707520_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707522_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707523_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707525_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707527_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707513_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707515_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707516_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707517_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707524_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707526_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707528_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707530_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618436_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707504_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707498_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707509_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707510_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707506_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JQ707491_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707484_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707502_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ707500_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707489_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707481_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707485_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707487_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707490_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707494_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707496_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707507_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707476_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707478_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707479_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707482_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707488_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707499_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707503_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707505_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707508_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707480_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707511_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707501_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707477_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707492_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707495_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707493_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668442_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KF798281_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MF925383_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HM042267_PreC_P-D      tgttcaagcctccaagctgtgcctggggtggctttagggcatggacattg
GQ183484_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ183479_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH932714_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT151620_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF798301_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MK516278_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875312_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ183473_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF679994_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF679996_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598663_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF679998_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KT366491_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT114172_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ183475_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601270_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KF679997_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664918_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ183474_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ183472_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF798299_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KT366493_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KT366496_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM524354_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664927_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ183471_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ183477_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF925363_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KT366494_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664930_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM524341_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF925364_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF925393_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ183481_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KM524355_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB267090_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB109476_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB090268_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB210821_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB210822_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB078031_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB078032_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB078033_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB109475_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB116266_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875310_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB090269_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB090270_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875311_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB205126_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB471856_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB471857_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MN507839_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KU668449_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MF618348_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KU668445_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KT366501_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM524347_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664928_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF798273_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF679995_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KR905423_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF925358_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT366511_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM524346_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF798307_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KT366465_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ183482_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
GQ183483_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KR905424_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KT366506_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
FJ040872_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM524353_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598665_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT366510_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT366495_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ183476_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM524351_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT366509_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM524352_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN688712_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
KM577669_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
MG877719_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MG877718_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MG877720_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ904433_PreC_C-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MH464838_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK541688_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097864_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MT591281_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF679990_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN688683_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN642162_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
X85263_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
KM577668_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN642148_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU921419_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601295_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU921418_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
X85255_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP857046_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097882_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097802_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MH724235_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MH724237_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttngggcatggacattg
KU736927_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601290_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097752_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB355456_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB355452_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB493846_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN688685_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
X85261_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
EU939680_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MH464840_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH464844_PreC_P-D      tgttcaagcctccaagctgtgccttggrtggctttggggcatggacattg
AY233296_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MH464836_PreC_P-D      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY233292_PreC_P-D      tgtccaagcctccaagctgtgccttgggtggctttgggacatggacattg
AY233294_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MH464834_PreC_P-D      tkttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT347090_PreC_P-D      tgttcaagcctccaggctgtgccttgggtggctttggggcatggacattg
KM519455_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY233291_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH464854_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X85260_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
KU736926_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601257_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097739_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatyg
EU414055_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
EU414142_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KC774437_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601324_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601242_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097725_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MK507912_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF419540_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF419542_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MK598657_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
GQ183478_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598655_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KF679989_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414056_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414141_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ183485_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598651_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601334_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097805_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594382_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724215_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH724220_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF679992_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF679993_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF798282_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF798306_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT366497_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT366507_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ562338_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HM750151_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X65257_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664922_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664948_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664919_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN664921_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097642_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttg
DQ315778_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097664_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726858_PreC_P-D      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
JF754629_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097863_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
EU726901_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MZ097815_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601318_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097782_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN642140_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601249_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097733_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP856993_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726897_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097686_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF584160_PreC_P-D      tgttcaagcctccragctgtgccttgggtggctttrgggcatggacattg
JF754611_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MG491156_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097832_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097701_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP856977_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggatattg
KP856997_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097824_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857117_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JN257162_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KT749823_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726929_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857049_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
MW601306_PreC_P-D      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacatcg
JN257183_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MW601294_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097765_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN642161_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642154_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642157_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB674430_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AY741798_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KF584078_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU456636_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097812_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF471655_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097772_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB674431_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097647_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
KP856986_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP856976_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097787_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
JN642149_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP856978_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
MZ097816_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP856984_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097817_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456652_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040818_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642142_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040819_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456637_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456655_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857050_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JF754610_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097827_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857030_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726881_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MZ097650_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726977_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MW601291_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097763_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KT963508_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097671_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754595_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040796_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
JN257202_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456650_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggaccttg
GU456640_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726893_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB270546_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601229_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097718_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601312_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097778_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
EU726849_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040824_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601289_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097762_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KC774459_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC774440_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC774444_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725140_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LT992444_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ349231_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040797_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097845_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040814_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB674425_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
JN040795_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857051_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040820_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JN257205_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU456638_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X85308_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X85259_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X85299_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
X85297_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X85298_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857053_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN642145_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF584099_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456648_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN257187_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
JN257188_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
EU726947_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040799_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726945_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754601_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257148_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601326_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097791_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN257169_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601256_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097738_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097852_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KF471649_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097797_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ386590_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414054_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414135_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377589_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF280817_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MN507838_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB270543_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726946_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY796030_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
GU456641_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040813_PreC_P-D      tgttcaagcctccaagctgtgccttggggggttttggggcatggacattg
JN040809_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC875301_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC875302_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875299_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875303_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK598647_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875291_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196210_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196213_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875286_PreC_P-D      tgttcaagcctcaaagctgtgccttgggtggctttggggcatggacattg
KC875306_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875283_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875275_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875281_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875305_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875284_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875287_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875300_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196226_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875307_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097821_PreC_P-D      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JF754633_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN257201_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097756_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH724252_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ349233_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726919_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY741797_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875290_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196209_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196212_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257186_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggaccttg
JN257152_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF584163_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
KF584165_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
MN310705_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
KF584161_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY382412_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MN507853_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY382414_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF584164_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
KF584166_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
KF584162_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097702_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754608_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875296_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX196228_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC875298_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040806_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726845_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB104712_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040827_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggatattg
KC875289_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040828_PreC_P-D      tgttcaagcctccaagctgtgccttaggtggctttaggacatggacattg
KC875304_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857097_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257203_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601261_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097741_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
EU726924_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726935_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG491181_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040808_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257155_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257196_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257199_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
OK106256_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097666_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618437_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM524339_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875308_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY371920_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB222713_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875295_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196227_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875276_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196214_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875309_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875279_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875277_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875280_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875282_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196215_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875278_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW601282_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618433_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618431_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618429_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP671699_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF471647_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875294_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040805_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF754591_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477459_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726931_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF471651_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF471652_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875288_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196208_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX196211_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875285_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875293_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040807_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618430_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618432_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY371902_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY371914_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY371921_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY721612_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EF103277_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726898_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040826_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097669_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
L27106_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
AJ627215_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AJ627216_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AJ627218_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097657_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097866_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456639_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttg
EU726975_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097871_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF471640_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
EU726855_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097835_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601259_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601272_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601237_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097722_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601238_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601311_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097803_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601231_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601305_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601329_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GU456642_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GU456644_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB674428_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097675_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MN585094_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
MZ097837_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754630_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754603_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB674435_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP856975_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601321_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP671700_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857006_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040811_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
GU456665_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097670_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY371906_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040800_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040801_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GU456643_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
EU726951_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601265_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097746_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601336_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097807_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
JN040812_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040804_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726970_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040829_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456646_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC875292_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726921_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726922_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097630_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG491191_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
GU456645_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040802_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GU456649_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726925_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040810_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726856_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattc
EU726857_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726963_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY371918_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726911_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ868005_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ868011_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ868009_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ867998_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY371911_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ868012_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY371908_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ867970_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ867983_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ867957_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ867963_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ868013_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ868004_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
FJ867999_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ867996_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
FJ867981_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ867968_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ867972_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY161159_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY161160_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY373431_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ867984_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
FJ867982_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ867964_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ867973_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ867974_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ867975_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ867979_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ868010_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ867966_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
FJ867965_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ867977_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ867953_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097799_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB674424_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP856996_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097700_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB674427_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacmttg
JF754632_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097699_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097846_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857005_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097818_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097709_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097645_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ399006_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MH724236_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097808_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatyg
JF754602_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB674413_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097678_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB674423_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857000_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601332_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
KP857007_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097689_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754607_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GU456647_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097695_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726880_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MW601337_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP857004_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB674429_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KP857003_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY371917_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttg
MW601315_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097780_PreC_P-D      tattcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF018187_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KF018189_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JN257149_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
MW601269_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857094_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
MW601248_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097732_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
MZ097649_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097840_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF151735_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JN040817_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JN040815_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040816_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KP857045_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MZ097834_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601302_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097774_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ178017_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MW601251_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MZ097735_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ349235_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ178012_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ178011_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ178015_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY371912_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ178019_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY350614_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY371901_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY371905_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY371922_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X02496_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ178016_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ178018_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ178020_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857008_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF754596_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB674426_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097681_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY661792_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY661793_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618427_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857099_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
Y07587_PreC_P-D        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857100_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MZ097839_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK618428_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU456674_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726973_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggatattg
KP857029_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggatattg
MZ097660_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MN844882_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JN257214_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggrcatggacattg
JN257215_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggrcatggacattg
EU726933_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456669_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GU456666_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040769_PreC_P-D      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MZ097836_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040782_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726938_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggatattg
MZ097785_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726932_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726904_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN040775_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726892_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KF471642_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JN040768_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040762_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU456658_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN642129_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
EU726859_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726954_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040770_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG491146_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857116_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MZ097833_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KF471659_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY371910_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726860_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU456667_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG491143_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KF471641_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU726950_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF471654_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
EU726886_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG491148_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456670_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
EU726865_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF471645_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU726873_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN040767_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU456671_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN642155_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY741795_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY741796_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY741794_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP671695_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040822_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KP671692_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF471653_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF471657_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726930_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726940_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH725152_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP671697_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP671684_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040758_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726937_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MK355500_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK693108_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP671691_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP671696_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP671686_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP671693_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP671694_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP671688_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK693109_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP671690_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN257151_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726971_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726972_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726894_PreC_P-D      tgttcaagcctccaagctgttgcttgggtggctttggggcatggacattg
EU726902_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726895_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726854_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726869_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726888_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726887_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU726976_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN040759_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP671685_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP671687_PreC_P-D      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
                                 *       *   **     ** *          *      

AB555500_PreC_P-D      acccttataaagaatttggagctagtgtgactttactctcgtttttgcct
MG877726_PreC_P-D      acccttataaaraatttggagcttctgtggagttactctcgtttttgcct
MG877727_PreC_P-D      acccttataaaraatttggagcttctgtggagttactctcgtttttgcct
MG877728_PreC_P-D      acccttataaaraatttggagcttctgtggagttactctcgtttttgcct
MW601320_PreC_P-D      atccatataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904439_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097636_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097644_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JX036342_PreC_P-D      atccttataaagaatttggagcttctgcgcagttactctcgtttttacct
JX036343_PreC_P-D      acgcgtataaagaatttggagcttctgtggagttactctcttttttgcct
JX036344_PreC_P-D      atccttataaagaatttggagcttctgcgcagttactctcgtttttgcct
MZ097662_PreC_P-D      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040766_PreC_P-D      atccttataaagaatttggcgcttctgtggagttactctcgtttttgcct
MZ097880_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674416_PreC_P-D      atccttataaagaatttggagcttctgtcgagttactctcttttttgcct
MH725171_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
AB674415_PreC_P-D      atccttataaagaatttggagcttctgtggagttactgtcttttttgcct
MG491172_PreC_P-D      atccttataaagaatttggagctactgtggagttaatctcgtttttgcct
MZ097798_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MW601338_PreC_P-D      atccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
MG491159_PreC_P-D      atccatataaagaatttggagcctctgtggagttactctcgtttttgcct
JF754612_PreC_P-D      atccttataaagaatttggcgcttctgtggagttactctcttttttgcct
JF754594_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754617_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726891_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040773_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097713_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB330367_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754609_PreC_P-D      atccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
MZ097730_PreC_P-D      atccttataaagaatttggagcttctgtkgagttactctcgtttttgcct
GU456677_PreC_P-D      atccctataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097698_PreC_P-D      atccttataaagaatttggagctactgtggagttaatctcttttttgcct
JN642135_PreC_P-D      acccttataaagaatttggagctactgtgcagttactctcgtttttgcct
JN642128_PreC_P-D      atccctataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857028_PreC_P-D      atccttataaagaatttggagctagtgtggagttactctcgtttttgcct
MZ097874_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcatttttgcct
GU456679_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754622_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726979_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754626_PreC_P-D      atccttataaagaatttggcgctactgtggagttactctcgtttttgcct
MH725153_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN257165_PreC_P-D      atccttataaagaatttggagcctctgtggagttactctcatttttgcct
JN257166_PreC_P-D      atccttataaagaatttggagcctctgtggagttactctcatttttgcct
KF018181_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MG491126_PreC_P-D      atccttataaagaatttggagcttcactggagttactctcttttttgcct
KP857031_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725126_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257153_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
JN257195_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
GU456657_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
FJ904426_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726884_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MK355501_PreC_P-D      atccttataaagaatttggagcttctgtgaagttactctcgtttttgcct
GU456651_PreC_P-D      atccttataaagaatttggagctagtatcgagttactctcgtttttgcct
MG491158_PreC_P-D      atccttataaagaatttggagctactgtgcagttactctcgtttttgcct
MZ097692_PreC_P-D      acccttataaagaatttggagcttctgttgagttactctcgtttttgcct
MZ097691_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857032_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857018_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN257176_PreC_P-D      atccttataaagaatttggagctactgtgcagttactctcgtttttgccg
JN257177_PreC_P-D      atccttataaagaatttggagctactgtgcagttactctcgtttttgccg
X85278_PreC_P-D        atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MW601299_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097770_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW601245_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097728_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097637_PreC_P-D      atccttataaagaatttggagctactgtgsagttactctcgtttttgcct
FJ904438_PreC_P-D      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097665_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097631_PreC_P-D      atccttataaagaatttggcgcttctatagagttactctcgtttttgcct
MH724978_PreC_P-D      atccttataaagaatttggagctagtgtggagttactctcttttttgcct
JF754600_PreC_P-D      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB270541_PreC_P-D      atccatataaagaatttggagcttctgtggagttactctcgtttttgcct
AB104710_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MT114169_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
MH725199_PreC_P-D      atccgtataaagaatttggagctactgtgcagttactctcgtttttgccg
MH725189_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MW601288_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725135_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726952_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcttttttgcct
JN040774_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcttttttgcct
KP857024_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB270542_PreC_P-D      atccatataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097682_PreC_P-D      atccttataaagaatttggagcttctgtgcagttactctcatttttgcct
KP857039_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgccg
KF018177_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642146_PreC_P-D      acctttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904429_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcatttttgcct
X80924_PreC_P-D        atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
X80926_PreC_P-D        atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AY371909_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ167302_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ167301_PreC_P-D      atccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ184322_PreC_P-D      atccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097653_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097638_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097629_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcatttttgcct
MW601331_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857019_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ486023_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB270540_PreC_P-D      atccatataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097711_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754619_PreC_P-D      atccttataaagaatttggagctactgtgcagttactctcgtttttgcct
GU456664_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097843_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642136_PreC_P-D      atccttataaagaatttggagctactgtgcagttactctcgtttttgcct
HQ833466_PreC_P-D      atccttataaagaatttggagctwctgtkgagttactctcgtttttgcck
GU456682_PreC_P-D      atccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
MG491188_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097693_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725068_PreC_P-D      atccttataaagaatttggagctactgcggagttactcttgtttttgcct
JN642147_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
GU456654_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MG491187_PreC_P-D      atccttataaagaatttggagccactgtggagttactctcgtttttgccg
MG491162_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MG491155_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MG491149_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AY236162_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcctttttgcct
DQ304550_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcctttttgcct
DQ304551_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcctttttgcct
DQ304547_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcctttttgcct
DQ304548_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcctttttgcct
DQ304549_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcctttttgcct
MT731871_PreC_P-D      atccatataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904402_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcatttttgccg
X59795_PreC_P-D        atccttataaagaatttggagcttctatggagttgctctcgtttttgcct
JN040772_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040771_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MG491183_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097795_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040830_PreC_P-D      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
HQ700439_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904446_PreC_P-D      atccttataaagaatttggcgctactgtggagttactctcatttttgcct
MG491147_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB674417_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674418_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ336680_PreC_P-D      atccttataaagaatttggagcctctgtggagttactctcgtttttgcct
DQ336682_PreC_P-D      atccttataaagaatttggagcctctgtggagttactctcgtttttgcct
DQ336684_PreC_P-D      atccttataaagaatttggagcctctgtggagttactctcgtttttgcct
DQ336681_PreC_P-D      atccttataaagaatttggagcctctgtggagttactctcgtttttgcct
DQ336683_PreC_P-D      atccttataaagaatttggagcctctgtggagttactctcgtttttgcct
MZ097661_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcttttttgcct
JN257172_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN257173_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754593_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754592_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726912_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674410_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456678_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857033_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097830_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW601279_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097753_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456656_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcttttttgcct
FJ904431_PreC_P-D      atccttataaagaatttggagctactgtgcagttactctcgtttttgcct
KF018182_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN257160_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257161_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456675_PreC_P-D      atccttataaagaatttggagcttctattgagttactctcgtttttgcct
GQ205385_PreC_P-D      acccttataaagaatttggagcaactgtggagttactctcatttttgcct
MG491173_PreC_P-D      atccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
MG491186_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MW601239_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097723_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097801_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
MZ097676_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcktttttgcct
MZ097639_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857037_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477458_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726944_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040776_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904399_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcatttttgcct
MW601298_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097769_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726941_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726875_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcttttttgcct
FJ904445_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcyt
EU726969_PreC_P-D      atccttataaagaatttggagctactacggagttactctcgtttttgcct
AB270550_PreC_P-D      atccgtataaagaatttggagctactgtggagttactctcgtttttgcct
KY629634_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857022_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097823_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857025_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642164_PreC_P-D      atccatataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726868_PreC_P-D      atccatataaagaatttggagctactgtggagttactctcgtttttgcct
JN040779_PreC_P-D      atccatataaagaatttggagctactgtggagttactctcgtttttgcct
AJ627224_PreC_P-D      atccttataaagaatttggagctagtgtcgagttactctcgtttttgcct
MW601304_PreC_P-D      atccttataaagaatttggagcttccgtggagttactctcgtttttgcct
JN642156_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754634_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456673_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456659_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgttttcgcct
JF754604_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcatttttgcct
EF103281_PreC_P-D      atcgttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754631_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857017_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857015_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857016_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MW601278_PreC_P-D      atccttataaagaatttggagctagtgtggagttactctcgtttttgcct
MW601258_PreC_P-D      atccatataaagaatttggagcttctgtggagttactctcgtttttgcct
JQ687531_PreC_P-D      atccttatgcagaatttggagctactgtggagttactctcgtttttgcct
JN642167_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754635_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MG491170_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW601250_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097734_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
X85277_PreC_P-D        atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097677_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725202_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH724970_PreC_P-D      actcttataaagaatttggagctactgttgagttaatctcgtttttgcct
KP857114_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgttcttgcct
JN040781_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
HQ700463_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904418_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcatttttgcct
AY796032_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB674419_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097870_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097635_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754590_PreC_P-D      atccttataaagaatttggagcttctgtggatttactctcgtttttgcct
EU726850_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW601247_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097731_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726885_PreC_P-D      atccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040755_PreC_P-D      atccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097881_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097646_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KY629633_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857115_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456672_PreC_P-D      atccttataaagaatttggagctactacggagttactctcgtttttgcct
KP857021_PreC_P-D      atccktataaagaatttggagctactgtggagttactctcgtttttgcct
EU787438_PreC_P-D      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726848_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcatttttgcct
KP857038_PreC_P-D      atccttataaagaatttggagcttctgtcgagttactctcgtttttgcct
MZ097825_PreC_P-D      atccttataaagaatttggagcttctgtcgagttactctcgtttttgcct
HQ700472_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674404_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700467_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcttttttgcct
HQ700455_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN687947_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700478_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700553_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700481_PreC_P-D      atccttataaagaatatggagctactgtggagttactctcgtttttgcct
HQ700474_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725086_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700468_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700470_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700489_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700473_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB222712_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598643_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700444_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700483_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700448_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700477_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700480_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700449_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700469_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700479_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700484_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700440_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700441_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700445_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700446_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700447_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700450_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700451_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700454_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700459_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700464_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700466_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700471_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700482_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700487_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700488_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700442_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700443_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097786_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097707_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642158_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726864_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725096_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725110_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725118_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725097_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725172_PreC_P-D      atccttataaagaatttggaggtattgtggagttacttttttttttgcct
MH724959_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726906_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcttttttgcct
DQ464182_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371913_PreC_P-D      atccttataaagaatttggagctactgtcgagttagtctcttttttgcct
MZ097634_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725139_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU787439_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF419522_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB270549_PreC_P-D      attcttataaagaatttggagcttctgtggagttactctcgtttttgcct
X85273_PreC_P-D        atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097868_PreC_P-D      atccttataaagaatttggagcctctgtggagttactctcgtttttgcct
MZ097705_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725094_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF618349_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857034_PreC_P-D      atccttataaagaatttggagctagtgtggagttactctcgtttttgcct
JN257159_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456681_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904427_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097878_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
MZ097673_PreC_P-D      atccttataaagaatttggagctactgttgaattactctcgtttttgcct
MW601285_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097759_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MW601267_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MW601244_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097727_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857035_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456684_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371904_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF419530_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB674403_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW601325_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcatttttgcct
MZ097790_PreC_P-D      atccttataaagaatttggagcyactgtggagttactctcatttttgcct
MW601322_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097783_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857109_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642150_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
JN040821_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040752_PreC_P-D      atccttataaagaatttggagctactgtcgagttactctcgtttttgcct
AY371915_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU939681_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ899792_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MG491144_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097811_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097674_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MW601339_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH724962_PreC_P-D      atccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
MW601283_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097757_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097856_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674420_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040778_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097810_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725144_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642153_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040777_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904424_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
EU726908_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726847_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MG491174_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097643_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642166_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP995100_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040780_PreC_P-D      atccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
GU456676_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456668_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725123_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642133_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN257170_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
JN040765_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674408_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725088_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
JN040761_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ349220_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW601307_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097775_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097875_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725054_PreC_P-D      atccttataaagaatttggagctagtgtggagttactctcgtttttgcct
MH724960_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724969_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040753_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904432_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcttttttgcct
AY371916_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AJ344116_PreC_P-D      atccttataaagaatttggagcttctgtggagttgctctcgtttttgcct
EU726957_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857040_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MT731880_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT591279_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT591277_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471658_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF018195_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040750_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcatttttgcct
AY721605_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW601262_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097742_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB716760_PreC_P-D      gccatcataaagaatttggagctactgtggagttactctcgtttttgcct
HE805987_PreC_P-D      gccatcataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097768_PreC_P-D      atccttataaaraatttggagctactgtgsagttactctcgtttttgcct
M32138_PreC_P-D        atccttataaagaatttggagctactgtggagttactctcgtttctgcct
KP857023_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF018185_PreC_P-D      atccttataaagaatttggagctactgtgcagttactctcgtttttgcct
JN040754_PreC_P-D      atccttataaagaatttggagctggtgtggagttactctcgtttttgcct
EU726926_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726910_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726872_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726965_PreC_P-D      atccctataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040757_PreC_P-D      atccctataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674405_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM042272_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM042273_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM042283_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287601_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287602_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287604_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287605_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287607_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287608_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287609_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287610_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287611_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287612_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287615_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287617_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287618_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287620_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287621_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183449_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183464_PreC_P-D      atccttataaagaatttggagctacggtggagttactctcgtttttgcct
GQ183463_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183459_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183458_PreC_P-D      atccatataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183457_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183460_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183461_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183469_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183450_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183451_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183452_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183453_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183454_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183455_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183456_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183462_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183465_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183466_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183467_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183468_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183448_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097796_PreC_P-D      atccttataaagaatttggagctacwgtggagttactctcgtttttgcct
MZ097688_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097625_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642151_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754588_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904415_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642126_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642130_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW601303_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471644_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456663_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AY161158_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725031_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725033_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040792_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040791_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040793_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097876_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456660_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB222710_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcttttttgcct
MZ097861_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MZ097690_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW601232_PreC_P-D      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725087_PreC_P-D      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857036_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857026_PreC_P-D      atccttataaagaatttggagctactgtcgagttactctcgtttttgcct
KM524338_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF061167_PreC_P-D      atccctataaagaatttggagctactgtggagttactctcgtttttgcct
JN642132_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN257211_PreC_P-D      attcttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257179_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040784_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754614_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ562309_PreC_P-D      atccatataaagaatttggagctactgtggagttactctcgtttttgcct
MH724965_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724966_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725125_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524348_PreC_P-D      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471660_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726861_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ097658_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW601335_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725077_PreC_P-D      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857020_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF018192_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161150_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161151_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161152_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161153_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161154_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161155_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161156_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287619_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507836_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW455166_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF170739_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725198_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725079_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724980_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcttttttgcct
MH725047_PreC_P-D      atccttataaagaatttggagctactggggagttactctcgtttttgcct
MH725134_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725169_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725133_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725057_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725046_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725053_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725055_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725056_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725052_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724995_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH724985_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724977_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725064_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725065_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725080_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725081_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724961_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724971_PreC_P-D      atccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725208_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725182_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725174_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725101_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725090_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725016_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724973_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725181_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725083_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724997_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725191_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725175_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725211_PreC_P-D      atccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725206_PreC_P-D      atccttataaagaatttggagctactgtggagttactc