HBVdb

Dataset for nucleotide sequence C of genotype C

[Download (right click)] [Edit] [Sequences] [Repertoires]

2926 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


FJ562286_C_P-C      -----------cctatcttatcaac-----acttccg-gaaactactg-----ttgttag
KC774226_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HM042269_C_P-C      atggacattgacccttataaagaatttggagctactgtggagttactctc---gtttttg
KC774179_C_P-C      atggacattgacccttataaagaatttggagctaccgtggagttactctc---ttttttg
KC774297_C_P-C      atggacattgacccgtataaagaatttggagctaccgtggagttactctc---ttttttg
HM011479_C_P-C      atggacattgacccgtataaagaatttggagcatctgyggagttamtctc---ttttttg
KX276837_C_P-C      atggacattgacccgtataaagaatttggagcatctgcggagttavtctc---ttttttg
MF488703_C_P-C      atggacattgacccttataaagaatttggagcgactgtggagttactctc---atttttg
KX276850_C_P-C      atggacattgacccrtataaagaatttggagcttctrcggagttactctc---ttttttg
JQ801508_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801517_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
MF925403_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
JQ801523_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT347089_C_P-C      atggacatcgacacctataaagaatttggagcttctctggagttactctc---ttttttg
KX276849_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089804_C_P-C      atggacattgacccatataaagaatttggatgctctgcgcagttactctc---ttttttg
HM011468_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ184326_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801515_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803776_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
JQ801518_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KF214670_C_P-C      atggacattgacccatataaagaatttggagctactgtggagttactctc---ttttttg
KJ803812_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB112066_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801499_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
MG826122_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
JQ801480_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
MF488701_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023652_C_P-C      atggacattgacccgtataaagaatttggagcttctgctgagttactctc---ttttttg
JQ429078_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactccc---ttttttg
KC315399_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ361526_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925405_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KF214667_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803760_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
FJ023651_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KJ803757_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924650_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB112408_C_P-C      atggacattgacccgtataaagaatttggagcttctgaggagttactctc---tttttta
KX276847_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KF214671_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
MF925395_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801510_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801491_C_P-C      atggacattgacccgtataaagaatttggagcttctgctgagttactctc---ttttttg
FJ023648_C_P-C      atggacattgacccctataaagaatttggagcttctgtggagttactctc---ttttttg
AB112348_C_P-C      atggacattgacccgtataaagtatttggagcttctgtggagttactctc---ttttttg
KX765822_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ361534_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KF214669_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
JQ801472_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925374_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925369_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801503_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ855541_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
GQ358153_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023639_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KT366464_C_P-C      atggacattgacccgtataaagaatttggagcatctgcggagttactctc---ttttttg
KF214677_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089803_C_P-C      atggacaatgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ855534_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765821_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN827423_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN827418_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EF384201_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765850_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765844_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801519_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801482_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801475_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN827424_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN827425_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765848_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN827421_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765825_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801497_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925394_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925367_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KF214673_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765828_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MH220971_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803792_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KF214675_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801520_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KF214672_C_P-C      atggacattgacccctataaagaatttggagcttctgtggagttactctc---ttttttg
KC875271_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC875265_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC875264_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC875273_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC875269_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC875274_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC875267_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC875270_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC875272_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC875268_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ315782_C_P-C      atggacattgacgcatataaagaatttggagcttctgtggagttactctc---ttttttg
KF214676_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801489_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925359_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470937_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KX774506_C_P-C      atggacattgacccatataaagaatttggagcttctgtagagttactctc---ttttttg
JQ801511_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023645_C_P-C      atggacattgactcgtataaagaatttggagcttccgtggagttactctc---ttttttg
AB117758_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB074756_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765840_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---tttttta
KT364719_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT364720_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT307719_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT307718_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT364718_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT987426_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU051427_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT987423_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924616_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801513_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765826_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925378_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925387_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925398_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801509_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803780_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MK286461_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765843_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765842_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KF214668_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801496_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801473_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924609_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ855548_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ315781_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ315783_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925409_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ855523_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT987424_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924612_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
GQ924613_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT987425_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU051423_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925410_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MG725248_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801486_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX774504_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MK628732_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925406_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925376_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925375_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925365_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470936_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KX765834_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765829_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT366463_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT364721_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803818_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801502_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801493_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023658_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023657_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---tttttta
KU051424_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765851_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803800_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924649_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924614_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN827422_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU051426_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925377_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF925408_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX774503_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765853_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765849_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765837_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765833_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765818_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU051425_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774236_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN827420_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN827416_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023649_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023642_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF068756_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB247916_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GU563561_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN827417_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801470_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803799_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765820_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765831_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765832_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765838_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765846_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX276855_C_P-C      atggacattgacacttataaagaatttggagcttctgtgcagttactctc---ttttttg
KF873536_C_P-C      atggacattgaccmttataaagaatttggagcttcagtggagttactctc---ttttttg
KU679937_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
KU679960_C_P-C      atggacattgacccttataaagaatttggagcttcagtggagttactctc---ttttttg
JQ027324_C_P-C      atggacattgacccgtataaagaatttggagcctctgtggagttactctc---ttttttg
KX276836_C_P-C      atggacattgaccattataaagaatttggagcttccgtggagttactctc---ttttttg
EU939539_C_P-C      atggacatcgacccctataaagaatttggagcttctgtggagttactctc---ttttttg
AB670274_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU547562_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc---ttttttg
EU717214_C_P-C      atggacattgacccgtataaagaatttggagcttctcgagagttactctc---ttttttg
EU872005_C_P-C      atggacattgacccgtataaagaatttggagcttctcgggagttactctc---ttttttg
GQ377552_C_P-C      atggacattgacccatataaagaatttggaggttccgaggagttactctc---ttttttg
KJ803777_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GU357845_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
AB176642_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttrctctc---ttttttg
KJ803809_C_P-C      atggacattgacccctataaagaatttggagcttctgtggagttactctc---gtttttg
GQ377623_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670263_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598760_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598762_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KX276833_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670268_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013778_C_P-C      atggacattgacacttataaagaatttggagcttctgtggagttactctc---ttttttg
AB670255_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB300373_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939643_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562280_C_P-C      atggacattgacmcatataaagaatttggagcttctgtggagttactctc---ttttttg
EU939542_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899767_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KF485390_C_P-C      atggacattgacccgtataaagaatccggagcttctgtggagatactctc---ttttttg
KF214652_C_P-C      atggacattgacccttataaagaatttggagcttctgtgcagttactctc---ttttttg
FJ562241_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
MH818373_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
FJ562310_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939541_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089772_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU667576_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939558_C_P-C      atggacattgacccatataaagaatttggagcttctgcggagttactctc---ttttttg
AB670272_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670259_C_P-C      atggacattgacacatataaagaatttggagcttctgtggagttactctc---ttttttg
AB115417_C_P-C      atggacattgacccgaataaagaatttggagcttctgtggagttactctc---ttttttg
AB042285_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363252_C_P-C      atggacattgacacctataaagcatttggagcttctgtggagttactctc---ttttttg
EU919165_C_P-C      atggacattgacccgtataaagaatttggagcatctgctgagttactctc---ttttttg
AB931170_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB931171_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU667914_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576193_C_P-C      atggacattgacccgtataaagaatttggagcttctggagagttactctc---ttttttg
KU576196_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU668197_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386616_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AY641563_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
EF137803_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
JQ027332_C_P-C      atggacattgacgtgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939641_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ890381_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089802_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB670262_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670246_C_P-C      atggacattgacccrtataaagaatttggagcttctgtggagttactctc---ttttttg
AB113877_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB300361_C_P-C      atggacattgacccgtataaagaatttggaggttctgtggagccactctc---tttttta
KY363285_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggaattactctc---ttttttg
AB670237_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggaattactctc---ttttttg
AB670279_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggaattactctc---ttttttg
GQ475328_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggaattactctc---ttttttg
GQ475351_C_P-C      atggacattgacccgtataaagaatttggagcttctctggagttactctc---ttttttg
KY363284_C_P-C      atggacattgacccgtataaagaatttggagcctctgtggaattactctc---ttttttg
FJ787487_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787488_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787489_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KU576284_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
D00630_C_P-C        atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774353_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040156_C_P-C      ayggacattgacccgkataaagaatttggagcttcttcggagttactctc---ttttttg
GQ377518_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023640_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040164_C_P-C      atggacattgacacgtataaagaatttggagcttctgyggagttactctc---ttttttg
KY363260_C_P-C      atggacattgacccgtataaagaatttggagcttctgctgagttactctc---ttttttg
AB900115_C_P-C      atggacattgacccgtataaagaatttggagcctctgcggagttactctc---ttttttg
AB367433_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
MK321266_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MK720629_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MK720630_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HM011500_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
AB367429_C_P-C      atggacattgacccgtataaagaatttggagcttctgctgagttactctc---gtttttg
AB367802_C_P-C      atggacattgacccgtataaagaatttggagcttctgctgagttactctc---gtttttg
FJ899768_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562250_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
X52939_C_P-C        atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670264_C_P-C      atggacattgacmcstataaagaatttggagcttctgtggagttactctc---ttttttg
FJ848339_C_P-C      atggacattgacacctataaagaatttggagcttctggggagttactctc---ttttttg
JQ040143_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670258_C_P-C      atggacattgacccctataaagaatttggagcttctgtggagttactctc---ttttttg
AB298720_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB298721_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040151_C_P-C      atggacattgacccatataaagaatttggagcttctgcggagttactctc---ttttttg
HQ700517_C_P-C      atggacattgacccktataaagaatttggagcttctgtggaattactctc---ttttttg
FJ386625_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB014394_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013943_C_P-C      atggaccttgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU589344_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
AB367405_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ993691_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
DQ993692_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
AB367421_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670260_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562255_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363282_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363283_C_P-C      atggacattgacccgtataaagaacttggagcttctgtggagttactctc---ttttttg
KU668231_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774202_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
GQ358158_C_C-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562243_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
AB367422_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU306674_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU306675_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363268_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363254_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803769_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
FJ787490_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY206386_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774354_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774355_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KM213037_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670306_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014363_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386620_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggaattactctc---ttttttg
AB111112_C_P-C      atggacattgacccgtataaagaatttggagcttctgyggagttactctc---ttttttg
AB049610_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014378_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB111125_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
AB111124_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
AB246344_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
LC279247_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
LC279248_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
LC279249_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
KC774279_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475330_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HM011465_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386626_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
D50520_C_P-C        atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
D50517_C_P-C        atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttatg
D50518_C_P-C        atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttatg
KM359441_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
DQ089797_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014398_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363277_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactccc---ttttttg
JX026878_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ478899_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY641560_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
AY641559_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttgctctc---ttttttg
AB670288_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB195949_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014390_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014374_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MG893556_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363278_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363279_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX036338_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
EU939536_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670302_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367418_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014360_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363256_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttctttg
KY363257_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475326_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
FJ562319_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
EU939647_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774329_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715364_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367401_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB106895_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014367_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803766_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
GQ475355_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386638_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB176643_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014376_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB971714_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
AB971715_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
GQ475357_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB195942_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB195943_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB195944_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475336_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF533983_C_P-C      atggacattgacccgtataaagaatttggggcttctgtggagttactctc---ttttttg
AB670285_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB205124_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939612_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562230_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
GQ475341_C_P-C      atggacattgacccctataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386629_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HQ638218_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363253_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013766_C_P-C      atggacattgacccgtataaagaattaggagcttctgtggagttactctc---ttttttg
KJ598637_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598638_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774348_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---gtttttg
KC774334_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774272_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX661489_C_P-C      atggacatcgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
JX026877_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
JQ040165_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040135_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
JN104434_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
GQ475350_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377618_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377523_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715350_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386602_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
EU939578_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AY596107_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
AB697494_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670297_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670275_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367431_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367423_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367408_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB182589_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774251_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774185_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774250_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774255_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774244_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562218_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386605_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386589_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KJ173393_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173394_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598642_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598635_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598636_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598640_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598641_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598659_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598639_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598661_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598658_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598656_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598654_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598657_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598650_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598649_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598651_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598653_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598648_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598660_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598646_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598644_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598645_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598647_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598652_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598655_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HM750132_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670265_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB113879_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475312_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475327_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475334_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU570068_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---tttcttg
EU570067_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---tttcttg
EU554537_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---tttcttg
EU554538_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---tttcttg
EU554539_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---tttcttg
AB367395_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089801_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562298_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964032_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964020_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964021_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964022_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964024_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964025_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964026_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964027_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964028_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964029_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964030_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964031_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964033_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964023_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803761_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KF214655_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475321_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939597_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY022423_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013961_C_P-C      atggacattgacccgtataaaaaatttggagcttctgtggagttactctc---ttttttg
KR013780_C_P-C      atggacattgacccatataaagaattcggagcttctgtggagttactctc---ttttttg
KR013765_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013764_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KF485389_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774316_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
KC774275_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774257_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KC774232_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774206_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN104435_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
GQ475344_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475332_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475322_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475320_C_P-C      atggacattgacccgtataaagaatttggagcttctatggagttactctc---ttttttg
GQ475318_C_P-C      atggacattgacccgtataaagaatttggagcttctatggagttactctc---ttttttg
GQ377571_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377540_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562320_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
EU939549_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EF137802_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367402_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KY470878_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470884_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173313_C_P-C      atggacattgacccttataaagaatttggagcctctgtggagttactctc---ttttttg
KJ173314_C_P-C      atggacattgacccttataaagaatttggagcctctgtggagttactctc---ttttttg
DQ144553_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ144603_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ144604_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB111116_C_P-C      atggacattgacccgtataaagaatttggagcttctatggagttactctc---tttcttg
AB111117_C_P-C      atggacattgacccgtataaagaatttggagcttctatggagttactctc---tttcttg
X04615_C_P-C        atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT284753_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377585_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB042282_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY641561_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470934_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KY470929_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KY470933_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KR013786_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KR013784_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KR013783_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774197_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KR013779_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KR013782_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KR013785_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KR013781_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagtcactctc---ttttttg
KF779242_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HM011489_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014377_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475339_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774192_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB697490_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475333_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279252_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279253_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774252_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670300_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
JN400087_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN400089_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173287_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173288_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964049_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964050_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964051_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964052_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964053_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964054_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964055_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964056_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964057_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964058_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964059_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964060_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964061_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964062_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964063_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475313_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475347_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF384364_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
AF384365_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
AF384366_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
AF384367_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
KY470874_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470873_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT284756_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013853_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013761_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774259_C_P-C      atggacattgacacgtataaagaatttggagcttccgtggagttactctc---ttttttg
KC774233_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
KC774223_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
HM750131_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475342_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475310_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377576_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377535_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377553_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715367_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttgtg
FJ715366_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386647_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU916229_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU306673_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
D12980_C_P-C        atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY641558_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN400088_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF286594_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670287_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670252_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367411_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB362932_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774243_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774346_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013797_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013768_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013767_C_P-C      atggacattgacccgtataaagaatttggagctcctgtggagttactctc---ttttttg
KR013762_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774220_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774184_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX661492_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377600_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013798_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ688404_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173437_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173438_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013763_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279254_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279255_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279256_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279257_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KF779300_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ683578_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
HM750138_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363276_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470883_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670309_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562297_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475306_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475308_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475315_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475331_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB471851_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB471852_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB471853_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB033550_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP027477_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MG893557_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279251_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470889_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470886_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470888_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470881_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470875_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774270_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774209_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX661491_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX429905_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828918_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ872210_C_P-C      atggacattgacccgtataaaaaatttggagcttctgtggagttactctc---ttttttg
GQ475348_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475329_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475325_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475324_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475338_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475354_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475311_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475307_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377616_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377563_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377517_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU589345_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
D50519_C_P-C        atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB697500_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475345_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB675677_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670292_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggaattactctc---ttttttg
AB670267_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB640730_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367409_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670283_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367403_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367399_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173283_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173284_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB300362_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB222714_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB222715_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828913_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828915_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828916_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828917_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828919_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828920_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB042283_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367394_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB485808_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670247_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AP011098_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY057947_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899763_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899775_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377531_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377603_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475305_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475346_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774180_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774219_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774274_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173426_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ410519_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470876_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470877_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470879_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470890_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470891_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470892_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX276853_C_P-C      atggacattgacccgtataaagaatttggagcttctgygvakttactctc---ttttttg
DQ089785_C_P-C      atggacattgacccatataaagaatttggagcttctcaggagttaatctc---ttttttg
KF873539_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
KF873541_C_P-C      atggacattgaccattataaagaatttggagcttctgtggagttactctc---ttttttg
JQ341517_C_P-C      atggacattgacccgtataaagaatttrgagcttctgtggagttactctc---ttttttg
JX507212_C_P-C      atggacattgacccgtataaagaatttggagcttctgcgcagttactctc---ttttttg
KJ410515_C_P-C      atggacattgacccgtataaagaatttggagcttatcaggagctgctctc---ttttttg
DQ089775_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX276852_C_P-C      atggacattgacmcctataaagaatttggagcttctgtggagttactctc---ttttttg
FJ904423_C_P-C      atggacattgacccgtataaagaatttggagcttctctggagttactctc---ttttttg
MG571332_C_P-C      atggacattgacccgtataaagaatttggagcttcttcggagttactctc---ttttttg
KM875424_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KM875425_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
HM011472_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MK818227_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674430_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX276841_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ410514_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803770_C_P-C      atggacattgacccgtataaagaatttggagcttctatggagttactctc---ttttttg
JX504535_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ341518_C_P-C      atggacattgaccygtataaagaatttggagcttcygtggagttactctc---ttttttg
KJ410499_C_P-C      atggacattgaccactataaagaatttggagcctctgtggagttactctc---ttttttg
KJ410489_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ410492_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ410491_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KJ410494_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KJ410511_C_P-C      atggacattgacccatataaagaatttggagcttctatggagttactctc---ttttttg
KX276846_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803779_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
DQ089778_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089776_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089777_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ410493_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
JX507211_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089792_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KM875428_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---tttttta
KJ410518_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY269140_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HM011486_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089791_C_P-C      atggacattgacccgtataaagaatttggagcttctgtcgagttactctc---ttttttg
KX276840_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089756_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089773_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089757_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF223961_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674457_C_P-C      atggacattgacgcctataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089786_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ027318_C_P-C      atggacattgacccgtataaagaatttggagcttctgyggagttactctc---ttttttg
DQ089790_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707768_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707769_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707770_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707771_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707772_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707773_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707774_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ027333_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089761_C_P-C      atggacattgacccgtataaagaattcggagcttctgtggagttactctc---ttttttg
MG571335_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803810_C_P-C      atggacattgacccctataatgaatttggagcttctgtggagttactctc---ttttttg
KJ803794_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674425_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674458_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674474_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674428_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674390_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KM875405_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EF197911_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KM875404_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ341541_C_P-C      atggacattgacccgtataaagaatttggagcttctgyggagttactctc---ttttttg
HM011488_C_P-C      atggacatygacccgtataaagaatttggagcttctgyggagttactctc---ttttttg
DQ089787_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY353910_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089788_C_P-C      atggacattgacccgtataaagaatttggagcttctctggagttactctc---ttttttg
DQ089759_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MG571345_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674514_C_P-C      atggacattgaccactataaagaatttggagcctctgtggagttactctc---ttttttg
FJ386673_C_P-C      atggacattgacacctataaagaatttggagcttctgcggagttactctc---ttttttg
AB112065_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
DQ089771_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KM875430_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ410498_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX870000_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924655_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089780_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674475_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
JQ027321_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY167099_C_P-C      atggacattgacccgtataaagaatttggagcaactgtggagttactctc---ttttttg
JQ341544_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ855543_C_P-C      atggacattgacccgtataaagaatttggagcttctatggagttactctc---ttttttg
AB031262_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
AF324084_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB105174_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089766_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013996_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013823_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013822_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013825_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674504_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674444_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013857_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ349225_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023650_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013820_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ctttttg
KR013824_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KR013821_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013826_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EF494379_C_P-C      atggacattgacccgtataaagaatttggagcttctacggagttactctc---ttttttg
AB105173_C_P-C      atggacattgacccgtataaagaatttggagctactgtggagttactctc---ttttttg
MF674471_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674411_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
MG826123_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674489_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
MF674463_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
MF674399_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ410504_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX507214_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801490_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HM011497_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023653_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089789_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089770_C_P-C      atggayattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089763_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089760_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089758_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY862869_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB205125_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB112472_C_P-C      atggacattgacccgaataaagaatttggagcttctgtggagttactctc---ttttttg
AF223960_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803826_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
MF674417_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KJ410505_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ410508_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674502_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674494_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674486_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674386_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX276851_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013904_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013855_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013770_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ410496_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173324_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801495_C_P-C      atggacattgacccgtataaagaatttggagcttctatggagttactctc---ttttttg
JQ040133_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ478901_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089784_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089762_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AY167092_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AJ748098_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF473543_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB246346_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB112471_C_P-C      atggacattgacccgaataaagaatttggagcttctgtggagttactctc---ttttttg
MF674467_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089782_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---tttttgg
KJ803774_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF223957_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN104437_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674418_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674403_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013935_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013856_C_P-C      atggacactgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013854_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803793_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173285_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774227_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ855525_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377605_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377536_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089783_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089767_C_P-C      atggacattgacccgtataaagaatttggagctkctgtggagttactctc---ttttttg
EF688062_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ246215_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089781_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF324081_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674442_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF223955_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF223956_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF223959_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089779_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377631_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173286_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674468_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674398_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU305541_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU305542_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674402_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674484_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674408_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674472_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674435_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674388_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674412_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674454_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674501_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013927_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ410501_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
KJ410513_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
KJ410495_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089764_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF223954_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF223958_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AP011097_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089765_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089769_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU305540_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ688403_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013787_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765824_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX276848_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924643_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
MG826132_C_P-C      atggacattgacccttatatagaatttggagcttctgtggagatactctc---ttttttg
EU547559_C_P-C      atggacattgacccttataaagaatttggagcttctcccaaattactctc---ttttttg
DQ089768_C_P-C      atggacattgacccgtataaagaatttggagcttcttcggagttactctc---ttttttg
HM011495_C_P-C      atggacatygacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939601_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---atttttg
MG826140_C_P-C      atggacattgacgtgtataaagaatttggagcttctgtggagttactctc---atttttg
KX276844_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924619_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
JQ801500_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924642_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KJ598662_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598665_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598670_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598667_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598674_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598672_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598663_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598664_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598666_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598668_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598669_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598673_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598676_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598677_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598678_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598671_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924629_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562256_C_P-C      atggaccttgacacgtataaaccatttggagcttctgtggagttactctc---ttttttg
EU670263_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
GU721029_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
MG826137_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttaatctc---ttttttg
MG826139_C_P-C      atggacattgaccattataaagaatttggagcttctgtggagttactctc---gtttttg
MG826138_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---gtttttg
MG826136_C_P-C      atggacattgacccttataaagaatttggagctactgtggagttactctc---atttttg
MG826129_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---gtttttg
MG826128_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---gtttttg
MG826133_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---gtttttg
MG826134_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---gtttttg
MG826135_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---gtttttg
MG826131_C_P-C      atggacattgacccttataaagaatttggagcttctgtggaattactctc---gtttttg
AP011106_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
AP011107_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
AB111946_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB112063_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ027317_C_P-C      atggacattgacccgtataaagaatttggagcttctatggagttactctc---ttttttg
AB074755_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774321_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774361_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013883_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013878_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013885_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ctttttg
KC774221_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013819_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774288_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774253_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939625_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939626_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013993_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774306_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774302_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386631_C_P-C      atggacattgactcatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774282_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774303_C_P-C      atggacattgacccatataaagaatttggagcttctgtagagttactctc---ttttttg
KC774207_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774296_C_P-C      atggacattgacccgtataaagaatttggagcttctatggagttactctc---ttttttg
KR013818_C_P-C      atggacattgacgcatataaagaatttggagcttctgtggagttactctc---ttttttg
KR013817_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KC774325_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774308_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787451_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562323_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386664_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386623_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774304_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774300_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377591_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377529_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715341_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT364751_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774280_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774204_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774285_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT364752_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774330_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774298_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774351_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ027322_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB074047_C_P-C      atggacattgacccgtataaagaatttggcgcttctgcggagttactctc---ttttttg
KJ803754_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939552_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
EU498227_C_P-C      atggacattgacccgtataaagaatttggagcatccgtggagttactctc---ttttttg
JQ341545_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803823_C_P-C      atggacattgacccgtataaagaatttggagcatctgcggagttactctc---ttttttg
MG826126_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562288_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---atttttg
FJ386601_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---atttttg
FJ562334_C_P-C      atggacattgacgcatataaagaatttggagcttctgtggagttactctc---atttttg
MG826143_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KY470908_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470911_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803814_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803815_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803811_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803813_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801501_C_P-C      atggacattgacccgtataaagaatttggagcttctgtagagttactctc---ttttttg
FJ023571_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801487_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765839_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148563_C_P-C      atggacattgacccgtataaagaatttggcgcttctgtggagttactccc---ttttttg
JQ801488_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765852_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023655_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801522_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023641_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924615_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HM011491_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470916_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470913_C_P-C      atggacattgacccgtataaagaatttggagcttctgtagagttactctc---ttttttg
GQ924658_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc---ttttttg
JQ801481_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
JQ801483_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KY470918_C_P-C      atggacattgacccgtataaagaatttggagtttctgtggagttactctc---ttttttg
KY470906_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470909_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470912_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470914_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470915_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470910_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470907_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470917_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470920_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765836_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148525_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148462_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801504_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KP148534_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765827_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148537_C_P-C      atggacactgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ803759_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148572_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148543_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148575_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148560_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148540_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148520_C_P-C      atggacattgacccgtataaagaatttggagtttctgtggagttactctc---ttttttg
KP148483_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148491_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148476_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148470_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774228_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ801505_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF899336_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924623_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023654_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB300363_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148567_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148566_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148557_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148554_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148548_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148513_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KP148523_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148528_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148570_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765830_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148487_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttgctctc---ttttttg
KP148489_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148574_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148573_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148568_C_P-C      atggacattgacccgtataaagcatttggagcttctgtggagttactctc---ttttttg
KP148564_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148562_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148559_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148558_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148547_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148546_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148526_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148519_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148530_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148552_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148517_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148514_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148488_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148480_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148479_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148475_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148474_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148468_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148469_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148471_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148472_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctctctttttttg
KP148473_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148477_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctctctttttttg
KP148481_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148482_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148492_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148493_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148465_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148315_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148464_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023656_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023647_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU306685_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU306688_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU306689_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU306690_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU306691_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU306694_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924604_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148463_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148466_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148512_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148521_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148524_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148529_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148531_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148532_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148535_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148538_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148545_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148549_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148551_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148555_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148561_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP148571_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU306687_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013796_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KR013792_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KR013793_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KR013794_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KR013795_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KJ598720_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964238_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964243_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598737_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598730_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964230_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598727_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964235_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598721_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964242_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598736_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598726_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964236_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598725_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964237_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598722_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598733_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964241_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598735_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598731_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964229_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598723_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598728_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598729_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598734_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598738_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598739_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964231_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964232_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964233_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964234_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964240_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598724_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598732_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU964239_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
DQ536411_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ536413_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014368_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
DQ536410_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ536414_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562300_C_P-C      atggacattgacacgtataaaccatttggagcatctgtggagttactctc---ttttttg
KF495606_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HM011493_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KY629637_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774235_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX504537_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377555_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY629631_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173333_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963900_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963901_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963902_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963903_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963904_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963905_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963906_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963907_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963908_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963909_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963910_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963911_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963912_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963913_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963914_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470983_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470990_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470991_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470980_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470981_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470982_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470984_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470988_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470985_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470986_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470987_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY670782_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MG826127_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013841_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013840_C_P-C      atggacattgacccgtataaaggatttggagcttctgtggagttactctc---ttttttg
KR013837_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013839_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KR013835_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013838_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013836_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562225_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939573_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377545_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
KY363274_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT284757_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB198076_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttgctctc---ttttttg
FJ386672_C_P-C      atggacattgacccgtataaagaatttggatcttctgtggagttactctc---ttttttg
EU562218_C_P-C      atggacattgacccgtataaagaatttggagctactgtggagttactctc---ttttttg
FJ562268_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
KU964215_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377562_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HM750139_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964223_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KU964226_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KT284758_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377554_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715395_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715397_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377559_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377570_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774260_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774267_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964228_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964214_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964222_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KU964225_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964218_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964224_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964216_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964217_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964219_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964220_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964221_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964227_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765823_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924636_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KJ803765_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765845_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggaattactctc---ttttttg
JQ027320_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ358154_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX276854_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ855544_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023646_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023643_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023644_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ855528_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765819_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765847_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KX765855_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU679951_C_P-C      atggacattgacccttataaagaatttggagcttccgtcgagttactctc---ttttttg
KU679949_C_P-C      atggacattgacccttataaagaatttggagctwctgygsasttactctc---ctttttg
AB900109_C_P-C      atggacattgacccgtataaagaatttggagcttcttcgcagttactctc---ttttttg
KF873544_C_P-C      atggacattgaccmttataaagaatttggagcttctrtgcagttactctc---ttttttg
KX276831_C_P-C      atggacattgacgtctataaagaatttggagcmtccgtggagttactctc---ttttttg
AB115418_C_P-C      atggacattgacccgaataaagaattcggagcttctacggagttactctc---ttttttg
KC774240_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KM875412_C_P-C      atggacattgacccgtataaagaatttggcgcttcagtggagttactctc---ttttttg
KJ803790_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013870_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KR013871_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
GQ924622_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB241111_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
AB241110_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
EU410081_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
EU410079_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
EU410080_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
AP011100_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KM526745_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KM526744_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AP011099_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KM526746_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AP011101_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN827414_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JN827415_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ924620_C_C-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF241411_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF241410_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173335_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173336_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562329_C_P-C      atggacattgacccgtataaagaatttggagctcctgtggatatactttt---ttttttc
HM011481_C_P-C      atggacattgacccatataaagaatttggagcatctgtggagttactctc---ttttttg
KX276839_C_P-C      atggacattgacccatataaagaatttggagcatctgtggagttactctc---ttttttg
FJ023677_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023592_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023624_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023625_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023589_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023567_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023566_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023568_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023587_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023590_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
FJ023591_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
KU679947_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
KU679957_C_P-C      atggacattgacccttataaagaatttggagcttctgcggagttactctc---ttttttg
KF873520_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
KU679936_C_P-C      atggacattgaccmttataaagaatttggagcttctgtggagttactctc---ttttttg
KF873514_C_P-C      atggacattgacccktataaagaatttggagcttctgtggagttactctc---ttttttg
KF873516_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
AB670295_C_P-C      atggaccttgacccgtataaagaatttggagcttctgcggagttagtctc---ttttttg
AB195931_C_P-C      atggacatcgacccatataaagaatttggagcttctgctgagttactctc---ttttttg
AB195932_C_P-C      atggacatcgacccatataaagaatttggagcttctgctgagttactctc---ttttttg
AB113878_C_P-C      atggacatcgacccatataaagaatttggagcctctgctgagttactctc---ttttttg
AB195930_C_P-C      atggacatcgacccatataaagaatttggagcttctgctgagttactctc---ttttttg
AY167091_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc---ttttttg
MG826124_C_P-C      atggacattgacacgtataaagaatttggagcctctgcggagttactctc---ttttttg
KC774319_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KY363258_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386679_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KU667678_C_P-C      atggacatcgaccattataaagaatttggggcttctgtggagttactctc---ttttttg
KU576863_C_P-C      atggacatcgaccattataaagaatttggagcttctgtggagttactctc---ttttttg
KU576860_C_P-C      atggacatcgaccattataaagaatttggagcttctgtggagttactctc---ttttttg
KU576864_C_P-C      atggacatcgaccattataaagaatttggagcttctgtggagttactctc---ttttttg
KU576865_C_P-C      atggacatcgaccattataaagaatttggagcttctgtggagttactctc---ttttttg
KU667741_C_P-C      atggacatcgaccattataaagaatttggagcttctgtggagttactctc---ttttttg
KU668127_C_P-C      atggacatcgaccattataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377620_C_P-C      atggaccttgacccatataaagaatttggagcttcagtggagttactctc---ttttttg
FJ562221_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386614_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB670298_C_P-C      atggacattgacccgtataaagaatttggagcttctgccgagttactctc---ttttttg
KY470925_C_P-C      atggacattgacacatataaagaatttagagcttctgtggagttactctc---ttttttg
KY470926_C_P-C      atggacattgacgcatataaagaatttggagcttctgtggagttactctc---ttttttg
AB670242_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939548_C_P-C      atggacattgacccgtataaagaatttggagcttctatggagttactctc---ttttttg
FJ386677_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB367426_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367801_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ227692_C_P-C      atggacattgaccactataaagaatttggggcatctgtggagttactctc---ttttttg
GQ227697_C_P-C      atggacattgaccactataaagaatttggagcatctgtggagttactctc---ttttttg
GQ227696_C_P-C      atggacattgaccactataaagaatttggagcatctgtggagttactctc---ttttttg
GQ227693_C_P-C      atggacattgaccactataaagaatttggagcatctgtggagttactctc---ttttttg
GQ227694_C_P-C      atggacattgaccactataaagaatttggagcatctgtggagttactctc---ttttttg
GQ259588_C_P-C      atggacattgaccactataaagaatttggagcatctgtggagttactctc---ttttttg
GQ227695_C_P-C      acggacattgaccactataaagaatttggagcatctgtggagttactctc---ttttttg
JQ040131_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY206376_C_P-C      atggacattgacccgtataaagaatttggagcctctatggagttaatctc---ttttttg
AY206379_C_P-C      atggacattgacccgtataaagaatttggagcctctatggagttaatctc---ttttttg
AB300360_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB365451_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttaatctc---ttttttg
KR013769_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
JX026880_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
EU522071_C_P-C      atggacattgacccctataaagaatttggagcttctgtggagttactctc---ttttttg
AB014386_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576747_C_P-C      atggacattgaccattataaagaatttggagcttctgtggagttactctc---ttttttg
KR013777_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
AB195945_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562273_C_P-C      atggacattgacacctataaagaatttggagcttctgcggagttactctc---ttttttg
FJ386617_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386596_C_P-C      atggacattgacgcatataaagaatttggagcttccgtggagttactctc---ttttttg
FJ386687_C_P-C      atggacattgacgcatataaagaatttggagcttccgtggagttactctc---ttttttg
EU939654_C_P-C      atggacattgactcatataaagaatttggagcttctgtggagttactctc---ttttttg
EU939613_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562301_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
EU939562_C_P-C      atggacattgacccctataaagaatttggagcttctgtggagttactctc---ttttttg
AY206385_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670310_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363264_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899783_C_P-C      atggacattgacccgtataaagaatttggagctactgcggagttactctc---ttttttg
AB014372_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
FJ715422_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715424_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715392_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386659_C_P-C      atggacattgacmcstataaagaatttggagcttctgyggagttactctc---ttttttg
AB195946_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562306_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562264_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
EU939540_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY641562_C_P-C      atggacattgacccgtataaagaatttggagctactgtggagttactctc---ttttttg
KF214678_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377621_C_P-C      atggacattgacccctataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386604_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787437_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576929_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939579_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899774_C_P-C      atggacattgacccgtataaagaatctggagcttctgtggagttactctc---ttttttg
GQ475349_C_P-C      atggacattgacccctataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562325_C_P-C      atggacattgacgcatataaagaatttggagcttccgtggagttactctc---ttttttg
EU939592_C_P-C      atggacattgacccatataaagaatttggagcttctgcggagttactctc---ttttttg
GQ475356_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU963926_C_P-C      atggacattgacccgtataaagaatttggagcttcagtgcagttactctc---ttttttg
KU963920_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KU963915_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KU963916_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KU963918_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KU963919_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KU963921_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KU963922_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KU963923_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KU963924_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KU963925_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KU963927_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KU963928_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KU963929_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KU963917_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KC774340_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774313_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ872211_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
FJ562279_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939607_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939594_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
AB111114_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
AB042284_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
AB014365_C_P-C      atggacattgacccctataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562333_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787468_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
FJ787469_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
JX504536_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939614_C_P-C      atggacattgacccctataaagaatttggagcttctgtggagttactctc---ttttttg
AB670256_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB014392_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774284_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF436920_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU916218_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
GQ377593_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562299_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774245_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
JF828910_C_P-C      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828908_C_P-C      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828905_C_P-C      atggacattgacgcctataaagaatttggagcttctgtggagttactctc---ttttttg
JF828906_C_P-C      atggacattgacgcctataaagaatttggagcttctgtggagttactctc---ttttttg
JF828907_C_P-C      atggacattgacgcctataaagaatttggagcttctgtggagttactctc---ttttttg
JF828911_C_P-C      atggacattgacgcctataaagaatttggagcttctgtggagttactctc---ttttttg
JF828912_C_P-C      atggacattgacgcctataaagaatttggagcttctgtggagttactctc---ttttttg
AB367430_C_P-C      atggacattgacccgtataaagaatttggagcttctggcgagttactctc---ttttttg
AB111123_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX504542_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB111121_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB111122_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386689_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367398_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939570_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899764_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899761_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899765_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470880_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562307_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
EF536065_C_P-C      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc---ttttttg
EF536066_C_P-C      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013851_C_P-C      atggacattgacccgtataaagaatttggagcttctttggagttactctc---ttttttg
GQ475337_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
EU939593_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939538_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173445_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013850_C_P-C      atggacattgacccgtataaagaatttggagcttctttggagttactctc---ttttttg
AB697502_C_P-C      atggacattgacccgtataaagaatttggagcttctctggagttactctc---ttttttg
HQ700576_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700571_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700570_C_P-C      atggacattgacccttataaagaatttggagcttccgtggagttactctc---ttttttg
HQ700569_C_P-C      atggacattgacccttataaagaatttggagcttccgtggagttactctc---ttttttg
HQ700545_C_P-C      atggacattgacccttataaagaatttggagcttccgtggagttactctc---ttttttg
HQ700564_C_P-C      atggacattgacccttataaagaatttggagcttccgtggaattactctc---ttttttg
HQ700565_C_P-C      atggacattgacccttataaagaatttggagcttccgtggaattactctc---ttttttg
HQ700573_C_P-C      atggacattgacccttataaagaatttggagcttccgtggaattactctc---ttttttg
HQ700563_C_P-C      atggacattgacccttataaagaatttggagcttccgtggagttactctc---ttttttg
HQ700556_C_P-C      atggacattgacccttataaagaatttggagcttccgtggagttactctc---ttttttg
HQ700502_C_P-C      atggacattgacccttataaagaatttggagcttccgtggagttactctc---ttttttg
HQ700504_C_P-C      atggacattgacccttataaagaatttggagcttccgtggagttactctc---ttttttg
HQ700562_C_P-C      atggacattgacccttataaagaatttggagcttccgtggagttactctc---ttttttg
HQ700568_C_P-C      atggacattgacccttataaagaatttggagcttccgtggagttactctc---ttttttg
HQ700574_C_P-C      atggacattgacccttataaagaatttggagcttccgtggagttactctc---ttttttg
HQ700567_C_P-C      atggacattgacccttataaagaatttggagcttcagtggagttactctc---ttttttg
HQ700578_C_P-C      atggacatcgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700575_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700577_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700495_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700496_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700476_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700490_C_P-C      atggacattgaccattataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700456_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700544_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700555_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700558_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700561_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700566_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700572_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700559_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
X75665_C_P-C        atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700543_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700506_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
GQ358157_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700522_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
KC836842_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU939617_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
JX026888_C_P-C      atggacattgacccatataaagaatttggagcttcagtggagttactctc---ttttttg
AB670270_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB670308_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
GU827639_C_P-C      atggacatcgacccatataaagaatttggagcttcagtggagttactctc---ttttttg
AB367420_C_P-C      atggacattgacccatataaagaatttggagcttctgcggagttactctc---ttttttg
KU668000_C_P-C      atggacaccgacccatataaagaatttggagcttctgtggagttactctc---ctttttg
KU667964_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU667969_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactccc---ttttttg
KU667984_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU668013_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU668018_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386611_C_P-C      atggacatcgacccatataaagaatttggagcgtctgtggagttactctc---ttttttg
EU939653_C_P-C      atggacattgacccatataaagaatttggagcttctgcggagttaatctc---ttttttg
FJ386624_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
GQ372968_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB367406_C_P-C      atggacattgacccatataaagaatttggagcttcagtggagttactctc---ttttttg
KY363286_C_P-C      atggacattgacctatataaagaatttggagcttctgtggagttactctc---ttttttg
KY363287_C_P-C      atggacattgacctatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032333_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ctttttg
FJ386665_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU939569_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899788_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899789_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774242_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939615_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386671_C_P-C      atggacattgacacatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386678_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU577055_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU577062_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU577049_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU577057_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU577056_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU577051_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU577052_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040158_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475309_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR819180_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774225_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
HQ622095_C_P-C      atggacattgacccatataaagaatttggagcttctgcggagttactctc---ttttttg
EU562216_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU939582_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU916226_C_P-C      atggacattgacatatataaagaatttggagcttctgtggagttactctc---ttttttg
AB250109_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU939572_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
JX560519_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562282_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU916225_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377572_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787457_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttattctc---ttttttg
FJ787458_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB670253_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB195936_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB195937_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB195938_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU916223_C_P-C      atggacattgacccatataaagaatttggagcttctgtggaattactctc---ttttttg
JX560520_C_P-C      atggacattgacccatataaagaatttggagcttctgtggaattactctc---ttttttg
FJ562232_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386652_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB670281_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU562215_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU562217_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU916224_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377514_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
JN104440_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787442_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787443_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774194_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB198081_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
KC774215_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774216_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377528_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB670239_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB670240_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB367425_C_P-C      atggacattgacccatataaagaatttggagcttctatggagttactctc---ttttttg
MH891502_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB670273_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
MH887433_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB900116_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB367404_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB642100_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377577_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386588_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787481_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU589340_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU589341_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU589342_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
JX429914_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787449_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB198082_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377601_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KM229703_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
HQ700516_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---atttttg
KX276838_C_P-C      atggacattgacccgtataaagaatttggagcatctgcgrhgttactctc---ttttttg
AB642097_C_P-C      atggacattgacccgtataaagaatttggagcttctgtcgagttactctc---ttttttg
JQ027323_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
KF779327_C_P-C      atggacattgacacgtataaagaatttgaggcttcttgggagttactctc---ttttttg
KJ803762_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
JQ040139_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KF165568_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
D23682_C_P-C        atggacattgacccgtataaagaatttggagcttctgtggagttagtctc---ttttttg
D23683_C_P-C        atggacattgacccgtataaagaatttggagcgtctgtggagttagtctc---ttttttg
KJ410510_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
AY206378_C_P-C      atggacattgacacgtataaagaatttggagcatctgtggagttactctc---ttttttg
HM011502_C_P-C      atggacattgacccgtataaagaatttggagcatctgyggagttactctc---ttttttg
AB367432_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367804_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ027319_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
FJ562304_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY167096_C_P-C      atggacattgacccgtataaagaatttggagcatccgtggagttactctc---ttttttg
DQ089796_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
KJ173316_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
AB202071_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB202072_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939590_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939591_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939588_C_P-C      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899778_C_P-C      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040144_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089795_C_P-C      atggacattgacccatataaagaatttggagcatctgtggagttactctc---ttttttg
AB014361_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670291_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB367412_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013842_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013846_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013847_C_P-C      atggacattgacccgtataaagaatttggagcctctgcggagttactctc---ttttttg
KR013845_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013844_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013848_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013849_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HM750135_C_P-C      atggacattgacccgtataaagaatttggagcatccgtggagttactctc---ttttttg
FJ386627_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939651_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ751764_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
FJ751765_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
V00867_C_P-C        atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
FJ562284_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
AY206382_C_P-C      atggacattgacccgtataaagaatttggagcatctgcggagttactctc---ttttttg
AB670278_C_P-C      atggacattgacccgtataaagaatttggagcttctttggagttactctc---ttttttg
KC774229_C_P-C      atggacattgacccatataaagaatttggagcatctgtggagttactctc---ttttttg
JN104432_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
JN104433_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
EU939550_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
DQ478900_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
EU939553_C_P-C      atggacattgacmcgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367435_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386685_C_P-C      atggacattgacmcatataaagaatttggagcttctgyggagttactctc---ttttttg
EU939537_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
AB670301_C_P-C      atggacattgacccgtataaagaatttggagcttctacggagttactctc---ttttttg
KX276835_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
EU881996_C_P-C      atggacattgacccttataaagaatttggcgcatctgtggagttactctc---ttttttg
AB670266_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774311_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
JQ707729_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707719_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707716_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707707_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707709_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707710_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707711_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707712_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707713_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707715_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707717_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707718_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707720_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707721_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707722_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707723_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707724_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707725_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707726_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707727_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707728_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707730_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707731_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707732_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707733_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ707708_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670277_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377583_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HM750134_C_P-C      atggacattgacccgtataaagaatttggagcatccgtggagttactctc---ttttttg
AB670243_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014373_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670290_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ751770_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
FJ151413_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
KC774264_C_P-C      atggacattgacccgtataaagaatttggagcatccgtggagttactctc---ttttttg
JN315779_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386607_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ993693_C_P-C      atggacattgacccgtataaagaattcggagcatctgtggagttactctc---ttttttg
DQ478885_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
AY206389_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
HM750137_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
KC774343_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
FJ787467_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787466_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787464_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787465_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774265_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
KC774217_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715372_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
AB367803_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367416_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB033553_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715371_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
FJ715398_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
FJ715400_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
KC774190_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
AB033551_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB033552_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367396_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB033556_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
KJ790199_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
AB367417_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
KJ173327_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
DQ993690_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
GQ924633_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
KJ173446_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
KF873525_C_P-C      atggacattgacccttataaagaatttggagcttcagtggagttactctc---ttttttg
KF873526_C_P-C      atggacattgacccttataaagaatttggagcttcagtggagttactctc---ttttttg
AB900113_C_P-C      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc---ttttttg
JQ801498_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475343_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475352_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF323463_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562326_C_P-C      atggacatcgacccatataaagaatttggagcttctgcggaattactctc---ttttttg
EF494377_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014387_C_P-C      atggacattgacccatataaagaatttggagcttctgcggagttactctc---ttttttg
AB697510_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939583_C_P-C      atggacattgacccgtataaagaatttggagcttctgttgagttactctc---gtttttg
EU554540_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367392_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB113875_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---gtttatg
AB113876_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---gtttatg
AB367413_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB111113_C_P-C      atggacattgacccgtataaagaatttggagcttctgctgagttactctc---ttttttg
KF214651_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377599_C_P-C      atggacatcgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB485809_C_P-C      atggacattgacccgtataaagaatttggagcttcttcggagttactctc---ttttttg
AB485810_C_P-C      atggacattgacccgtataaagaatttggagcttcttcggagttactctc---ttttttg
KU668280_C_P-C      atggacattgacccgtataaagaattaggagcttctgtggagttactctc---ttttttg
KY363275_C_P-C      atggaccttgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY689435_C_P-C      atggacatcgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
KY689525_C_P-C      atggacatcgacccttataaagaatttggagcttctgtrgagttactctc---ttttttg
EU939648_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367410_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828937_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363280_C_P-C      atggacattgacccgtataaagaatttggagcttctttggagttactctc---ttttttg
JQ040152_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939616_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY247031_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939587_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367427_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774238_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670294_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670305_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
JX036339_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactttc---gtttttg
KC774211_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX036335_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
JX036336_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
JX036337_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
KC774277_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774254_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774256_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774213_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774214_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774335_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774191_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
HM750136_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774283_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774189_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MH094411_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386575_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU916216_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774287_C_P-C      atggacattgacccatataaagaatttggagcgtctgtggagttactctc---ttttttg
KC774187_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KC774352_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KC774338_C_P-C      atggacattgacccgtataaagaatttggagcatccgtggagttactctc---ttttttg
FJ386630_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY363281_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774309_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774247_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032331_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---tttttta
JX661490_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386603_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774181_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
HM750141_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279274_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774342_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040166_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386576_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY247032_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB026815_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU560440_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
EU579442_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
KC774196_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774336_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562318_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562330_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470887_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470882_C_P-C      atggacattgacccgtataaagaatttggggcttctgtggagttactctc---ttttttg
KY470885_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774337_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774299_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774278_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774200_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774205_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774208_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774182_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377541_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377533_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367424_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB198078_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU916237_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC875261_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774261_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774262_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013852_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC875263_C_P-C      atggacattgacccgtataaagaatttggagctcctgtggagttactctc---ttttttg
KC774345_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475317_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386639_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
GQ475314_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475319_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC875262_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ475316_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670238_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU916238_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040127_C_P-C      atggacattgacccgtataaagaatttggagcttctgykgagttactctc---ttttttg
EU939657_C_P-C      atggacatcgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
AB014371_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899795_C_P-C      atggacattgacacatataaagaatttggagcttccgtggagttactctc---ttttttg
KJ410521_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562331_C_P-C      atggacattgacacctataaagaatttggagcktctgtggagttactctc---ttttttg
KU576449_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
GQ377586_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899793_C_P-C      atggacattgacacgtataaagaatttggagcttccgtggagttactctc---ttttttg
FJ899794_C_P-C      atggacattgacacgtataaagaatttggagcttccgtggagttactctc---ttttttg
AY220702_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU939585_C_P-C      atggacattgacctatataaagaatttggagcttccgtggagttactctc---ttttttg
FJ386621_C_P-C      atggacattgacacatataaagaatttggagcttccgtggagttactctc---ttttttg
GQ377557_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU576454_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
FJ032346_C_P-C      atggacatcgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
FJ032347_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
KR013942_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KR013789_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KR013788_C_P-C      atggacattgacccatataaagaatttggagcttctatggagttactctc---ttttttg
KR013790_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KU576453_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
DQ089794_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU939649_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562295_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU939566_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173439_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173440_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774266_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
JX429909_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089793_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
JX429907_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774195_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040129_C_P-C      atggacattgacccatataaagaatttggagcttcctcagagttactctc---ttttttg
KU576455_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
KU576457_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
FJ787471_C_P-C      atggacattgaccactataaagaatttggagcttccgtggagttactccc---ttttttg
FJ032355_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032356_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787470_C_P-C      atggacattgaccactataaagaatttggagcttccgtggagttactctc---ttttttg
FJ386641_C_P-C      atggacattgacccatataaagaatttggagcttcckcggagttactctc---ttttttg
EU939658_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
KC774331_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
EU939571_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU439013_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
FJ715383_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttctg
FJ715403_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttctg
FJ715407_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttctg
FJ715409_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttctg
FJ715382_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttctg
FJ715402_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttctg
FJ715381_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttctg
FJ715421_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttctg
JX429913_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU306725_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU439014_C_P-C      atggacattgacccatattaagaatttggagcttccgtggagttactctc---ttttttg
EU439005_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU306722_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
DQ377163_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU306727_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU306719_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
DQ377165_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactccc---ttttttg
DQ377162_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
DQ377161_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU306713_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU306714_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU306720_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU306721_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU306729_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
DQ377164_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
DQ377160_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU439012_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU439009_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU439008_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU306724_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU306726_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU306728_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU439010_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU439011_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU439025_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
FJ562285_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
JQ040141_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
GQ377598_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF674429_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX661488_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939652_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU916213_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
GQ377527_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
FJ562332_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
FJ562233_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU916211_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU916214_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
KR013791_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
KC774339_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KC774289_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
FJ386587_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
EU916212_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
FJ032332_C_P-C      atggacattgacccatataaagaatttggagcttccgtggagttactctc---ttttttg
FJ562335_C_P-C      atggacattgacccgtataaagaatttggagcttctttgcagttactctc---ttttttg
FJ562337_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040167_C_P-C      atggacattgaccactataaagaatttggagcttcagtggagttactctc---ttttttg
JQ040149_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU668050_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040132_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR014007_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KR014002_C_P-C      atggacattgacacctataaagaatttggagcttctgcggagttactctc---ttttttg
KR014005_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KR014000_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KU964343_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377609_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ980549_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562339_C_P-C      atggacattgacmcgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939555_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386662_C_P-C      atggacattgacctgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386644_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670304_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963937_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386612_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386661_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU717215_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AY206381_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB367428_C_P-C      atggacattgacccgtataaagaatttggagcttctgtcgagttactctc---ttttttg
AB675674_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
AB675675_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
DQ922651_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939586_C_P-C      atggacattgaccattataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562238_C_P-C      atggacattgacctgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU570073_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU570074_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014388_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX661497_C_P-C      atggacattgaccattataaagaatttggagcttctgtggagttactctc---ttttttg
AB111118_C_P-C      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
FJ562251_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939567_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR014048_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctt---ttttttg
AY220699_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY220700_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562266_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ975274_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774357_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX504539_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562315_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562291_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---gtttttg
FJ386657_C_P-C      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939564_C_P-C      atggacatcgacccctataaagaatttggagcttctgtggagttactctc---ttttttg
EU796069_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014364_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939556_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377543_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964324_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964332_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964321_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964323_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964326_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964328_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964329_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964318_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964319_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964320_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964322_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964325_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964327_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964330_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964331_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964333_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787459_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagtctctctc---ttttttg
FJ715343_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367434_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
EU871971_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF182805_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF182802_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF182803_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU871969_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR014041_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562272_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KY470975_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KY470966_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ctttttg
KY470978_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470976_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470971_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470972_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470967_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470965_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470969_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470974_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470968_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470970_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470973_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470977_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470979_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR014092_C_P-C      atggacattgaccactataaagaattcggagcttctgtggagttactctc---ttttttg
FJ787484_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562313_C_P-C      atggacattgacacgtataaagaatttggagcttccgtggagttactctc---ttttttg
DQ986376_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013814_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013812_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013809_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013810_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013811_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013813_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013815_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173295_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774320_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
JQ040154_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
FJ518810_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386598_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032338_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939554_C_P-C      atggacattgaccattataaagaatttggagcttctgtggagttactctc---ttttttg
AB198083_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
AB014381_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
DQ986375_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
DQ975273_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ980550_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367414_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367407_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB300372_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
AB670269_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB300359_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670282_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670307_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279275_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279276_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC318702_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC318703_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377580_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899777_C_P-C      atggacattgacacgtataaagaatttggagcgtccgtggagttactctc---ttttttg
FJ562308_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562269_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562245_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774360_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715406_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttaccctc---ttttttg
FJ715404_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttaccctc---ttttttg
FJ715380_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715377_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715378_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715379_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU554541_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU554542_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032345_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963996_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964002_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963992_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963997_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964076_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964078_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964064_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964065_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964066_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964067_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964068_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964069_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964070_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964071_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964072_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964073_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964074_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964075_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964334_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964336_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964337_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964338_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964339_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964340_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964341_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964342_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964344_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964345_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964346_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964347_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964348_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964077_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939543_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562340_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881803_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KR013772_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173433_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173434_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774359_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774314_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774286_C_P-C      atggacattgacccgtataaagaatttggagctactgtggagttactctc---ttttttg
GQ377617_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032350_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032351_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939557_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ922649_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY596108_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
AB014396_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173311_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173312_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715405_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715376_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715375_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715374_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715389_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173317_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX026884_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377636_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU916217_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU717218_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KR013771_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU439015_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KU964046_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964034_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964035_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964036_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964037_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964038_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964039_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964040_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964041_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964042_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964043_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964044_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964047_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964048_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964045_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032334_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715355_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715357_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715358_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787453_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787454_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AB288026_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
LC373511_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
LC373512_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
AB050018_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB367397_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013866_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173431_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173432_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173296_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963898_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963886_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963887_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963888_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963889_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963890_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963892_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963893_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963894_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963895_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963896_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963897_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963899_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963891_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279246_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
KU964180_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR014006_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013875_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013803_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013802_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774310_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774281_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774237_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774224_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX661495_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX429918_C_P-C      atggacattgacccgtatgaagaatttggagcttctgtggagttactctc---ttttttg
JX429915_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040162_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377538_C_P-C      atggacattgacccgtataaagagtttggagcttctgtggagttactctc---ttttttg
GQ377524_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715344_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386653_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386619_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386618_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939642_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
EU872008_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670311_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU871975_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU871977_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173391_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173392_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
D28880_C_P-C        atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
S75184_C_P-C        atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB195952_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB195953_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB195954_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774271_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
JX504534_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562292_C_P-C      atggacattgacctatataaagaatttggagcttctgtggagttactctc---ttttttg
DQ089799_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787479_C_P-C      atggacattgacccgtataaagaatttggggcttctgtggagttactctc---ttttttg
FJ787439_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787441_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715342_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774290_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562327_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386591_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MG893558_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386579_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
AB014391_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386597_C_P-C      atggacattgacccgtataaagaattcggagcttctgtggagttactctc---ttttttg
KJ173435_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377637_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173436_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963882_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU963871_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU963877_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU963878_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU963880_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU963885_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU963872_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU963873_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KJ173293_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173294_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173315_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
MG893560_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279261_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279250_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC090200_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881880_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964198_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964004_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT284755_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013984_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013808_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013773_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173331_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173332_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173302_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774356_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774326_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774315_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774249_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173441_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX661496_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX661493_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX429916_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GU434374_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377632_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377551_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ518813_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
FJ386637_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032361_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032339_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939611_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU872010_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU871982_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF363961_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB299858_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
AB426467_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
AB198079_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014395_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014385_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KY881737_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881744_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881765_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173328_C_P-C      atggacattgacccgtataaagaatttggagcatctgtggagttactctc---ttttttg
AY206384_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881736_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881738_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881739_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881742_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881743_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881748_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881749_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881750_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881751_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881754_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881755_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881758_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881762_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881763_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881764_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881766_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881767_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881768_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881769_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881770_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881771_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881772_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881773_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881774_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881775_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881776_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881777_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX429906_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173429_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173430_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173442_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670254_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279245_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279258_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881980_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881984_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013909_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013908_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013776_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598697_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598691_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598689_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598694_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598698_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598699_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173427_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173428_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774292_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774210_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774203_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386667_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032336_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939619_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF458664_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB300365_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562244_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX429904_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774295_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774312_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173281_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173282_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173289_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173291_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173292_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173301_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173303_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173304_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173395_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173396_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598688_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598690_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598695_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598696_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598701_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598740_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598749_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598753_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013774_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014362_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
D23680_C_P-C        atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279259_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279260_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
LC279262_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB246345_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939580_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787461_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377628_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562281_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562290_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964191_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctn---ntttttg
GQ377546_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774248_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173307_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173308_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173309_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173310_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173443_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173444_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964181_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964176_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013998_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013858_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173306_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173305_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040145_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
HM750140_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377624_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377584_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562258_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386595_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386577_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU916215_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB111119_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB111120_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX504545_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774318_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173321_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013827_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013873_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013877_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964169_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964170_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964171_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964174_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964178_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964183_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964184_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964187_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964188_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964192_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964193_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964194_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964195_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964196_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964197_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964199_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB026811_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB026812_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB026814_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB026813_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386640_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU577024_C_P-C      atggacattgacccgtataaaaaatttggagcttctgtggagttactctc---ttttttg
EU939599_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---gtttttg
KU667409_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KU576858_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576118_C_P-C      atggacattgacccgtataaaggatttggagcttctgtggagttactctc---ttttttg
KU576951_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576920_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---tttttcg
KU576919_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576688_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576627_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576588_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576586_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576581_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576122_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576117_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576643_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576580_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576584_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU577106_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576833_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576696_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576677_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576631_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576422_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576142_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576115_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576116_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576119_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576120_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576121_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576124_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576143_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576144_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576503_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576585_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576615_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576635_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576642_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576644_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576697_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576752_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576763_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576835_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576838_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576899_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576937_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576941_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU576123_C_P-C      atggacattaacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014383_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU872013_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
AB642095_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939596_C_P-C      atggacattgacccgtataaagaatttggagcctctgcggagttactctc---ttttttg
KY689518_C_P-C      atggacatcgaccactataaagaatttggagcttccgtggagttactctc---ttttttg
AY206392_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939645_C_P-C      atggacactgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
FJ562324_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KR014059_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013862_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR014057_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386594_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
EU717212_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---atttttg
FJ386663_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KY881816_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KY881805_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KY881809_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KY881819_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KY881812_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KY881813_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KY881810_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KY881802_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---atttttg
KY881806_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KY881807_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KY881818_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KY881814_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KY881815_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---atttttg
KY881804_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KY881811_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
KY881817_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---atttttg
AB300368_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939544_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX026885_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562242_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX429912_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377597_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ922650_C_P-C      atggacattgacccgtataaagaatttggggcttcagtggagttactctc---ttttttg
AB642099_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386670_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MG893553_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT284754_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787447_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562276_C_P-C      atggacatcgacccatataaagaatttggagcttccgtggagttaatctc---ttttttg
EU939574_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KC774347_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013831_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013828_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013833_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013832_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013829_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013830_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013834_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KP784761_C_P-C      atggacattgacccgtataaagaatttggagcttcagtggagttactctc---ttttttg
KJ598717_C_P-C      atggacattgactcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598705_C_P-C      atggacattgactcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598706_C_P-C      atggacattgactcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598707_C_P-C      atggacattgactcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598708_C_P-C      atggacattgactcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598709_C_P-C      atggacattgactcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598711_C_P-C      atggacattgactcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598712_C_P-C      atggacattgactcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598713_C_P-C      atggacattgactcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598714_C_P-C      atggacattgactcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598715_C_P-C      atggacattgactcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598718_C_P-C      atggacattgactcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598719_C_P-C      atggacattgactcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598681_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774327_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377640_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377521_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377515_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562275_C_P-C      atggacattgacccctataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562274_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB471848_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB471850_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU554535_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939604_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032340_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032341_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377574_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377615_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377619_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377642_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774268_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774276_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598710_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598716_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB471849_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014382_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013861_C_P-C      atggacattgacccgtataaagaatttggagcttctacggagttactctc---ttttttg
KR013859_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KR013860_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KR014055_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR014060_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774301_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774269_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---gtttttg
FJ386613_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF411410_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014384_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU871980_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU871998_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377526_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939618_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB195947_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB195948_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774199_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
JF828923_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828921_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828922_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828928_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828924_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828925_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828926_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828929_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828930_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JF828931_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KT284759_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
D23681_C_P-C        atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB670276_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014399_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939545_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173337_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX504541_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB014380_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670289_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562249_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB014379_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787462_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787463_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KM875423_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU871974_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU871970_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU871972_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF182804_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ151414_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ788835_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU871973_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562220_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386628_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386651_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
FJ787485_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787482_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787483_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881972_C_P-C      atggacattgaaccgtataaagaatttggagcttctgtgaagttactctc---ttttttg
AY269099_C_P-C      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc---ttttttg
KY881962_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KY881990_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KY881889_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KY881994_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881991_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881989_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881891_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881887_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881886_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881881_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881875_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881884_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
KY881960_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
KY881971_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881978_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY882002_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY882001_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881997_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881979_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881961_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881890_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881888_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881876_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881874_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881871_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881966_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY882003_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881988_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881885_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881878_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881987_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881974_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881892_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881882_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881883_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881870_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881872_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881981_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881993_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881877_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881873_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881879_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881973_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU668181_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU668135_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
MF568467_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY689471_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU919169_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013863_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377575_C_P-C      atggacattgacccgtataaagaatttagagcttctgtggagttactctc---ttttttg
KJ598772_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598780_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013865_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU871978_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU871979_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939655_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939656_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KF166858_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964016_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964011_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964012_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964013_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964017_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964018_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964019_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964015_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032359_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ032360_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670261_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013867_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU919168_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013864_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KJ173290_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562293_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KR013869_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013805_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964014_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013804_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013807_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF384371_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU560441_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787486_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899776_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF384372_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ980551_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF411412_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB014393_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU872001_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU872003_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU872000_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU872002_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU872004_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562228_C_P-C      atggacattgacccgtataaagaatttggagcttctgcagagttactctc---ttttttg
KY363266_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY363267_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
EU579443_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU589336_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU668271_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KR013868_C_P-C      atggacattgacgcctataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040168_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377608_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939595_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
DQ975272_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB900099_C_P-C      atggacattgacccgtataaagaatttggagcttctgctgagttactctc---ttttttg
AF458665_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939546_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562239_C_P-C      atggacattgacctatataaagaatttggagcttctgtggagttactctc---ttttttg
AB014369_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939659_C_P-C      atggacattgacgcctataaagaatttggagcttctgtggagttactctc---ttttttg
KR014098_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KR014099_C_P-C      atggacattgacccgtataaagaatttggagcttctgctgagttactctc---ttttttg
KR013874_C_P-C      atggacattgacccgtataaagaatttggggcttctgctgagttactctc---ttttttg
KR013872_C_P-C      atggacattgacccgtataaagaatttggagcttctgctgagttactctc---ttttttg
KR013876_C_P-C      atggacattgacccgtataaagaatttggagcttctgctgagttactctc---ttttttg
EU939644_C_P-C      atggacattgacgcctataaagaatttggagcttctgtggagttactctc---ttttttg
KU964200_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU964202_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU964203_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU964205_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU964206_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU964209_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU964212_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU964201_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU964204_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU964207_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU964208_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU964210_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU964211_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU964213_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
EU939605_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB014397_C_P-C      atggacattgacacttataaagaatttggagcttctgtggagttactctc---ttttttg
EU916233_C_P-C      atggacattgacacctataaagaatttggagcgtctgtggagttactctc---ttttttg
EU916234_C_P-C      atggacattgacacctataaagaatttggagcgtctgtggagttactctc---ttttttg
FJ386645_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ173319_C_P-C      atggacattgacccgtataaagaatttggagcttctttggagttactctc---ttttttg
FJ787452_C_P-C      atggatattgacgtgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964185_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964186_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964189_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964190_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562235_C_P-C      atggacattgacccgtataaagaatttggagcttctggggagttactctc---ttttttg
EU916227_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU522069_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactcac---ttttttg
AB670241_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562252_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040172_C_P-C      atggacattgacmcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881992_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881983_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881968_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881928_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386574_C_P-C      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY881976_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881938_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881939_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881940_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881941_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881942_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881943_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881964_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881996_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881959_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881969_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881977_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881963_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881915_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881916_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881918_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881919_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881921_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881922_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881923_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881924_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881925_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881926_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881927_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881929_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881930_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881931_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881932_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881933_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881934_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881935_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881936_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881965_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881975_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881982_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881985_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881986_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881995_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881998_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY882000_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881917_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881967_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881970_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881999_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881920_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
KY881937_C_P-C      atggacattgaccactataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386632_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964349_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964358_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU964363_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562270_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939561_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939609_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598679_C_P-C      atggacattgacacgtataaagaatttggagcttctgcggagttactctc---ttttttg
KJ598686_C_P-C      atggacattgacacgtataaagaatttggagcttctgcggagttactctc---ttttttg
EU939576_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU554536_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598680_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598687_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ899771_C_P-C      atggacattgacccgtataaagaatttggagcttctggagagttactctc---ttttttg
EU939563_C_P-C      atggacattgacccgtataaagaatttggagcttctggagagttactctc---ttttttg
FJ899769_C_P-C      atggacattgacccgtataaagaatttggagcttctggagagttactctc---ttttttg
FJ899770_C_P-C      atggacattgacccgtataaagaatttggagcttctggagagttactctc---ttttttg
AF411408_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
AF411411_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
EU796070_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
EU796072_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
D23684_C_P-C        atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
EU871976_C_P-C      atggacattgacccatataaagaatttggagcttctgcggagttactctc---ttttttg
DQ089800_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB670249_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939610_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774358_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
EU939560_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU717217_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
KJ598744_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598747_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598741_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598742_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598746_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598748_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598751_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598754_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598743_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598750_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KJ598752_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU522068_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY306136_C_P-C      atggacattggcccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AY167090_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939584_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KU963879_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU963884_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU963874_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU963875_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU963876_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KU963881_C_P-C      atggacattgacccgtataaagaatttggagcttccgtggagttactctc---ttttttg
KC774218_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
AY066028_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX429903_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562248_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
EU560438_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---gtttttg
EU560439_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
EU570072_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---gtttttg
FJ562261_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787455_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
EU939646_C_P-C      atggacattgacacgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939568_C_P-C      atggacattgaccactataaagaatttggagcttctggagagttactctc---ttttttg
FJ787456_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
FJ562265_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386650_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715391_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
FJ715351_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
FJ715368_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
FJ715418_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
FJ715390_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
AB205123_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774231_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AB198080_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715352_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715353_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715365_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715370_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774333_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715359_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
FJ715360_C_P-C      atggacattgacccgtataaagaatttggagcttctgcggagttactctc---ttttttg
FJ715415_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ715416_C_P-C      atggacattgacccgtataaggaatttggagcttctgtggagttactctc---ttttttg
EU939603_C_P-C      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386592_C_P-C      atggacattgacccgtataaagaatttggagcttctttggagttactctc---ttttttg
EU939640_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013800_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KR013969_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KR013975_C_P-C      atggacattgacacctataaagaatttggagcttctgtggagttactctc---ttttttg
KR013801_C_P-C      atggacattgacccgtatatagaatttggagcttctgtggagttactctc---ttttttg
GQ377530_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ787445_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF461357_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
AF461363_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013974_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JQ040163_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ386609_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470900_C_P-C      atggacgttgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470894_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470895_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470897_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470899_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470901_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470902_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470903_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470904_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470905_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KY470896_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KC774293_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
KC774239_C_P-C      atggacattgacccatataaagaatttggagcttctgtggagttactctc---ttttttg
JX504546_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
EU939600_C_P-C      atggacattgacccttataaagaatttggagcttctgtggagttactctc---ttttttg
EU916210_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggtgttactctc---ttttttg
KC774241_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---gtttttg
AB198077_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377578_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
FJ562283_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
GQ377579_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX429917_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
JX504544_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
KR013799_C_P-C      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttg
                                     *                                    *     

FJ562286_C_P-C      acgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatc
KC774226_C_P-C      ccttctgacttttttcttttttttcaaaatctcctcaacac------------cccctct
HM042269_C_P-C      ccttctgacttctttccttcagtacgagatcttcttgatac------------cgcctca
KC774179_C_P-C      ccttctgacttctttccttcagtacgagatcttctcgacac------------cgcctca
KC774297_C_P-C      ccttctgacttctttccttcagtacgagatcttctcgacac------------cgcctca
HM011479_C_P-C      ccttctgacttctttccttctrttcgagatctcatcgacac------------cgcctct
KX276837_C_P-C      ccttctgacttctttccttctrttcgagatctcatcgacac------------cgcctcw
MF488703_C_P-C      ccttctgatttctttccgtctgtccgagatcttctaggaac------------cgccgct
KX276850_C_P-C      ccttctgacttytttccgtctattcgggatctcctcgacac------------cgcctct
JQ801508_C_P-C      cctcaggacttttttccgaatgttcgggatctcctcgacac------------cgccact
JQ801517_C_P-C      cctgatgacttttttccatctgttcgggatctcctcgacac------------cgcctca
MF925403_C_P-C      ccttctgacttctttccgtctgttcgggatctccttgacac------------cgcctct
JQ801523_C_P-C      ccttctgacttctttccgtctcttctggatcccctctacac------------cgcctct
KT347089_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcaact
KX276849_C_P-C      ccttctgacttctttccgtctgttcgggatctcctcgacac------------cgcctct
DQ089804_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgccact
HM011468_C_P-C      ccttctgacttctttccgactattcgggatctcctcgacac------------cgcatct
GQ184326_C_P-C      ccttctgacttttttccgtctatacgggatctcctcgacac------------cgcattt
JQ801515_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgccact
KJ803776_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
JQ801518_C_P-C      ccttctgacttctttccgtctgttcgggatctcctcgacac------------cgcctct
KF214670_C_P-C      ccttctgacttctttccgaatgtacgggacctcctcgacac------------cgcctct
KJ803812_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
AB112066_C_P-C      ccttctgacttctttccgtctgttcgggatctcctcgacac------------tgcctct
JQ801499_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcatct
MG826122_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcccaa
JQ801480_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MF488701_C_P-C      cctaaagacttctttccgtctgttcgggatctcctcgacac------------cgcatct
FJ023652_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
JQ429078_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KC315399_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
DQ361526_C_P-C      ccttctgacttttttccgtctattcgggatctcctcgacac------------cgcctct
MF925405_C_P-C      ccttctgacttctttccgtctattcgtgatctcctcgacac------------cgcctct
KF214667_C_P-C      ccttctgacttctttccgtctgttcgggatctcctcgacac------------cgcctct
KJ803760_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
FJ023651_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KJ803757_C_P-C      ccttctgacttttttccgtctattcgggatctcctcgacac------------cgcctct
GQ924650_C_P-C      cctactgacttctttccgaatattcgagatctcctcgacac------------cgcctct
AB112408_C_P-C      ccttctgactactttccgtctattcgggatctcctcgacac------------cgcctct
KX276847_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KF214671_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgatac------------cgcctcc
MF925395_C_P-C      ccttctgacttctttccgtctgttcgggatctcctcgacac------------cgcctct
JQ801510_C_P-C      ccttctgacttctttccgtctattcgggatcttctcgacac------------cgcctct
JQ801491_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------tgcctct
FJ023648_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
AB112348_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcttct
KX765822_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
DQ361534_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KF214669_C_P-C      ccttctgacttctttccgtcaattcgggatctcctcgacac------------tgcctct
JQ801472_C_P-C      ccttctgacttctttccgtctattcgggatctactcgacac------------cgcctct
MF925374_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
MF925369_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
JQ801503_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
GQ855541_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcttct
GQ358153_C_P-C      ccttctgacttctttccgtctattcgggatctccttgacac------------cgcctct
FJ023639_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KT366464_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KF214677_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgccgcc
DQ089803_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
GQ855534_C_P-C      ccttctgacttttttccttctattcgggatctcctagacac------------cgcttca
KX765821_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------tgcctca
JN827423_C_P-C      ccttctgacttttttccgtctattcgggatctcctcgacac------------cgcctca
JN827418_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctca
EF384201_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctca
KX765850_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcttca
KX765844_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctca
JQ801519_C_P-C      ccttctgacttctttccgtctattcgggatctccttgacac------------cgcctca
JQ801482_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctca
JQ801475_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctca
JN827424_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctca
JN827425_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctca
KX765848_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctca
JN827421_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctca
KX765825_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctca
JQ801497_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctca
MF925394_C_P-C      ccttctgacttttttccgtctgttcgggatctcctcgacac------------cgcctct
MF925367_C_P-C      ccttctgacttctttccgtctattcgtgatctcctcgacac------------cgcctct
KF214673_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765828_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------tgcctct
MH220971_C_P-C      ccttctgacttctttccgaatattcgggatctcctcgacac------------cgcctct
KJ803792_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
KF214675_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcttct
JQ801520_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KF214672_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KC875271_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KC875265_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KC875264_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgccact
KC875273_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgccact
KC875269_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KC875274_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KC875267_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KC875270_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KC875272_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KC875268_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
DQ315782_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KF214676_C_P-C      ccttctgacttctttccgtcgattcgggatctcctcgacac------------cgcctct
JQ801489_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MF925359_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KY470937_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX774506_C_P-C      ccttctgacttttttccgtctattcgggatctcctcgacac------------cgcctct
JQ801511_C_P-C      ccttctgacttctttccatctattcgggatctcctcgacac------------cgcctct
FJ023645_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
AB117758_C_P-C      ccttctgacttctttccatctattcgggatctcctcgacac------------cgcctct
AB074756_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765840_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KT364719_C_P-C      ccttctgacttttttccgtctattcgggatctccttgacac------------agcctct
KT364720_C_P-C      ccttctgacttttttccgtctattcgggatctccttgacac------------agcctct
KT307719_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KT307718_C_P-C      ccttctgatttctttccgtctattcgggatctcctcgacac------------cgcctct
KT364718_C_P-C      ccttctgatttctttccgtctattcgggatctcctcgacac------------cgcctct
KT987426_C_P-C      ccttctgatttctttccgtctattcgggatctcctcgacac------------cgcctct
KU051427_C_P-C      ccttctgatttctttccgtctattcgggatctcctcgacac------------cgcctct
KT987423_C_P-C      ccttctgatttctttccgtctattcgggatctcctcgacac------------cgcctct
GQ924616_C_P-C      ccttctgacttctttccgtctattcgggacctcctcgacac------------cgcctct
JQ801513_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765826_C_P-C      ccttccgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MF925378_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MF925387_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MF925398_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
JQ801509_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KJ803780_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MK286461_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765843_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765842_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KF214668_C_P-C      ccttctgacttttttccgtctattcgggatctcctcgacac------------cgcctct
JQ801496_C_P-C      ccttctgacttttttccatctattcgggatctcctcgacac------------cgcctct
JQ801473_C_P-C      ccttctgacttctttccgtccattcgggatctcctcgacac------------cgcctct
GQ924609_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
GQ855548_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------tgcctct
DQ315781_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
DQ315783_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MF925409_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
GQ855523_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KT987424_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
GQ924612_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
GQ924613_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KT987425_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KU051423_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MF925410_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MG725248_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
JQ801486_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX774504_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MK628732_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MF925406_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MF925376_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MF925375_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MF925365_C_P-C      ccttctgacttctttccgtctattcgtgatctcctcgacac------------cgcctct
KY470936_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765834_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765829_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KT366463_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KT364721_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KJ803818_C_P-C      ccttctgacttctttccgtctattcgggatctcctggacac------------cgcctct
JQ801502_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
JQ801493_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
FJ023658_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
FJ023657_C_P-C      ccttccgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KU051424_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765851_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KJ803800_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
GQ924649_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
GQ924614_C_P-C      ccttctgacttttttccgtctattcgggatctcctcgacac------------cgcctct
JN827422_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KU051426_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MF925377_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
MF925408_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX774503_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765853_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765849_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765837_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765833_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765818_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KU051425_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KC774236_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
JN827420_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
JN827416_C_P-C      cctgctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
FJ023649_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
FJ023642_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
AF068756_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
AB247916_C_P-C      ccttctgatttctttccgtctattcgggatctcctcgacac------------cgcctct
GU563561_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
JN827417_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
JQ801470_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KJ803799_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765820_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765831_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765832_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765838_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX765846_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KX276855_C_P-C      ccttctgacttctttccaaatattcgagatctcctcgacac------------cgcctca
KF873536_C_P-C      ccttctgatttctttccatctattcgagatcttctcgacac------------cgccgcc
KU679937_C_P-C      ccttctgatttttttccgtctattcgagatcttctcgacac------------tgcatcc
KU679960_C_P-C      ccttctgatttctttccatccattcgagatcttctcgacac------------cgccgcc
JQ027324_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KX276836_C_P-C      cctkctgacttctttccttcgattcgagatctcctcgacac------------cgccact
EU939539_C_P-C      cctaatgacttctttccttctgctcgcgatctcctcgacac------------cgccact
AB670274_C_P-C      ccttctgatttctttccttctattcgagatctccttgacac------------cgcatct
EU547562_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
EU717214_C_P-C      ccttcggacttttttccttctattcgcgatctccttgacac------------cgcctct
EU872005_C_P-C      ccttctgacttttttcctcctgttcgcgatctccttgacac------------cgcctct
GQ377552_C_P-C      ccttctgacctctttccttttattcgagatattctggacag------------gggcgat
KJ803777_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccgct
GU357845_C_P-C      cctcctgacttttttccttctactcgagacctcattgacac------------cgcctct
AB176642_C_P-C      ccttctgacttctttccttctgctcgagatctcctcgacac------------cgcctct
KJ803809_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377623_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AB670263_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598760_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598762_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KX276833_C_P-C      cctttggacttctttccttctattcgagagctcctcgacac------------cgcctct
AB670268_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctcc
KR013778_C_P-C      cctattgacttctttccttccgttcgagatctcatcgacac------------cgcctct
AB670255_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB300373_C_P-C      cctcatgacttctttccttctattcgagatctcctcgacac------------tgcctct
EU939643_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgccttt
FJ562280_C_P-C      ccttctgacttytttccttccattcgagatctcctcgacac------------cgcctct
EU939542_C_P-C      ccttctgacttctttccgtctgttcgagatctcctcgacac------------cgcctct
FJ899767_C_P-C      ccttctgacttctttccgtctgttcgagatctcctcgacac------------cgcctct
KF485390_C_P-C      ccttctgacttctttccttmtattcgagatctcctcgacac------------cgcctct
KF214652_C_P-C      cctactgacttctttccttctattcgagatctcctcgacac------------cgccgct
FJ562241_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctct
MH818373_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
FJ562310_C_P-C      ccttctgacttctttccttcaattcgagatctcctcgacac------------tgcctct
EU939541_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
DQ089772_C_P-C      ccttcggacttctttccttctattcgtgatctactcgacac------------cgcctct
KU667576_C_P-C      ccttctgacttttttccgtctgttcgagatctcctcgacac------------cgccgct
EU939558_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670272_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670259_C_P-C      cctgctgacttctttccttctrttcgagatctcctcgacac------------cgccact
AB115417_C_P-C      ccttctgacttctttccttctatgcgagatctcctcgacac------------tgcatct
AB042285_C_P-C      cctactgacttctttcctgctgttcgagatctcctcgacac------------cgcctct
KY363252_C_P-C      ccttctgacttctttccttcaactcgagatctcattgatac------------cgccact
EU919165_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
AB931170_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctct
AB931171_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctct
KU667914_C_P-C      ccttctgacttttttccttcggttcgagatctcctcgacac------------cgcctct
KU576193_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KU576196_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctct
KU668197_C_P-C      ccttctgacttttttccttcggttcgagatctcctcgacac------------cgcctct
FJ386616_C_P-C      ccttctgacttctttccttctgtgcgagatctcctcgacac------------cgcctct
AY641563_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgccact
EF137803_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctct
JQ027332_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939641_C_P-C      ccttctgacttctttccttctrttcgagatctcctcgacac------------cgcctct
DQ890381_C_P-C      cctactgatttctttccttctattcgagacctcctcgacac------------cgcctct
DQ089802_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670262_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctct
AB670246_C_P-C      ccgcctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB113877_C_P-C      ccttctgacttctttccttctatacgagatctcctcgatac------------cgcctca
AB300361_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
KY363285_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
AB670237_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
AB670279_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
GQ475328_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
GQ475351_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
KY363284_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
FJ787487_C_P-C      ccttctgacttctttccttccgttcgaggtctcctcgacac------------cgcatct
FJ787488_C_P-C      ccttctgacttctttccttccgttcgagatctcctcgacac------------cgcatct
FJ787489_C_P-C      ccttctgacttctttccttccgttcgagatctcctcgacac------------cgcatct
KU576284_C_P-C      ccttctgacttctttccttcggttcgagatctcctcgacac------------cgcctct
D00630_C_P-C        ccttctgacttctttccttctattcgagatctcctcgacac------------cgccttt
KC774353_C_P-C      ccttctgacttctttccgtccgttcgagatctccttgacac------------cgcctct
JQ040156_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377518_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctct
FJ023640_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ040164_C_P-C      ccttctgacttctttcctgccattcgagatctccwtgacac------------cgcctct
KY363260_C_P-C      ccttctgatttctttccttccattcgagatctcctcgacac------------cgccgct
AB900115_C_P-C      ccttctgacttctttcctaatattcgagatctcctcgacac------------cgcctct
AB367433_C_P-C      ccttctgacttcttcccttctattcgagatctccttgacac------------cgcctct
MK321266_C_P-C      cctactgacttctttccttctattcgagatctcctcgacac------------cgccgct
MK720629_C_P-C      cctactgacttctttccttctattcgagatctcctcgacac------------cgccgct
MK720630_C_P-C      cctactgacttctttccttctattcgagatctcctcgacac------------cgccgct
HM011500_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
AB367429_C_P-C      ccttctgacttctttccttccatccgagatctcctcgacac------------cgcctct
AB367802_C_P-C      ccttctgacttctttccttccatccgagatctcctcgacac------------cgcctct
FJ899768_C_P-C      cctactgacttctttccatctattcgagatctcctcgacac------------cgcctct
FJ562250_C_P-C      cctactgacttctttccttctattcgagatctactcgacac------------cgcctct
X52939_C_P-C        ccttctgacttctttccgtctgttcgagatctcctcgacac------------cgcctct
AB670264_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctct
FJ848339_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
JQ040143_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
AB670258_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
AB298720_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
AB298721_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
JQ040151_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
HQ700517_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386625_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
AB014394_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgatac------------cgcctct
KR013943_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccact
EU589344_C_P-C      ccttctgacttctttccgtctgttcgagatctcctcgacac------------cgccact
AB367405_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctct
DQ993691_C_P-C      ccttctgacttctttccttctgttcgagatctccttgacac------------cgcctct
DQ993692_C_P-C      ccttctgacttctttccttctgttcgagatctccttgacac------------cgcctct
AB367421_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcatct
AB670260_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562255_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctct
KY363282_C_P-C      ccttctgacttttttccgtctattcgagatctccttgacac------------cgcctct
KY363283_C_P-C      ccttctgacttttttccgtctattcgagatctccttgacac------------cgcctct
KU668231_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774202_C_P-C      ccttctgacttctttccttccattcgagatcttctcgacac------------cgcctct
GQ358158_C_C-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctct
FJ562243_C_P-C      ccttctgacttctttccttctgttcgagatcttctcgacac------------cgcctct
AB367422_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------tgcctct
EU306674_C_P-C      ccttctgacttctttccttctattcgagatctcgtcgacac------------cgccact
EU306675_C_P-C      ccttctgacttctttccttctattcgagatctcgtcgacac------------cgccact
KY363268_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KY363254_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcatct
KJ803769_C_P-C      ccttctgacttctttccttccattcgagacctcctcgacac------------cgcctct
FJ787490_C_P-C      ccttctggcttctttccttctattcgagatctcctcgacac------------cgcctct
AY206386_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
KC774354_C_P-C      ccttctgacttctttcctgctattcgagatcttctcgacac------------cgcctct
KC774355_C_P-C      ccttctgacttctttcctgctattcgagatcttctcgacac------------cgcctct
KM213037_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
AB670306_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB014363_C_P-C      ccttctgacttctttccttctattcgagatctcctagacac------------cgcctct
FJ386620_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB111112_C_P-C      ccttctgacttctttccttctrttcgagatctccttgacac------------cgcctct
AB049610_C_P-C      ccttctgacttctttcctactattcgagatctcctcgacac------------cgcctct
AB014378_C_P-C      ccttctgacttctttccttccattcgagatctccttgacac------------cgcctct
AB111125_C_P-C      ccttctgacttctttcctaatattcgagatctcctcgacac------------cgcctct
AB111124_C_P-C      ccttctgacttctttcctaatattcgagatctcctcgacac------------cgcctct
AB246344_C_P-C      ccttctgacttctttcctaatattcgagatctcctcgacac------------cgcctct
LC279247_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
LC279248_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
LC279249_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774279_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctct
GQ475330_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctct
HM011465_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctct
FJ386626_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
D50520_C_P-C        ccttctgacttctttccttccattcgagatctcctcgacac------------cgccact
D50517_C_P-C        ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
D50518_C_P-C        ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
KM359441_C_P-C      ccttctgacttctttcctaatattcgagatctcctcgacac------------cgcctct
DQ089797_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
AB014398_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KY363277_C_P-C      ccttctgacttttttccttcgattcgagatctcctcgacac------------cgcctct
JX026878_C_P-C      cctgctgatttctttccttctattcgagatctcctcgacac------------cgcctct
DQ478899_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgccgct
AY641560_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AY641559_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670288_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB195949_C_P-C      ccttctgacttctttccttctattcgagatctcctcgatac------------cgcctct
AB014390_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgatac------------cgcctct
AB014374_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
MG893556_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY363278_C_P-C      ccttctgacttttttccttcgattcgagatctcctcgacac------------cgcctct
KY363279_C_P-C      ccttctgacttttttccttcgattcgagatctcctcgacac------------cgcctct
JX036338_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939536_C_P-C      ccttctgacttttttccttccattcgagatctcctcgacac------------cgcctct
AB670302_C_P-C      ccttctgacttctttccttctgttcgagatctccttgacac------------cgcatct
AB367418_C_P-C      ccttctgatttctttccttctgttcgagatctcctcgacac------------cgcctct
AB014360_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KY363256_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KY363257_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
GQ475326_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
FJ562319_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
EU939647_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774329_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715364_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB367401_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB106895_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB014367_C_P-C      ccttctgacttctttccttctgttcgggatctcctcgacac------------cgcctct
KJ803766_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475355_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
FJ386638_C_P-C      ccttctgacttctttccttctattcgagatyttctcgacac------------cgcctct
AB176643_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB014376_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB971714_C_P-C      ccttctgacttctttccgtccattcgagatctcctcgacac------------cgcctct
AB971715_C_P-C      ccttctgacttctttccgtccattcgagatctcctcgacac------------cgcctct
GQ475357_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB195942_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB195943_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB195944_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475336_C_P-C      ccttctgacttctttccttccgttcgagatctcctcgacac------------cgcctct
AF533983_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
AB670285_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
AB205124_C_P-C      ccttctgacttctttccttctattcgagatctcctcgatac------------cgcctct
EU939612_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562230_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475341_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386629_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
HQ638218_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY363253_C_P-C      ccttctgacttctttccttcaattcgagatctccttgatgc------------cgccact
KR013766_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598637_C_P-C      ccttcggacttctttccttctattcgagatctcgtcgacac------------cgcctct
KJ598638_C_P-C      ccttcggacttctttccttctattcgagatctcgtcgacac------------cgcctct
KC774348_C_P-C      ccttctgacttctttccttctattagagatctcctcgacac------------cgcctct
KC774334_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774272_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctcc
JX661489_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX026877_C_P-C      ccttctgacttctttccttctgttcgagatcttctcgacac------------cgcctct
JQ040165_C_P-C      cmttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ040135_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JN104434_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
GQ475350_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcttct
GQ377618_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377523_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
FJ715350_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------tgcctct
FJ386602_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
EU939578_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AY596107_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
AB697494_C_P-C      ccttctgacttctttccgtctgttcgagatctcctcgacac------------cgcctct
AB670297_C_P-C      ccttctgacttctttccttctattcgagatctcctcgatac------------cgcctct
AB670275_C_P-C      ccttctgacttctttccttctattcgagatctcgtcgacac------------cgcctct
AB367431_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
AB367423_C_P-C      cctactgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB367408_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
AB182589_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgatac------------cgcctct
KC774251_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KC774185_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774250_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774255_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774244_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562218_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
FJ386605_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
FJ386589_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KJ173393_C_P-C      ccttctgacttttttccttctattcgagatctcctcgatac------------cgcctct
KJ173394_C_P-C      ccttctgacttttttccttctattcgagatctcctcgatac------------cgcctct
KJ598642_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598635_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598636_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598640_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598641_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598659_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598639_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598661_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598658_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598656_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598654_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598657_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598650_C_P-C      cctttggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598649_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598651_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598653_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598648_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598660_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598646_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598644_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598645_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598647_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598652_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598655_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
HM750132_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670265_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB113879_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475312_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475327_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475334_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU570068_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
EU570067_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
EU554537_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
EU554538_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
EU554539_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
AB367395_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgccact
DQ089801_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562298_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964032_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964020_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964021_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964022_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964024_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964025_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964026_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964027_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964028_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964029_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964030_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964031_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964033_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964023_C_P-C      ccttctgacttctttcctgctattcgagatctcctcgacac------------cgcctct
KJ803761_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KF214655_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
GQ475321_C_P-C      ccttctgacttttttccttctattcgagatctccttgacac------------cgcctct
EU939597_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY022423_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013961_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013780_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013765_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013764_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KF485389_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774316_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
KC774275_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774257_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774232_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774206_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JN104435_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
GQ475344_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
GQ475332_C_P-C      ccttctgacttctttccttctattcgagatctactcgacac------------cgcctct
GQ475322_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475320_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
GQ475318_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377571_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377540_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562320_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
EU939549_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------tgcctct
EF137802_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB367402_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470878_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------tgcctct
KY470884_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------tgcctct
KJ173313_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173314_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
DQ144553_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
DQ144603_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
DQ144604_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB111116_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
AB111117_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
X04615_C_P-C        ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KT284753_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcatct
GQ377585_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttct
AB042282_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AY641561_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470934_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470929_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470933_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013786_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013784_C_P-C      ccttctgacttctttccttctattcgagatctccccgacac------------cgcctct
KR013783_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774197_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013779_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013782_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013785_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013781_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KF779242_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
HM011489_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB014377_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
GQ475339_C_P-C      ccttctgacttttttccttccattcgagatctcctcgacac------------cgcctct
KC774192_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctct
AB697490_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
GQ475333_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
LC279252_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctct
LC279253_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctct
KC774252_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670300_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JN400087_C_P-C      ccttctgacttctttccttctattcaagatctcctcgacac------------cgcctct
JN400089_C_P-C      ccttctgacttctttccttctattcaagatctcctcgacac------------cgcctct
KJ173287_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173288_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964049_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964050_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964051_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964052_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964053_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964054_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964055_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964056_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964057_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964058_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964059_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964060_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964061_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964062_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964063_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475313_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475347_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AF384364_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AF384365_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AF384366_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AF384367_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470874_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470873_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KT284756_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013853_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013761_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774259_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774233_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774223_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
HM750131_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475342_C_P-C      ccttctgacttttttccttctgtgcgagatctcctcgacac------------cgcctct
GQ475310_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377576_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377535_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
GQ377553_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
FJ715367_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715366_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386647_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
EU916229_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU306673_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
D12980_C_P-C        ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AY641558_C_P-C      ccttctgacttctttccttctattcaagatcgcctcgacac------------cgcctct
JN400088_C_P-C      ccttctgacttctttccttctattcaagatcgcctcgacac------------cgcctct
AF286594_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670287_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670252_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB367411_C_P-C      ccttctgacttctttccttctattcgagatctccttgatac------------cgcatct
AB362932_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
KC774243_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcatct
KC774346_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013797_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013768_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013767_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013762_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774220_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774184_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX661492_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377600_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013798_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ688404_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173437_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173438_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013763_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
LC279254_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
LC279255_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
LC279256_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
LC279257_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KF779300_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
DQ683578_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
HM750138_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY363276_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470883_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670309_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562297_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475306_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475308_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475315_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475331_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
AB471851_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB471852_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB471853_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB033550_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP027477_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
MG893557_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
LC279251_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470889_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KY470886_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470888_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470881_C_P-C      ccttccgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470875_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774270_C_P-C      ccttctgacttctttccttctatacgagatctcctcgacac------------cgcctct
KC774209_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX661491_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX429905_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828918_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ872210_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
GQ475348_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
GQ475329_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475325_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475324_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
GQ475338_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
GQ475354_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
GQ475311_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475307_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
GQ377616_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377563_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
GQ377517_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU589345_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
D50519_C_P-C        ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
AB697500_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
GQ475345_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
AB675677_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
AB670292_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670267_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB640730_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB367409_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670283_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB367403_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB367399_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KJ173283_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KJ173284_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
AB300362_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB222714_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB222715_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828913_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828915_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828916_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828917_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828919_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828920_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB042283_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB367394_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB485808_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670247_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AP011098_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AY057947_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ899763_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ899775_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377531_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377603_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475305_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475346_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774180_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774219_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774274_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173426_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ410519_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470876_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470877_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470879_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470890_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470891_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470892_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KX276853_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089785_C_P-C      ccttctgacttctttcctactattcgtgatctcctcgacac------------cgcctct
KF873539_C_P-C      ccttctgatttctttccgtctattcgagatctccttgacac------------tgcctyc
KF873541_C_P-C      ccttctgatttctttccgtctattcgagatctccttgacac------------tgcctcc
JQ341517_C_P-C      ccttctgacttctttccgaatgtccgygatctcctcgacac------------cgcctct
JX507212_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgccgca
KJ410515_C_P-C      ccttctgacttttttcctactattcgtgatctcctcgacac------------cgcctct
DQ089775_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctca
KX276852_C_P-C      ccttctgacttctttccttctattcgkgatctcctcgacac------------cgcctct
FJ904423_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MG571332_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KM875424_C_P-C      ccttctgacttctttccttctattcgtgatctactcgacac------------cgcctct
KM875425_C_P-C      ccttctgacttctttccttctattcgtgctctactcgacac------------cgcctct
HM011472_C_P-C      ccttctgatttctttccttctgttcgtgatctcctcgacac------------cgcctct
MK818227_C_P-C      ccttctgatttctttccttctgttcgtgatctcctcgacac------------cgcctct
MF674430_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
KX276841_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ410514_C_P-C      ccttctgacttctttcctaatgttcgtgatctcctcgacac------------cgcctct
KJ803770_C_P-C      cctgctgacttctttccttccattcgggatctcctcgacac------------cgcctct
JX504535_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
JQ341518_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
KJ410499_C_P-C      ccttctgacttttttccttccattcgtgatctcctcgacac------------cgcaact
KJ410489_C_P-C      ccttctgacttttttccttccattcgtgatctcctcgacac------------cgcaact
KJ410492_C_P-C      ccttctgacttttttccttccattcgtgatctcctcgacac------------cgcaact
KJ410491_C_P-C      ccttctgacttttttccttccattcgtgatctcctcgacac------------cgcaact
KJ410494_C_P-C      ccttctgacttttttccttccattcgtgatctcctcgacac------------cgcaact
KJ410511_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KX276846_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ803779_C_P-C      ccttctgacttttttccttctattcgtgatctcctcgacac------------cgcctct
DQ089778_C_P-C      ccttctgacttctttccttctrttcgtgatctcctcgacac------------cgcctct
DQ089776_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089777_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ410493_C_P-C      cctgctgacttctttccttctattcgtgatcttctcgacac------------cgcctct
JX507211_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089792_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
KM875428_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctca
KJ410518_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AY269140_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
HM011486_C_P-C      ccttctgacttctttccttcyattcgtgatctcctcgacac------------cgcttct
DQ089791_C_P-C      ccttctgacttctttcctaatattcgtgatctcctcgacac------------cgcctct
KX276840_C_P-C      ccttccgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089756_C_P-C      cctaatgacttctttccttctattcgtgatctcctcgacac------------cgcttct
DQ089773_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
DQ089757_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgccact
AF223961_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
MF674457_C_P-C      ccttctgacttttttccttctattcgtgatctcctcgacac------------cgcctct
DQ089786_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JQ027318_C_P-C      ccttctgacttttttccttctattcgtgatctcctcgacac------------cgcctct
DQ089790_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgatac------------cgcatct
JQ707768_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JQ707769_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JQ707770_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JQ707771_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JQ707772_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JQ707773_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JQ707774_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JQ027333_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089761_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
MG571335_C_P-C      ccttctgatttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ803810_C_P-C      ccttctgacttttttccttctattcgtgatctcctcgacac------------cgccact
KJ803794_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674425_C_P-C      ccttctgacttttttccttctgttcatgatctcctcgacac------------cgcctct
MF674458_C_P-C      ccttctgacttttttccttctgttcatgatctcctcgacac------------cgcctct
MF674474_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674428_C_P-C      ccttctgacttttttccttctattcgtgatcttctcgacac------------cgcctct
MF674390_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KM875405_C_P-C      ccttctgacttttttccttctattcgtgatctcatcgacac------------cgcctct
EF197911_C_P-C      ccttctgacttttttccttctattcgtgatctactcgacac------------cgcctct
KM875404_C_P-C      ccttctgacttttttccttctattcgtgatctcctcgacac------------cgcctct
JQ341541_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
HM011488_C_P-C      ccttctgacttttttccttctattcgtgatctcctcgacac------------cgcctct
DQ089787_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KY353910_C_P-C      ccttctgacttctttccgtctgttcgtgatctcctcgacac------------cgcctct
DQ089788_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgaaac------------cgcctct
DQ089759_C_P-C      ccttctgacttctttccttctattcgtgatctactcgacac------------cgcctct
MG571345_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674514_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
FJ386673_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctct
AB112065_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
DQ089771_C_P-C      ccttctgacttctttcctactattcgtgatctcctcgacac------------cgccgct
KM875430_C_P-C      ccttctgacttttttccttctattcgtgatctcctcgacac------------cgcctct
KJ410498_C_P-C      ccttctgacttttttccttctattcgcgatctcctcgacac------------cgcctct
JX870000_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
GQ924655_C_P-C      ccttctgacttctttccatctattcgtgatcttctcgacac------------cgcctct
DQ089780_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcttct
MF674475_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JQ027321_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AY167099_C_P-C      ccctctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JQ341544_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
GQ855543_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB031262_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AF324084_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
AB105174_C_P-C      ccttctgacttctttccttctattcgtgatctcgtcgacac------------cgcctct
DQ089766_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KR013996_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KR013823_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KR013822_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KR013825_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
MF674504_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674444_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------agcctct
KR013857_C_P-C      ccttctgacttctttccttctattcgtgatctcctcggcac------------cgcctct
FJ349225_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
FJ023650_C_P-C      ccttctgacttttttccttctattcgcgatctcctcgacac------------cgcctct
KR013820_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KR013824_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KR013821_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KR013826_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
EF494379_C_P-C      ccttctgacttttttccttctattcgtgatctcctcgacac------------cgcctct
AB105173_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674471_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgccact
MF674411_C_P-C      ccttctgacttttttccttccattcgtgatctcctcgacac------------tgcctct
MG826123_C_P-C      ccttctgacttctttccttccattcgtgatttcctcgacac------------cgcctct
MF674489_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674463_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674399_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ410504_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JX507214_C_P-C      ccttctgacttttttccttctattcgtgatctcctcgacac------------cgcctct
JQ801490_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
HM011497_C_P-C      ccttctgacttttttccttctattcgtgatctcctcgacac------------cgcctct
FJ023653_C_P-C      ccttccgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089789_C_P-C      ccttctgacttctttccttctattcgtgacctcctcgacac------------cgcttct
DQ089770_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089763_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089760_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089758_C_P-C      ccttctgacttctttccytctattcgtgatctcctcgacac------------cgcctct
AY862869_C_P-C      ccttctgacttctttccttctattcgtgatcttctcgacac------------cgcctct
AB205125_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcatct
AB112472_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcatct
AF223960_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ803826_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674417_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ410505_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ410508_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674502_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcatct
MF674494_C_P-C      ccttctgacttctttccttctattcgtgatctactcgacac------------cgcctct
MF674486_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674386_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KX276851_C_P-C      ccttctgacttctttcctactattcgtgatctcctcgacac------------cgcctct
KR013904_C_P-C      ccttctgacttccttccttctattcgtgatctcctcgacac------------cgcctct
KR013855_C_P-C      ccttatgactcctttccttctattcgtgatctcctcgacac------------cgcctct
KR013770_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ410496_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ173324_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JQ801495_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JQ040133_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ478901_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgccgct
DQ089784_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089762_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AY167092_C_P-C      ccttctgacttttttccttctattcgtgatctcctcgacac------------cgcctct
AJ748098_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AF473543_C_P-C      ccttctgacttctttccttccattcgtgatcttctcgacac------------cgcctct
AB246346_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AB112471_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcatct
MF674467_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089782_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ803774_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AF223957_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JN104437_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674418_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674403_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
KR013935_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KR013856_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KR013854_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ803793_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ173285_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
KC774227_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
GQ855525_C_P-C      ccttctgacttttttccatctattcgtgatctcctcgacac------------cgcctct
GQ377605_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
GQ377536_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089783_C_P-C      ccttctgacttttttccttctattcgtgatctcctcgacac------------cgcctct
DQ089767_C_P-C      ccttctgacttctttccttctrttcgtgatctcctcgacac------------cgcctct
EF688062_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ246215_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089781_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AF324081_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674442_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AF223955_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AF223956_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AF223959_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089779_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
GQ377631_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ173286_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674468_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674398_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
EU305541_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
EU305542_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674402_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674484_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674408_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674472_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674435_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674388_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674412_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674454_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
MF674501_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KR013927_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ410501_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ410513_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ410495_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089764_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AF223954_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AF223958_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
AP011097_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089765_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
DQ089769_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
EU305540_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JQ688403_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KR013787_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KX765824_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KX276848_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctcw
GQ924643_C_P-C      cctgctgacttctttccttcaattcgagacctcctcgacac------------cgcctct
MG826132_C_P-C      ccttctgctatctttccatctattctagatctcctcgacac------------cgcctca
EU547559_C_P-C      ccttctgacttctttccttctattcatgatctcctctacac------------cgcctct
DQ089768_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcttct
HM011495_C_P-C      ccttckgacttytttccttctattcgagacctcctcgacac------------cgcctct
EU939601_C_P-C      ccttctgacttctttccttctattcgagatctactcgacac------------cgcctct
MG826140_C_P-C      ccttctgatttctttccatctattcgagatctcctcgacac------------cgcctca
KX276844_C_P-C      ccttctgacttctttccttccattcgagacctcctcgacac------------cgcctct
GQ924619_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccact
JQ801500_C_P-C      ccttctgacttttttccgtctgttcgagatctcctcgacac------------cgcctct
GQ924642_C_P-C      cctaatgacttctttccttccatgcgagacctcctcgacac------------cgcctct
KJ598662_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598665_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598670_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598667_C_P-C      ccttctgacttttttccttccattcgtgatctcctcgacac------------cgcctct
KJ598674_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598672_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598663_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598664_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598666_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598668_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598669_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598673_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598676_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598677_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598678_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598671_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
GQ924629_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562256_C_P-C      ccttctgacttytttccttccattcgtgatcttctcgacac------------cgcctcc
EU670263_C_P-C      ccttctgacttctttccttctatacgagatctcctcgacac------------cgcctca
GU721029_C_P-C      ccttctgacttctttccttctatacgagatctcctcgacac------------cgcctct
MG826137_C_P-C      ccttctgatttctttccatctattcgagatctcctcgacac------------cgcctca
MG826139_C_P-C      ccttctgacttctttccatctattcgagatctcctcgacac------------cgcctca
MG826138_C_P-C      ccttctgatttctttccatctgttcgagatctcctcgacac------------cgcctca
MG826136_C_P-C      ccttctgatttctttccatctattcgagatctcctcgacac------------cgcctca
MG826129_C_P-C      ccttctgatttctttccatctattcgagatctcctcgacac------------cgcctca
MG826128_C_P-C      ccttctgatttctttccatctattcgagatctcctcgacac------------cgcctca
MG826133_C_P-C      ccttctgatttctttccatctattcgagatctcctcgacac------------cgcctca
MG826134_C_P-C      ccttctgatttctttccatctattcgagatctcctcgacac------------cgcctca
MG826135_C_P-C      ccttctgatttctttccatctattcgagatctcctcgacac------------cgcctca
MG826131_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
AP011106_C_P-C      ccttctgatttctttccatctattcgagatctcctcgacac------------cgcctca
AP011107_C_P-C      ccttctgatttctttccatctattcgagatctcctcgacac------------cgcctca
AB111946_C_P-C      ccttctgacttctttcctaatattcgtgatctcctcgacac------------cgcctct
AB112063_C_P-C      ccttctgacttctttcctaatattcgtgatctcctcgacac------------cgcctct
JQ027317_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB074755_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774321_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KC774361_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KR013883_C_P-C      ccttctgatttctttccttctatccgagatcttctcgacac------------cgcctca
KR013878_C_P-C      ccttctgatttctttccttctatccgagatcttctcgacac------------cgcctca
KR013885_C_P-C      ccttctgatttctttccttctatccgagatcttctcgacac------------cgcctca
KC774221_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KR013819_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KC774288_C_P-C      ccttctgatttctttccttctatccgagatcttctcgacac------------cgcctca
KC774253_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
EU939625_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
EU939626_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KR013993_C_P-C      ccttctgacttctttccttctattcgaggtcttctcgacac------------cgcctca
KC774306_C_P-C      ccttctgacttctttcctgctattcgagatcttctcgacac------------cgcctca
KC774302_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcatca
FJ386631_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KC774282_C_P-C      ccttctgatttctttccttctatccgagatcttctcgacac------------cgcctca
KC774303_C_P-C      ccgtctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KC774207_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KC774296_C_P-C      ccttctgatttctttccttctatccgagatcttctcgacac------------cgcctca
KR013818_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KR013817_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KC774325_C_P-C      ccttctgatttctttccttctatccgtgatcttctcgacac------------cgcctca
KC774308_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
FJ787451_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
FJ562323_C_P-C      ccttctgatttctttccttctatccgagatcttctcgacac------------cgcctca
FJ386664_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
FJ386623_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KC774304_C_P-C      ccttctgacttctttccttccattcgagatcttctcgacac------------cgcctca
KC774300_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
GQ377591_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
GQ377529_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
FJ715341_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KT364751_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KC774280_C_P-C      ccttctgatttctttccttctattcgagatcttctcgacac------------cgcctca
KC774204_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KC774285_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KT364752_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
KC774330_C_P-C      ccttctgatttctttccttctatccgagatcttctcgacac------------cgcctca
KC774298_C_P-C      ccttctgatttctttccttctatccgagatcttctcgacac------------cgcctca
KC774351_C_P-C      ccttctgatttctttccttctatccgagatcttctcgacac------------cgcctca
JQ027322_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB074047_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ803754_C_P-C      cctcaggacttttttccttctattagagatctcctcgacac------------cgcttct
EU939552_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU498227_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ341545_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ803823_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
MG826126_C_P-C      ccttctgacttttttccttctattcgtgatctcctcgacac------------cgcctct
FJ562288_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctct
FJ386601_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562334_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
MG826143_C_P-C      ccttctgacttctttccatctattcgagatctcctcgacac------------cgcctca
KY470908_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
KY470911_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
KJ803814_C_P-C      ccttctgacttctttccttccattcgagacctcctcgacac------------cgcctct
KJ803815_C_P-C      ccttctgacttctttccttccattcgagacctcctcgacac------------cgcctct
KJ803811_C_P-C      ccttctgacttctttccttccattcgagacctcctcgacac------------cgcctct
KJ803813_C_P-C      ccttctgacttctttccttccattcgagacctcctcgacac------------cgcctct
JQ801501_C_P-C      ccttctgacttctttccttccattcaagatctcctcgacac------------cgcctct
FJ023571_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
JQ801487_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
KX765839_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
KP148563_C_P-C      ccgtctgacttctttcctgctattcgagatctcctcgacac------------cgcctct
JQ801488_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KX765852_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
FJ023655_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ801522_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ023641_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ924615_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
HM011491_C_P-C      ccttctgacttctttccttccattcgagacctcctcgacac------------cgcctct
KY470916_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470913_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ924658_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ801481_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ801483_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470918_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470906_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470909_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470912_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470914_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470915_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470910_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470907_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470917_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470920_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KX765836_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
KP148525_C_P-C      ccttctgactactttccttctattcgagatctcctcgacac------------cgcctct
KP148462_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ801504_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148534_C_P-C      ccccctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KX765827_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
KP148537_C_P-C      ccttctgccttctttccttctattcgagatctcctcgacac------------cgcctct
KJ803759_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148572_C_P-C      ccttctgacttctttccttctattcgagatctcctcggcac------------tgcctct
KP148543_C_P-C      ccttctggcttctttccttctattcgagatctcctcgacac------------cgcctct
KP148575_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148560_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148540_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148520_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148483_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcccct
KP148491_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcccct
KP148476_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148470_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774228_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ801505_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctct
JF899336_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ924623_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ023654_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB300363_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148567_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148566_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148557_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148554_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148548_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148513_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148523_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148528_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148570_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KX765830_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KP148487_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148489_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148574_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148573_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148568_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148564_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148562_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148559_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148558_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148547_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148546_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148526_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148519_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148530_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148552_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148517_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148514_C_P-C      ccttctgacttctttccttctatttgagatctcctcgacac------------cgcctct
KP148488_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148480_C_P-C      ccttctgactactttccttctattcgagatctcctcgacac------------cgcctct
KP148479_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148475_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148474_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148468_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148469_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148471_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148472_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148473_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148477_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148481_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148482_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148492_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148493_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148465_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148315_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148464_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ023656_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
FJ023647_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU306685_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU306688_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU306689_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU306690_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU306691_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU306694_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ924604_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148463_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148466_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148512_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148521_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148524_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148529_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148531_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148532_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148535_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148538_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148545_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148549_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148551_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148555_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148561_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KP148571_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU306687_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013796_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013792_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013793_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013794_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctcc
KR013795_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ598720_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KU964238_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KU964243_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KJ598737_C_P-C      ccttctgacttctttccttccgttcgtgatctcctcgacac------------cgcctct
KJ598730_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
KU964230_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
KJ598727_C_P-C      ccttctgacttctttccttccgttcgtgatctcctcgacac------------cgcctct
KU964235_C_P-C      ccttctgacttctttccttccgttcgtgatctcctcgacac------------cgcctct
KJ598721_C_P-C      ccttctgacttctttccttccgttcgtgatctcctcgacac------------cgcctct
KU964242_C_P-C      ccttctgacttctttccttccgttcgtgatctcctcgacac------------cgcctct
KJ598736_C_P-C      ccttctgacttctttccttccgttcgtgatctcctcgacac------------cgcctct
KJ598726_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KU964236_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598725_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KU964237_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598722_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgccact
KJ598733_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgccact
KU964241_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgccact
KJ598735_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KJ598731_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KU964229_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KJ598723_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KJ598728_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KJ598729_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KJ598734_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KJ598738_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KJ598739_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KU964231_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KU964232_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KU964233_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KU964234_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KU964240_C_P-C      ccttctgacttctttccttccattcgtgatctgctcgacac------------cgcctct
KJ598724_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KJ598732_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KU964239_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
DQ536411_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
DQ536413_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB014368_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
DQ536410_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
DQ536414_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562300_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
KF495606_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctcg
HM011493_C_P-C      ccttctgacttctttcctaacattcgtgatctcctcgacac------------cgcctct
KY629637_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
KC774235_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
JX504537_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
GQ377555_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgccact
KY629631_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KJ173333_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963900_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963901_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963902_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963903_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963904_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963905_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963906_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963907_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963908_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963909_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963910_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963911_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963912_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963913_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KU963914_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KY470983_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KY470990_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KY470991_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KY470980_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KY470981_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KY470982_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KY470984_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KY470988_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KY470985_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KY470986_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KY470987_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KY670782_C_P-C      ccttctgacttytttccttccattcgtgatctcctcgacac------------cgcctct
MG826127_C_P-C      ccttctgacttctttccttccattcgtgatctcctcgacac------------cgcctct
KR013841_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KR013840_C_P-C      ccttctgacttctttccttctgttcgtgatctcctcgacac------------cgcctct
KR013837_C_P-C      ccttctgacttctttccttctattcgtgatatcctcgacac------------cgcctct
KR013839_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KR013835_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KR013838_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
KR013836_C_P-C      ccttctgacttctttccttctattcgtgatctcctcgacac------------cgcctct
FJ562225_C_P-C      ccttctgacttctttccttctgttcaacatctcctcgacac------------cgcctct
EU939573_C_P-C      ccttctgacttctttccttctgttcgagagctcctcgacac------------cgcctct
GQ377545_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY363274_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KT284757_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB198076_C_P-C      ccttctgacttctttccwtctattcgagatctcctcgacac------------cgcctct
FJ386672_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU562218_C_P-C      ccttctgacttctttccatctattcgagatctcctcgacac------------cgcctct
FJ562268_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964215_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgccgct
GQ377562_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
HM750139_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KU964223_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KU964226_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KT284758_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377554_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
FJ715395_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715397_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377559_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377570_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KC774260_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774267_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964228_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964214_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccgct
KU964222_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KU964225_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964218_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964224_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964216_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964217_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964219_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964220_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964221_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964227_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KX765823_C_P-C      ccttcggacttctttccttctattcgagatctactcgacac------------cgcctct
GQ924636_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctct
KJ803765_C_P-C      ccttctgacttctttccgaacattcgagatctcctcgacac------------cgcctct
KX765845_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ027320_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ358154_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KX276854_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ855544_C_P-C      ccttctgacttctttccttctattcgagatctactcgacac------------cgcctct
FJ023646_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ023643_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ023644_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ855528_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KX765819_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KX765847_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KX765855_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU679951_C_P-C      ccttctgatttctttccgtctattcgagatctcctcgacac------------cgcctcc
KU679949_C_P-C      ccttctgatttctttccgtctrttcgtgatctcctcgacac------------cgccrcc
AB900109_C_P-C      cctgctgacttttttccttctgttcgcgacctactcgacac------------cgcctct
KF873544_C_P-C      ccttctgatttctttccgtccattcgmgacctccttgacac------------cgcatcc
KX276831_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
AB115418_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctcc
KC774240_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KM875412_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ803790_C_P-C      ccttctgacttttttccttctgttcgggatctcctcgacac------------cgcctct
KR013870_C_P-C      ccttccgacttttttccttctattcgggacctcctcgacac------------cgcctct
KR013871_C_P-C      ccttctgacttttttccttctattcgggacctcctcgacac------------cgcctcc
GQ924622_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
AB241111_C_P-C      ccttctgatttctttccttccattcgagatctcctcgacac------------cgcctct
AB241110_C_P-C      ccttctgatttctttccttctattcgagacctcctcgacac------------cgcctct
EU410081_C_P-C      ccttctgatttctttccttctattcgagacctcctcgacac------------cgcctct
EU410079_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
EU410080_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
AP011100_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
KM526745_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
KM526744_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
AP011099_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
KM526746_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
AP011101_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
JN827414_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
JN827415_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ924620_C_C-C      ccgtctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
AF241411_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AF241410_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173335_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KJ173336_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562329_C_P-C      ccttctgacttctttccctctattcaagatctccttgacac------------cgcctgg
HM011481_C_P-C      cctgctgacttctttcctcctgttcgagatctcctcgacac------------cgcctct
KX276839_C_P-C      cctgctgacttctttcctcctgttcgagatctcctcgacac------------cgcctct
FJ023677_C_P-C      ccttctgatttctttccgtctgttcgagatcttctcgacac------------cgcctca
FJ023592_C_P-C      ccttctgatttctttccgtctattcgagatctactcgacac------------cgcctca
FJ023624_C_P-C      ccttctgatttctttccgtcattcgaagatctactcgacac------------cgcctca
FJ023625_C_P-C      ccttctgatttctttccgtctattcgagatctactcgacac------------cgcctca
FJ023589_C_P-C      ccttctgatttctttccgtctattcgagatctactcgacac------------cgcctca
FJ023567_C_P-C      ccttctgatttctttccgtctattcgagatctactcgacac------------cgcctca
FJ023566_C_P-C      ccttctgatttctttccgtctattcgagatctactcgacac------------cgcctca
FJ023568_C_P-C      ccttctgatttctttccgtctattcgagatctactcgacac------------cgcctca
FJ023587_C_P-C      ccttctgatttctttccgtctattcgagatctactcgacac------------cgcctca
FJ023590_C_P-C      ccttctgatttctttccgtctattcgagatctactcgacac------------cgcctca
FJ023591_C_P-C      ccttctgatttctttccgtctattcgagatctactcgacac------------cgcctca
KU679947_C_P-C      ccttctgatttctttccgaatatccgagatctcctcgacac------------cgcctcc
KU679957_C_P-C      ccttctgatttctttccgtctatccgagatctcctcgacac------------cgcctcc
KF873520_C_P-C      ccttctgatttctttccgtctgttcgtgatctcctcgacac------------cgccacc
KU679936_C_P-C      ccttctgatttctttccgtctattcgcgatctcctcgacac------------cgccgcc
KF873514_C_P-C      ccttctgatttctttccgtctattcgtgatctcctcgacac------------agccgcc
KF873516_C_P-C      ccttctgatttctttccgtctattcgtgatctcctcgacac------------agccgcc
AB670295_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB195931_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctca
AB195932_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctca
AB113878_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctca
AB195930_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctca
AY167091_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
MG826124_C_P-C      ccttctgacttctttccgtctattcgggatctcctcgacac------------cgcctct
KC774319_C_P-C      cctcctgacttttttccttctattcgggatctcctcgacac------------cgcctct
KY363258_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
FJ386679_C_P-C      ccgtctgacttctttccttcaattcgagatctcctcgacac------------tgccact
KU667678_C_P-C      cctgctgacttctttccttccattcgagatctcctcgacac------------cgccact
KU576863_C_P-C      cctgctgacttctttccttccattcgagatctcctcgacac------------cgccact
KU576860_C_P-C      cctgctgacttctttccttccattcgagatctcctcgacac------------cgccact
KU576864_C_P-C      cctgctgacttctttccttccattcgagatctcctcgacac------------cgccact
KU576865_C_P-C      cctgctgacttctttccttccattcgagatctcctcgacac------------cgccact
KU667741_C_P-C      cctgctgacttctttccttccattcgagatctcctcgacac------------cgccact
KU668127_C_P-C      cctgctgacttctttccttccattcgagatctcctcgacac------------cgccact
GQ377620_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562221_C_P-C      ccttctgacttttttccttctattcgagacctcctcgacac------------cgcctct
FJ386614_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
AB670298_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
KY470925_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470926_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
AB670242_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939548_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386677_C_P-C      cctaatgacttctttccttccattcgagatctcctcgacac------------cgcttct
AB367426_C_P-C      ccttctgacttctttccttctatacgagatctcctcgacac------------cgcctct
AB367801_C_P-C      ccttctgacttctttccttctatacgagatctcctcgacac------------cgcctct
GQ227692_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ227697_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ227696_C_P-C      ccttctgacttctttccttctactcgagatctcctcgacac------------cgcctct
GQ227693_C_P-C      ccttctgacttctttccttctactcgagatctcctcgacac------------cgcctct
GQ227694_C_P-C      ccttctgacttctttccttctactcgagatctcctcgacac------------cgcctct
GQ259588_C_P-C      ccttctgacttttttccttctactcgagatctcctcgacac------------cgcctct
GQ227695_C_P-C      ccttctgacttctttccttctactcgagatctcctcgacac------------cgcctct
JQ040131_C_P-C      cctcctgacttctttccttccattcgtgatctccttgacac------------cgcctct
AY206376_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
AY206379_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
AB300360_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctta
AB365451_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013769_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgccact
JX026880_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgccact
EU522071_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
AB014386_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KU576747_C_P-C      ccttccgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013777_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
AB195945_C_P-C      ccttctgacttttttccttctattcgagatctccttgatac------------cgcctct
FJ562273_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccact
FJ386617_C_P-C      ccttttgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386596_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
FJ386687_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939654_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
EU939613_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
FJ562301_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
EU939562_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AY206385_C_P-C      ccttccgacttttttccttctattcgagatctcctcgacac------------cgcctct
AB670310_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY363264_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
FJ899783_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB014372_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715422_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715424_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715392_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386659_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB195946_C_P-C      ccttctgacttctttccttctattcgagatctccttgatac------------cgcctct
FJ562306_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctct
FJ562264_C_P-C      ccttctgacttctttccgactattcgagatctcctcgacac------------cgccact
EU939540_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AY641562_C_P-C      ccttctgacttctttccttctattcgagatctcctggacac------------tgcctct
KF214678_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377621_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
FJ386604_C_P-C      ccttctgatttttttccttctattcgagatctcctcgacac------------cgcctct
FJ787437_C_P-C      ccttctgatttttttccttctattcgagatctcctcgacac------------cgcctct
KU576929_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939579_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
FJ899774_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
GQ475349_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
FJ562325_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939592_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475356_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
KU963926_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963920_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctca
KU963915_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963916_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963918_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963919_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963921_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963922_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963923_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963924_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963925_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963927_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963928_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963929_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963917_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774340_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774313_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ872211_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
FJ562279_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939607_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939594_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
AB111114_C_P-C      ccttctgacttctttccgtctattcgagatctccttgacac------------cgcctct
AB042284_C_P-C      ccttctgacttctttccttctattcgagatctcctcnacac------------cgcctct
AB014365_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
FJ562333_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ787468_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ787469_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX504536_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939614_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
AB670256_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB014392_C_P-C      cctcctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774284_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF436920_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU916218_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377593_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562299_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774245_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828910_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
JF828908_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
JF828905_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
JF828906_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
JF828907_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
JF828911_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
JF828912_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
AB367430_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB111123_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX504542_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB111121_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB111122_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386689_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccgct
AB367398_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939570_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccgct
FJ899764_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccgct
FJ899761_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccgct
FJ899765_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccgct
KY470880_C_P-C      ccttctgatttctttccttctatccgagatctcctcgacac------------cgcctct
FJ562307_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EF536065_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EF536066_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013851_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475337_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939593_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939538_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173445_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013850_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB697502_C_P-C      cctcaggacttctttccttctgttcgagatctcctcgacac------------cgcctcc
HQ700576_C_P-C      ccttctgatttcttcccatcgattcgagatctcctcgacac------------cgcctca
HQ700571_C_P-C      ccttctgatttctttccgtccattcgagatctcctcgacac------------cgcctca
HQ700570_C_P-C      ccttctgatttctttccgtctattcgagatctcctcgacac------------cgcctca
HQ700569_C_P-C      ccttctgatttctttccgtctattcgagatctcctcgacac------------cgcctca
HQ700545_C_P-C      ccttctgattttttcccgtctattcgagatctcctcgacac------------cgcctca
HQ700564_C_P-C      ccttctgatttctttccgtctattcgagatctcctcgacac------------cgcctca
HQ700565_C_P-C      ccttctgatttctttccgtctattcgagatctcctcgacac------------cgcctca
HQ700573_C_P-C      ccttctgatttctttccgtctattcgagatctcctcgacac------------cgcctca
HQ700563_C_P-C      ccttctgatttctttccgtctattcgagatctcctcgacac------------cgcttca
HQ700556_C_P-C      ccttctgatttctttccgtctattcgagatctccttgacac------------cgcctca
HQ700502_C_P-C      ccttctgatttctttccgtctattcgagatctcctcgacac------------cgcctca
HQ700504_C_P-C      ccttctgatttctttccgtctattcgagatctcctcgacac------------cgcctca
HQ700562_C_P-C      ccttctgatttctttccgtctattcgagatctcctcgacac------------cgcctca
HQ700568_C_P-C      ccttctgatttctttccgtctattcgagatctcctcgacac------------cgcctca
HQ700574_C_P-C      ccttctgatttctttccgtctattcgagatctcctcgacac------------cgcctca
HQ700567_C_P-C      ccttccgatttctttccgtctattcgagatctcctcgacac------------cgcctca
HQ700578_C_P-C      ccttctgatttctttccgtctattcgagacctcctcgacac------------cgcctca
HQ700575_C_P-C      ccttctgatttctttccgtctattcgagacctcctcgacac------------cgcctca
HQ700577_C_P-C      ccttctgatttctttccgtctrttcgagacctcctcgacac------------cgcctca
HQ700495_C_P-C      ccttctgatttctttccgtctattcgagacctcctcgacac------------cgcctca
HQ700496_C_P-C      ccttctgatttctttccgtctattcgagacctcctcgacac------------cgcctca
HQ700476_C_P-C      ccttctgatttctttccgtctrttcgagacctcctcgacac------------cgcctca
HQ700490_C_P-C      ccttctgatttctttccgtctattcgagacctcctcgacac------------cgcctca
HQ700456_C_P-C      ccttctgatttctttccgtctattcgagacctcctcgacac------------cgcctca
HQ700544_C_P-C      ccttctgatttctttccgtctattcgagacctcctcgacac------------cgcctca
HQ700555_C_P-C      ccttctgatttctttccgtctattcgagacctcctcgacac------------cgcctca
HQ700558_C_P-C      ccttctgatttctttccgtctattcgagacctcctcgacac------------cgcctca
HQ700561_C_P-C      ccttctgatttctttccgtctattcgagacctcctcgacac------------cgcctca
HQ700566_C_P-C      ccttctgatttctttccgtctattcgagacctcctcgacac------------cgcctca
HQ700572_C_P-C      ccttctgatttctttccgtctattcgagacctcctcgacac------------cgcctca
HQ700559_C_P-C      ccttctgatttctttccgtctattcgagacctcctcgacac------------cgcctca
X75665_C_P-C        ccttctgatttctttccatctattcgagacctcctcgacac------------cgcctca
HQ700543_C_P-C      ccttctgatttctttccatccattcgagatctcctcgacac------------cgcctca
HQ700506_C_P-C      ccttctgatttctttccgtccattcgagatctcctcgacac------------cgcctca
GQ358157_C_P-C      ccttctgatttctttccatctattcgagatctcctcgacac------------cgcctca
HQ700522_C_P-C      ccttctgatttctttccatctattcgagatctcctcgacac------------cgcctca
KC836842_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939617_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
JX026888_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctca
AB670270_C_P-C      ccttctgacttttttccttctgttcgagatctcatcgacac------------cgcctca
AB670308_C_P-C      ccttctgacttttttccttctgttcgagatctcatcgacac------------cgcctca
GU827639_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB367420_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KU668000_C_P-C      ccttctgacttctttccttctatacgagatctcctcgacac------------cgcctca
KU667964_C_P-C      ccttctggcttctttccttctatacgagatctcctcgacac------------cgcctca
KU667969_C_P-C      ccttctgacttctttccttctatacgagatctcctcgacac------------cgcctca
KU667984_C_P-C      ccttctgacttctttccttctatacgagatctcctcgacac------------cgcctca
KU668013_C_P-C      ccttctgacttctttccttctatacgagatctcctcgacac------------cgcctca
KU668018_C_P-C      ccttctgacttctttccttctatacgagatctcctcgacac------------cgcctca
FJ386611_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939653_C_P-C      cctaatgacttctttccttccattcgagatctcctcgacac------------cgcctca
FJ386624_C_P-C      ccttctgacttctttccttcaattcgagatctcctcgacac------------cgcctca
GQ372968_C_P-C      ccttctgacttctttccttcaattcgagatctcctcgacac------------cgcctca
AB367406_C_P-C      ccttctgacttctttccttcaattcgagatctcctcgacac------------cgcctca
KY363286_C_P-C      cctactgacttctttccttcaattcgagatctcctcgacac------------cgccaca
KY363287_C_P-C      cctactgacttctttccttctattcgagatctcctcgacac------------cgccaca
FJ032333_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ386665_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939569_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ899788_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ899789_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774242_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939615_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ386671_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ386678_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU577055_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctca
KU577062_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctca
KU577049_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctca
KU577057_C_P-C      ccttctgacttctttccttccattcgcgatctccttgacac------------cgcctca
KU577056_C_P-C      ccttctgacttctttccttccattcgcgatctccttgacac------------cgcctca
KU577051_C_P-C      ccttctgacttctttccttccattcgcgatctccttgacac------------cgcctca
KU577052_C_P-C      ccttctgacttctttccttccattcgcgatctccttgacac------------cgcctca
JQ040158_C_P-C      ccttccgacttctttccttccattcgagatctcctcgacac------------cgcctca
GQ475309_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR819180_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctca
KC774225_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
HQ622095_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU562216_C_P-C      ccttctgacttcttcccttctattcaagatctcctcgacac------------cgcctca
EU939582_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU916226_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB250109_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939572_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
JX560519_C_P-C      ccttctgacttttttccttctattcgagatctcctcgatac------------cgcctca
FJ562282_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
EU916225_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
GQ377572_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
FJ787457_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ787458_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctcg
AB670253_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB195936_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
AB195937_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
AB195938_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
EU916223_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
JX560520_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ562232_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
FJ386652_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB670281_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU562215_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU562217_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU916224_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
GQ377514_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
JN104440_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ787442_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
FJ787443_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
KC774194_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB198081_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctcc
KC774215_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774216_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
GQ377528_C_P-C      ccttctgacttctttccctctattcgagatctcctcgacac------------cgcctca
AB670239_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB670240_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB367425_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
MH891502_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
AB670273_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
MH887433_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB900116_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB367404_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB642100_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
GQ377577_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctca
FJ386588_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ787481_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
EU589340_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
EU589341_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
EU589342_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
JX429914_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ787449_C_P-C      ccttctgacttctttccctctattcgagatctcctcgacac------------cgcctca
AB198082_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
GQ377601_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KM229703_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
HQ700516_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctca
KX276838_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
AB642097_C_P-C      cctwckgacttctttccttctattcgagatctcctcgatac------------cgccgct
JQ027323_C_P-C      ccttctgacttctttccttctrttcgagatctsctcgacac------------cgcctct
KF779327_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctct
KJ803762_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccgct
JQ040139_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
KF165568_C_P-C      ccttctgacttttttccttccattcgagatctcctcgacac------------cgcctca
D23682_C_P-C        ccttctgacttctttccttctattcgagatctccttgacac------------cgccgct
D23683_C_P-C        ccttctgacttctttccttctattcgagatctccttgacac------------cgccgct
KJ410510_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccaat
AY206378_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
HM011502_C_P-C      ccttctgacttctttccttctrttcgagatctcctcgacac------------cgcctct
AB367432_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
AB367804_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
JQ027319_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctct
FJ562304_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AY167096_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
DQ089796_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173316_C_P-C      ccttctgacttttttcctgctattcgagatctcctcgacac------------cgcatct
AB202071_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB202072_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
EU939590_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgccgct
EU939591_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgccgct
EU939588_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
FJ899778_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
JQ040144_C_P-C      ccttctgacttctttccttcaattcgagatctcctcgacac------------cgcctct
DQ089795_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB014361_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgccgct
AB670291_C_P-C      ccttctgacttctttccttctattcgagatctactcgacac------------cgcctct
AB367412_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctct
KR013842_C_P-C      ccttctgacttctttccttctatttgagatctcctcgacac------------cgcctct
KR013846_C_P-C      cctcctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013847_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013845_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013844_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013848_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013849_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
HM750135_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386627_C_P-C      ccttcggacttctttccttccattcgcgatctcctcgacac------------cgcctct
EU939651_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctct
FJ751764_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
FJ751765_C_P-C      ccttctgactttttttcttctattcgagatctcctcgacac------------cgcctct
V00867_C_P-C        ccttctgacttctttccgtctattcgagatctccttgacac------------cgcctct
FJ562284_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgccgct
AY206382_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670278_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774229_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JN104432_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JN104433_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939550_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
DQ478900_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939553_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB367435_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386685_C_P-C      ccttctgacttctttccttctattcgagatctcmtcgacac------------cgcctct
EU939537_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
AB670301_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KX276835_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
EU881996_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670266_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccgct
KC774311_C_P-C      ccttctgacttctttcctgctattcgagatctcctcgacac------------cgcctct
JQ707729_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707719_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707716_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707707_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707709_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707710_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707711_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707712_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707713_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707715_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707717_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707718_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707720_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707721_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707722_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707723_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707724_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707725_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707726_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707727_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707728_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707730_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707731_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707732_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707733_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ707708_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670277_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377583_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
HM750134_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670243_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
AB014373_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670290_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ751770_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ151413_C_P-C      ccttctgacctctttccgtctattcgagatctcctcgacac------------cgcctct
KC774264_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JN315779_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386607_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctct
DQ993693_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
DQ478885_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AY206389_C_P-C      cctcctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
HM750137_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctcc
KC774343_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctcc
FJ787467_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
FJ787466_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
FJ787464_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
FJ787465_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
KC774265_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774217_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
FJ715372_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB367803_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB367416_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB033553_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
FJ715371_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715398_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715400_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774190_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB033551_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB033552_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB367396_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB033556_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ790199_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB367417_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173327_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
DQ993690_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ924633_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173446_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KF873525_C_P-C      ccttctgatttctttccgtctatkcgagatctcctcgacac------------cgcctcc
KF873526_C_P-C      ccttctgatttctttccgtctattcgagatctcctcgacac------------cgcctcc
AB900113_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctct
JQ801498_C_P-C      ccttctgacttctttcctaatattcgagatctactcgacac------------cgcctct
GQ475343_C_P-C      ccttctgacttctttcctcctgttcgagatctcctcgacac------------cgcctct
GQ475352_C_P-C      ccttctgacttctttcctcctgttcgagatctcctcgacac------------cgcctct
AF323463_C_P-C      cctactgacttctttccttctgttcgagatctcctcgacac------------cgcctct
FJ562326_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EF494377_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
AB014387_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB697510_C_P-C      cctactgacttctttccttctattcgagatctcctagacac------------cgcctct
EU939583_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
EU554540_C_P-C      ccttctgacttctttccttcaattcgagatctcctcgacac------------cggctct
AB367392_C_P-C      cctcctgacttctttccttcggttcgagatctcatcgacac------------cgcctct
AB113875_C_P-C      ccttctgacttctttccttctattcgagatctcctcgatac------------cgcctct
AB113876_C_P-C      ccttctgacttctttccttctattcgagatctcctcgatac------------cgcctct
AB367413_C_P-C      ccttctgacttctttccttccattcgagagcttatcgacac------------cgcctct
AB111113_C_P-C      ccttctgacttctttccttctgttcgagatctcctggacac------------cgcctct
KF214651_C_P-C      ccttctgacttctttccttcaattcgagatctactcgacac------------cgcctct
GQ377599_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgccgct
AB485809_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB485810_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU668280_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KY363275_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY689435_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY689525_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939648_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccact
AB367410_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcttct
JF828937_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY363280_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ040152_C_P-C      ccttctgacttctttccttctrttcgagatctcctcgacac------------cgcctct
EU939616_C_P-C      ccttctgacttctttccttctattcgagatctactcgacac------------cgcctct
AY247031_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU939587_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccttt
AB367427_C_P-C      ccttctgacttctttccttctattcgagatctcctcgatac------------cgcctct
KC774238_C_P-C      ccttctgacttctttccttctattcgagatcttctcgacac------------cgcctct
AB670294_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcatct
AB670305_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcatct
JX036339_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774211_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX036335_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX036336_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX036337_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774277_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774254_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774256_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774213_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774214_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774335_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774191_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
HM750136_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774283_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774189_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
MH094411_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
FJ386575_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
EU916216_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccttt
KC774287_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774187_C_P-C      ccttctgacttctttccttctattagagatctcctcgacac------------cgcctct
KC774352_C_P-C      ccttctgacttctttccttctattagagatctcctcgacac------------cgcctct
KC774338_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctct
FJ386630_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
KY363281_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774309_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774247_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgatac------------cgcctct
FJ032331_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
JX661490_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386603_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KC774181_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
HM750141_C_P-C      ccttctgacttctttccttctattagagatctcctcgacgc------------cgcctct
LC279274_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774342_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
JQ040166_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
FJ386576_C_P-C      ccttctgacttctttccttctattcgagatctactcgacac------------cgcctct
AY247032_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
AB026815_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------tgcctct
EU560440_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU579442_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774196_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774336_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562318_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562330_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470887_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470882_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY470885_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774337_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
KC774299_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
KC774278_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KC774200_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774205_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774208_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774182_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377541_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377533_C_P-C      ccttctgacttctttccttctattagagatctcctcgacac------------cgcctct
AB367424_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB198078_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU916237_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC875261_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774261_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttct
KC774262_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttct
KR013852_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC875263_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774345_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475317_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
FJ386639_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475314_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475319_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC875262_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ475316_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB670238_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU916238_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ040127_C_P-C      cctwmtgacttctttccktcyatycgagatctcctcgacac------------cgcytct
EU939657_C_P-C      cctgctgacttctttccttccattcgagatctcctcgacac------------cgcctct
AB014371_C_P-C      cctcatgacttctttccttccattcgagatctcctcgacac------------cgcttca
FJ899795_C_P-C      cctgctgacttctttccttctattcgggatctcctcgacac------------cgccttt
KJ410521_C_P-C      ccttcggacttctttccttctgttcgagatctcctcgacac------------cgcctca
FJ562331_C_P-C      ccttctgacttttttccttctattygagatctcatcgacac------------cgcctca
KU576449_C_P-C      ccttctgatttctttccttctgttcgagatctcctcgacac------------cgccgct
GQ377586_C_P-C      cctactgacttctttccttctattcgagatctcctcgacac------------tgcctct
FJ899793_C_P-C      cctgctgacttttttccttctattcgagatctcctcgacac------------tgcctct
FJ899794_C_P-C      cctgctgacttttttccttctattcgagatctcctcgacac------------tgcctct
AY220702_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgccgct
EU939585_C_P-C      ccttctgacttttttccttccattcgagatctcctcgacac------------cgcctct
FJ386621_C_P-C      cctcatgacttctttccttctatgcaagatctcgtcgacac------------cgcctat
GQ377557_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU576454_C_P-C      ccttctgatttctttcctgctattcgagatctcctcgacac------------cgcctct
FJ032346_C_P-C      cctactgacttctttccttccattcgagatctcctcgacac------------cgcctct
FJ032347_C_P-C      cctactgacttctttccttccattcgagatctcctcgacac------------cgcctct
KR013942_C_P-C      ccttctgacttctttccttctattcgagatctcctcgatac------------cgcctct
KR013789_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013788_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013790_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU576453_C_P-C      ccttctgatttctttccttctgttcgagatctcctcgacac------------cgcctct
DQ089794_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
EU939649_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562295_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939566_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173439_C_P-C      ccctctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KJ173440_C_P-C      ccctctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KC774266_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX429909_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------tgcctct
DQ089793_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX429907_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774195_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
JQ040129_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU576455_C_P-C      ccttctgatttctttccttctgttcgagatctcctcgacac------------cgcctct
KU576457_C_P-C      ccttctgatttctttccttctgttcgagatctcctcgacac------------cgcctct
FJ787471_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
FJ032355_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ032356_C_P-C      ccttctgacttctttccttctattcgagatctcctcggcac------------cgcctct
FJ787470_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386641_C_P-C      ccttctgacttytttccttctrttcgagatctcctcgacac------------cgcctct
EU939658_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KC774331_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccaca
EU939571_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
EU439013_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgagac------------cgcctct
FJ715383_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715403_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715407_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
FJ715409_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
FJ715382_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715402_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715381_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715421_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX429913_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU306725_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU439014_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU439005_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU306722_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
DQ377163_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU306727_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU306719_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
DQ377165_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
DQ377162_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
DQ377161_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU306713_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU306714_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU306720_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU306721_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU306729_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
DQ377164_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
DQ377160_C_P-C      ccttctgacttcttcctttctattcgagatctcctcgacac------------cgcctct
EU439012_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU439009_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU439008_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU306724_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU306726_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU306728_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU439010_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU439011_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU439025_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
FJ562285_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ040141_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
GQ377598_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
MF674429_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX661488_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939652_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
EU916213_C_P-C      ccttctgacttctttccttctattcgaggtctcctcgacac------------cgcctct
GQ377527_C_P-C      ccttctgacttctttccttctatacgagatctcctcgacac------------cgcctct
FJ562332_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562233_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctct
EU916211_C_P-C      ccctctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU916214_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013791_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774339_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774289_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386587_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU916212_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ032332_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562335_C_P-C      cctgctgacttctttccttctgttcgagatctcctcgacac------------cgccatt
FJ562337_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctct
JQ040167_C_P-C      cctttggacttctttccttctattcgagatctcctcgacac------------cgcctcw
JQ040149_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU668050_C_P-C      ccttctgacttttttccttctgttcgagatctccttgacac------------cgccaca
JQ040132_C_P-C      ccttckgacttctttccttctgttcgagatctcatcgacac------------cgcctct
KR014007_C_P-C      ccttctgacttctttccttccattcaagatctcctcgacac------------cgcctct
KR014002_C_P-C      ccttctgacttctttccttccattcaagatctcctcgacac------------cgcctct
KR014005_C_P-C      ccttctgacttctttccttccattcaagatctcctcgacac------------cgcctct
KR014000_C_P-C      ccttctgacttctttccttccattcaagatctcctcgacac------------cgcctct
KU964343_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377609_C_P-C      ccttctgacttctttcctaacattcgagatctcctcgacac------------cgcctct
DQ980549_C_P-C      ccttctgacttctttccttctgttcgagatctcatcgacac------------cgcctca
FJ562339_C_P-C      ccttctgacttctttccttctactcgagatctcmttgacac------------cgcctca
EU939555_C_P-C      cctgctgacttctttccttctgttcaagatctcctcgacac------------cgcctct
FJ386662_C_P-C      ccttctgacttctttcctgctattcgagacctcctcgacac------------cgcctct
FJ386644_C_P-C      ccttttgaattctttctttccattcgagatctcctggacac------------cgcctct
AB670304_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgccgcc
KU963937_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
FJ386612_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccact
FJ386661_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctct
EU717215_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
AY206381_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB367428_C_P-C      ccttctgacttctttccttccgttcgagatctcctcgacac------------cgcctcc
AB675674_C_P-C      ccttctgacttctttccttctattcgagatctactcgacac------------cgcctct
AB675675_C_P-C      ccttctgacttctttccttctattcgagatctactcgacac------------cgcctct
DQ922651_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939586_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccact
FJ562238_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU570073_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU570074_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB014388_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
JX661497_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
AB111118_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
FJ562251_C_P-C      ccttctgacttctttcctactattcgagatctcctcgacac------------cgcctca
EU939567_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccgct
KR014048_C_P-C      ccttctgacttctttccttctattcaagatctcctcgacac------------cgcctct
AY220699_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
AY220700_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
FJ562266_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccact
DQ975274_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KC774357_C_P-C      ccttctgacttttttccttccgttcgagatctcctcgacac------------cgcctca
JX504539_C_P-C      ccttctgacttctttccttctattcaagatctccgcgacac------------cgcctct
FJ562315_C_P-C      ccttctgacttctttccttctattcaagacctcctcgacac------------cgcctca
FJ562291_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccacc
FJ386657_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939564_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU796069_C_P-C      ccttctgacttctttcctgctattcgagatctcctcgacac------------cgcatct
AB014364_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
EU939556_C_P-C      cctgctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
GQ377543_C_P-C      ccttctgacttctttccttctattcgagatctgctcgacac------------cgcctca
KU964324_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964332_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964321_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964323_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964326_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964328_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964329_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964318_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964319_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964320_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964322_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964325_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964327_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964330_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964331_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KU964333_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
FJ787459_C_P-C      ccttctgacttctttcctgctattcgagatctcctcgacac------------cgcctct
FJ715343_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
AB367434_C_P-C      ccttctgacttctttccttccattcgagatctactcgacac------------cgcctca
EU871971_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctcg
AF182805_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AF182802_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AF182803_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU871969_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR014041_C_P-C      ccttctgacttctttccttctattcaagatctcctcgacac------------cgcctct
FJ562272_C_P-C      ccttctgacttctttccgtccattcgagatctcctcgacac------------cgccact
KY470975_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY470966_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY470978_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY470976_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY470971_C_P-C      cctgctgacttctctccttctattcgagatctcctcgacac------------cgcctca
KY470972_C_P-C      cctgctgacttctctccttctattcgagatctcctcgacac------------cgcctca
KY470967_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY470965_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY470969_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY470974_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY470968_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY470970_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY470973_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY470977_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY470979_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR014092_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctca
FJ787484_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562313_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccttt
DQ986376_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgctgca
KR013814_C_P-C      ccttctgacttctttccttccgttcgagatctccttgacac------------cgcctct
KR013812_C_P-C      ccttctgacttctttccttccattcgagatctccttgacac------------cgcctct
KR013809_C_P-C      ccttctgacttctttccttccattcgagatctccttgacac------------cgcctct
KR013810_C_P-C      ccttctgacttctttccttccattcgagatctccttgacac------------cgcctct
KR013811_C_P-C      ccttctgacttctttccttccattcgagatctccttgacac------------cgcctct
KR013813_C_P-C      ccttctgacttctttccttccattcgagatctccttgacac------------cgcctct
KR013815_C_P-C      ccttctgacttctttccttccattcgagatctccttgacac------------cgcctct
KJ173295_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774320_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
JQ040154_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctcw
FJ518810_C_P-C      ccttctgacttctttccttctattcaagatctcatcgacac------------cgcctct
FJ386598_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgatac------------cgcctca
FJ032338_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctca
EU939554_C_P-C      ccttctgacttttttccttctattcgagatctcctggacac------------cgcctca
AB198083_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctcc
AB014381_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
DQ986375_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
DQ975273_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
DQ980550_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
AB367414_C_P-C      ccttctgacttctttccttcaattcgagatctcctcgacac------------cgcctcc
AB367407_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctcc
AB300372_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctcc
AB670269_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctcc
AB300359_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctcc
AB670282_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctcc
AB670307_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctcc
LC279275_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
LC279276_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
LC318702_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
LC318703_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377580_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ899777_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctca
FJ562308_C_P-C      ccttctgacttctttccttcaattcgagatctcctcgacac------------cgcctct
FJ562269_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ562245_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774360_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ715406_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ715404_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ715380_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ715377_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ715378_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ715379_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU554541_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU554542_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ032345_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU963996_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctcc
KU964002_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctcc
KU963992_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctcc
KU963997_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctcc
KU964076_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964078_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964064_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964065_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964066_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964067_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964068_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964069_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964070_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964071_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964072_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964073_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964074_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964075_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964334_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964336_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964337_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964338_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964339_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964340_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964341_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964342_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964344_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964345_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964346_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964347_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964348_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964077_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939543_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccaca
FJ562340_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgccaca
KY881803_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013772_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
KJ173433_C_P-C      ccttctgatttctttccttccattcgagatctcctcgacac------------cgcctct
KJ173434_C_P-C      ccttctgatttctttccttccattcgagatctcctcgacac------------cgcctct
KC774359_C_P-C      ccttctgacttttttccttccattcgagatctcctcgacac------------cgcctca
KC774314_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774286_C_P-C      ccttctgacttttttccttccattcgagatctcctcgacac------------cgcctca
GQ377617_C_P-C      ccttctgacttctttccttccattcgggatctcctcgacac------------cgcctct
FJ032350_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
FJ032351_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
EU939557_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
DQ922649_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcatca
AY596108_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB014396_C_P-C      ccttctgacttctttccttcaattcgagatctcctcgacac------------cgcctct
KJ173311_C_P-C      ccttctgacttctttccttctattcgagatctcctagacac------------cgcctca
KJ173312_C_P-C      ccttctgacttctttccttctattcgagatctcctagacac------------cgcctca
FJ715405_C_P-C      ccttctgacttctttccctctatacgagatctcctagacac------------cgcctca
FJ715376_C_P-C      ccttctgacttctttccttctatacgagatctcctagacac------------cacctca
FJ715375_C_P-C      ccttctgacttctttccttctatacgagatctcctagacac------------cgcctca
FJ715374_C_P-C      ccttctgacttctttccttctatacgagatctcctagacac------------cgcctca
FJ715389_C_P-C      ccttctgacttctttccttttatacgagatctcctagacac------------cgcctca
KJ173317_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
JX026884_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
GQ377636_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctca
EU916217_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU717218_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
KR013771_C_P-C      ccttctgacttccttccttctattcgagatctcctcgacac------------cgcctca
EU439015_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964046_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964034_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964035_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964036_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964037_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964038_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964039_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964040_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964041_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964042_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964043_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964044_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964047_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964048_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
KU964045_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
FJ032334_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ715355_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715357_C_P-C      ccttctggcttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715358_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ787453_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ787454_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB288026_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
LC373511_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
LC373512_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB050018_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB367397_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013866_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KJ173431_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173432_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctct
KJ173296_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963898_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacat------------cgcctca
KU963886_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963887_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963888_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963889_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963890_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963892_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963893_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963894_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963895_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963896_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963897_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963899_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963891_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cacctca
LC279246_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964180_C_P-C      ccttctgacttctttccttctactcgagatctcctcgacac------------cgcctct
KR014006_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013875_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013803_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013802_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774310_C_P-C      ccttctgacttctttccttctattcgcgatctcctcgacac------------cgcctca
KC774281_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
KC774237_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774224_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
JX661495_C_P-C      ccttccgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX429918_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX429915_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ040162_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
GQ377538_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377524_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715344_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
FJ386653_C_P-C      ccttctgacttctttccttcaattcgagatctcctcgacac------------cgcctca
FJ386619_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ386618_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
EU939642_C_P-C      cctttggacttctttccttctattcgagatctcctcgacac------------cgcctct
EU872008_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcttca
AB670311_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttca
EU871975_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcttca
EU871977_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcttca
KJ173391_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
KJ173392_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctct
D28880_C_P-C        ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
S75184_C_P-C        ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB195952_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
AB195953_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
AB195954_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
KC774271_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctca
JX504534_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ562292_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
DQ089799_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
FJ787479_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
FJ787439_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
FJ787441_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
FJ715342_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
KC774290_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
FJ562327_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386591_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
MG893558_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ386579_C_P-C      cctttggacttctttccttctattcgagatctcctcgacac------------cgcctct
AB014391_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgccact
FJ386597_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173435_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctca
GQ377637_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctca
KJ173436_C_P-C      ccttctgacttctttccttctattcgagacctcctcgacac------------cgcctca
KU963882_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963871_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963877_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963878_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963880_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963885_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963872_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963873_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173293_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ173294_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173315_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
MG893560_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
LC279261_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
LC279250_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
LC090200_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881880_C_P-C      ccttccgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964198_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964004_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KT284755_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013984_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013808_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013773_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173331_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KJ173332_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KJ173302_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774356_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774326_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774315_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774249_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173441_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
JX661496_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
JX661493_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctca
JX429916_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctca
GU434374_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
GQ377632_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctct
GQ377551_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
FJ518813_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386637_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctca
FJ032361_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ032339_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
EU939611_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcatca
EU872010_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttca
EU871982_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttca
AF363961_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB299858_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB426467_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB198079_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcatct
AB014395_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB014385_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881737_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881744_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881765_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173328_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AY206384_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881736_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881738_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881739_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881742_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881743_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881748_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881749_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881750_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881751_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881754_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881755_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881758_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881762_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881763_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881764_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881766_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881767_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881768_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881769_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881770_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881771_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881772_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881773_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881774_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881775_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881776_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881777_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
JX429906_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173429_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173430_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173442_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB670254_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
LC279245_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
LC279258_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881980_C_P-C      ccttccgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881984_C_P-C      ccttccgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013909_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013908_C_P-C      ccttctgacttctttccttctattcgaggtctcctcgacac------------cgcctca
KR013776_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctca
KJ598697_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KJ598691_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598689_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598694_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598698_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598699_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173427_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173428_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774292_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774210_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774203_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ386667_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ032336_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939619_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AF458664_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB300365_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ562244_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
JX429904_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774295_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774312_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173281_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173282_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173289_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173291_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173292_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173301_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173303_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173304_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173395_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173396_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598688_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598690_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598695_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598696_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598701_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598740_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598749_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598753_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013774_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB014362_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
D23680_C_P-C        ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
LC279259_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
LC279260_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
LC279262_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB246345_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939580_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ787461_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377628_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562281_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562290_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964191_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377546_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KC774248_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ173307_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ173308_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ173309_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ173310_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ173443_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ173444_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KU964181_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KU964176_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013998_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013858_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173306_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173305_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ040145_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttct
HM750140_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcatct
GQ377624_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377584_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562258_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386595_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386577_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU916215_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB111119_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB111120_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX504545_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774318_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KJ173321_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013827_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013873_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013877_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964169_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964170_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964171_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964174_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964178_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964183_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964184_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964187_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964188_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964192_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964193_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964194_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964195_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964196_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964197_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964199_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB026811_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttct
AB026812_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttct
AB026814_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttct
AB026813_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttct
FJ386640_C_P-C      ccgactgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KU577024_C_P-C      cctgctgacttctttccttctgttcgagagctcctcgacac------------cgcctca
EU939599_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KU667409_C_P-C      ccttctgacttttttccttctattcgagagctcctcgacac------------cgcctca
KU576858_C_P-C      ccttctgacttttttccttctattcgggatctcctcgacac------------cgcctca
KU576118_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576951_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576920_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576919_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576688_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576627_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576588_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576586_C_P-C      cctcctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576581_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576122_C_P-C      ccttctgacttctttccttctattcgggagctcctcgacac------------cgcctca
KU576117_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576643_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576580_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576584_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU577106_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576833_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576696_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576677_C_P-C      ccttctgacttttttccttctatttgggagctcctcgacac------------cgcctca
KU576631_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576422_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576142_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576115_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576116_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576119_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576120_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576121_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576124_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576143_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576144_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576503_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576585_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576615_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576635_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576642_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576644_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576697_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576752_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576763_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576835_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576838_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576899_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576937_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576941_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
KU576123_C_P-C      ccttctgacttttttccttctattcgggagctcctcgacac------------cgcctca
AB014383_C_P-C      ccttctgacttttttccttctatacgagatctcctcgacac------------cgccgct
EU872013_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcttca
AB642095_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939596_C_P-C      ccttctgacttctttcctaatattcgagatctcctcgacac------------cgcctca
KY689518_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AY206392_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939645_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ562324_C_P-C      ccttctgacttctttccttctgttcaagatctcctcgacac------------cgcctca
KR014059_C_P-C      ccttctgacttctttccttctattcgagatctcgtcgacac------------cgcctca
KR013862_C_P-C      ccttctgacttttttccttctattcgagatctcgtcgacac------------cgcctca
KR014057_C_P-C      ccttctgacttctttccttctattcgagatctcgtcgacac------------cgcctca
FJ386594_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU717212_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386663_C_P-C      ccttctgacttctttccttccattcgagatctcatcgacac------------cgcctca
KY881816_C_P-C      ccttctgacttctttccttctactcgagatctcctcgacac------------cgccaca
KY881805_C_P-C      ccttctgacttctttccttctactcgagatctcctcgacac------------cgcctca
KY881809_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881819_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881812_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881813_C_P-C      ccttctgacttctttccttctattcaagatctcctcgacac------------cgcttca
KY881810_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881802_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881806_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881807_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881818_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881814_C_P-C      ccttctgacttcttttcttctattcgagatctcctcgacac------------cgcctca
KY881815_C_P-C      ccttctgacttcttttcttctattcgagatctcctcgacac------------cgcctca
KY881804_C_P-C      ccttctgacttctttcctgctattcgagatctcctcgacac------------cgcctca
KY881811_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881817_C_P-C      ccttctgacttctttccttctattcgagatcgcctcgacac------------cgcctca
AB300368_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939544_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
JX026885_C_P-C      ccttctgacttctttccttctattcgagatctccttgacac------------cgcctca
FJ562242_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
JX429912_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
GQ377597_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
DQ922650_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB642099_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ386670_C_P-C      ccttctgacttctttcctaacattcgagatctcctcgacac------------cgcctca
MG893553_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KT284754_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
FJ787447_C_P-C      ccttctgatttctttccttctattcgagatctcctcgacac------------cgcctca
FJ562276_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939574_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KC774347_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
KR013831_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013828_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013833_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013832_C_P-C      cctcctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013829_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013830_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013834_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KP784761_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598717_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598705_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598706_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598707_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598708_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598709_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598711_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598712_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598713_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598714_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598715_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598718_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598719_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598681_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774327_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
GQ377640_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
GQ377521_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
GQ377515_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ562275_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ562274_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB471848_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB471850_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU554535_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939604_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ032340_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ032341_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
GQ377574_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
GQ377615_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
GQ377619_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
GQ377642_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774268_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774276_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598710_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598716_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB471849_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB014382_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttct
KR013861_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013859_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR013860_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR014055_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KR014060_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774301_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774269_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386613_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AF411410_C_P-C      ccttctgacttttttccttccattcgagatctcctcgacac------------cgcttca
AB014384_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
EU871980_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttca
EU871998_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttca
GQ377526_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939618_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
AB195947_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
AB195948_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KC774199_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828923_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828921_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828922_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828928_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828924_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828925_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828926_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828929_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828930_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JF828931_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KT284759_C_P-C      ccttctgacttttttccttctattcgagatctcctcgatac------------cgcctct
D23681_C_P-C        ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB670276_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttca
AB014399_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939545_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ173337_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
JX504541_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
AB014380_C_P-C      ccttctgacttttttccttctattcgagacctcctcgacac------------cgcctct
AB670289_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcttca
FJ562249_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB014379_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ787462_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ787463_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KM875423_C_P-C      ccttcggacttctttccttccgttcgggatctcctcgacac------------cgcctca
EU871974_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
EU871970_C_P-C      ccttctgacttttttccttccgttcgagatctcctcgacac------------cgccgca
EU871972_C_P-C      ccttctgacttttttccttccgttcgagatctcctcgacac------------cgccgca
AF182804_C_P-C      ccttctgacttctttccttctgttagagatctcctcgacac------------cgccgca
FJ151414_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgccgca
DQ788835_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgccgca
EU871973_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgccgca
FJ562220_C_P-C      ccttctgacttctttccttctgttcgagagctcctcgacac------------cgcctca
FJ386628_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctca
FJ386651_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctcg
FJ787485_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgtctca
FJ787482_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctca
FJ787483_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881972_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
AY269099_C_P-C      ccttcggacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881962_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881990_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881889_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881994_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881991_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881989_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881891_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881887_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881886_C_P-C      ccttccgacttctttccttctattcgagatctcatcgacac------------cgcctca
KY881881_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881875_C_P-C      ccttccgacttctttccgtctgttcgagatctcctcgacac------------cgcctca
KY881884_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881960_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881971_C_P-C      ccttccgacttctttccttctgttcgagatctcatcgacac------------cgcctca
KY881978_C_P-C      ccttccgacttctttccttctgttcggggtctcctcgacac------------cgcctca
KY882002_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY882001_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881997_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881979_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881961_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881890_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881888_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881876_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881874_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881871_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881966_C_P-C      ccttccgacttctttccttctgttcgagatctcatcgacac------------cgcctca
KY882003_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881988_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881885_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881878_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881987_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881974_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881892_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881882_C_P-C      ccttccgacttctttccgtctgttcgagatctcctcgacac------------cgcctca
KY881883_C_P-C      ccttccgacttctttccgtctgttcgagatctcctcgacac------------cgcctca
KY881870_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881872_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881981_C_P-C      ccttccgacttctttccttctgttcgagatctcatcgacac------------cgcctca
KY881993_C_P-C      ccttccgacttctttccttctgttcgagatctcatcgacac------------cgcctca
KY881877_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881873_C_P-C      ccttccgacttctttccttctattcgagatctcctcgacac------------cgcctca
KY881879_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KY881973_C_P-C      ccttccgacttctttccttctgttcgagatctcctcgacac------------cgcctca
KU668181_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
KU668135_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
MF568467_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
KY689471_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
EU919169_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KR013863_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgccgct
GQ377575_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgccaca
KJ598772_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KJ598780_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KR013865_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacgc------------cgccgct
EU871978_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcttca
EU871979_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcttca
EU939655_C_P-C      ccttctgacttctttccttctgttcgggatctcctcgacac------------cgccgct
EU939656_C_P-C      ccttctgacttctttccttctgttcgggatctcctcgacac------------cgccgct
KF166858_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgccgca
KU964016_C_P-C      ccttctgactttttttcttctgttcgagatctcctcgacac------------cgcctca
KU964011_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
KU964012_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
KU964013_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
KU964017_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
KU964018_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
KU964019_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
KU964015_C_P-C      ccttctgacttctttccttcggttcgagatctcctcgacac------------cgcctca
FJ032359_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
FJ032360_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgccact
AB670261_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
KR013867_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
EU919168_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KR013864_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KJ173290_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctca
FJ562293_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
KR013869_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
KR013805_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctct
KU964014_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctca
KR013804_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------tgcctct
KR013807_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctct
AF384371_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctct
EU560441_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctct
FJ787486_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctct
FJ899776_C_P-C      ccttctgacttttttccttctgttcgagatctcctcgacac------------cgcctct
AF384372_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
DQ980551_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AF411412_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctcc
AB014393_C_P-C      ccttctgacttttttccttccattcgagatctcctcgacac------------cgcctct
EU872001_C_P-C      ccttctgacttctttcctaatattcgagatctcctcgacac------------cgcctct
EU872003_C_P-C      ccttctgacttctttcctaatattcgagatctcctcgacac------------cgcctct
EU872000_C_P-C      ccttctgacttctttcctaatattcgagatctcctcgacac------------cgcctct
EU872002_C_P-C      ccttctgacttctttcctaatattcgagatctcctcgacac------------cgcctct
EU872004_C_P-C      ccttctgacttctttcctaatattcgagatctcctcgacac------------cgcctct
FJ562228_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY363266_C_P-C      ccttctgacttctttccttctgtacgagatctcctcgacac------------cgcctct
KY363267_C_P-C      ccttctgacttctttccttctgtacgagatctcctcgacac------------cgcctct
EU579443_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
EU589336_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctca
KU668271_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013868_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JQ040168_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcaaca
GQ377608_C_P-C      ccttctgacttctttcctactattcgagatctcctcgacac------------cgcctct
EU939595_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
DQ975272_C_P-C      ccttctgacttctttccttctattcaagatctcctcgacac------------cgcctca
AB900099_C_P-C      ccttctgacttctttccttctgttcgagatctcctcgacac------------cgcctca
AF458665_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
EU939546_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
FJ562239_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
AB014369_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
EU939659_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
KR014098_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR014099_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013874_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013872_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013876_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939644_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964200_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
KU964202_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
KU964203_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
KU964205_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
KU964206_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
KU964209_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
KU964212_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
KU964201_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
KU964204_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
KU964207_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
KU964208_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
KU964210_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
KU964211_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
KU964213_C_P-C      ccttcggacttctttccttctattcgagatctcctcgacac------------cgccaca
EU939605_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB014397_C_P-C      ccttctgacttttttccttccattcgagatctcctcgacac------------cgcttct
EU916233_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
EU916234_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
FJ386645_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ173319_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
FJ787452_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU964185_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctct
KU964186_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctct
KU964189_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctct
KU964190_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctct
FJ562235_C_P-C      ccttctgacttttttccttccattcgagatctcctcgacac------------cgcctct
EU916227_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU522069_C_P-C      ccttccgacttctttccttctattcgagatctccttgacac------------cgcctct
AB670241_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ562252_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
JQ040172_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881992_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881983_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881968_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881928_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctct
FJ386574_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881976_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881938_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881939_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881940_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881941_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881942_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881943_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881964_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881996_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881959_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881969_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881977_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881963_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881915_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881916_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881918_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881919_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881921_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881922_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881923_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881924_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881925_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881926_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881927_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881929_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881930_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881931_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881932_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881933_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881934_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881935_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881936_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881965_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881975_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881982_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881985_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881986_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881995_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881998_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY882000_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881917_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881967_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881970_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881999_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881920_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KY881937_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386632_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964349_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964358_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU964363_C_P-C      cctgctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562270_C_P-C      ccttctgacttytttccttctattcgagatctcctcgacac------------cgcctca
EU939561_C_P-C      ccttctgacttttttccttccattcgagatctcctcgacac------------cgcctca
EU939609_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598679_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
KJ598686_C_P-C      ccttctgacttctttccttccattcgagatctcctcgacac------------cgcctca
EU939576_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU554536_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598680_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598687_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ899771_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939563_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ899769_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ899770_C_P-C      ccttctgacttctttccttctattcgagaactcctcgacac------------cgcctca
AF411408_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AF411411_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU796070_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU796072_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
D23684_C_P-C        ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU871976_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
DQ089800_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AB670249_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939610_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774358_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU939560_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
EU717217_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598744_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ598747_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ598741_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ598742_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ598746_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ598748_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ598751_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ598754_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ598743_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KJ598750_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
KJ598752_C_P-C      ccttctgacttttttccttctattcgagatctcctcgacac------------cgcctca
EU522068_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AY306136_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AY167090_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU939584_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KU963879_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963884_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963874_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963875_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963876_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KU963881_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
KC774218_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
AY066028_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
JX429903_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctca
FJ562248_C_P-C      ccttctgacttttttccttctattcgggatctcctcgacac------------cgcctct
EU560438_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU560439_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
EU570072_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562261_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
FJ787455_C_P-C      ccgtctgacttctttccttctactcgagatctcctcgacac------------cgcctcg
EU939646_C_P-C      ccgtctgacttctttccttccattcgagatctcctcgacac------------cgcctct
EU939568_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgccact
FJ787456_C_P-C      ccgtctgacttctttccttctattcaagatctcctcgacac------------cgcctct
FJ562265_C_P-C      ccgtctgacttctttccttctrttcgagatctcctcgacac------------cgcctct
FJ386650_C_P-C      ccgtctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
FJ715391_C_P-C      cagtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715351_C_P-C      cagtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715368_C_P-C      cagtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715418_C_P-C      cagtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715390_C_P-C      cagtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB205123_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774231_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB198080_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715352_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715353_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715365_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715370_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774333_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715359_C_P-C      ccgtctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ715360_C_P-C      ccgtctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
FJ715415_C_P-C      ccgtctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
FJ715416_C_P-C      ccgtctgacttctttccttctgttcgagatctcctcgacac------------cgcctct
EU939603_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
FJ386592_C_P-C      ccttctgacttttttccttctatccgggatctcctcgacac------------cgcctct
EU939640_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013800_C_P-C      ccttctgacttctttccttcgattcaagatctcctcgacac------------cgcctct
KR013969_C_P-C      ccttctgacttctttccttcgattcgagatctcctcgacac------------cgcctct
KR013975_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013801_C_P-C      ccttctgacttctttccttcaattcgagatctcctcgacac------------cgcctct
GQ377530_C_P-C      ccttctgacttctttccttctatccgggatctcctcgacac------------cgcctct
FJ787445_C_P-C      ccttctgacttctttccgtctattcgagatctcctcgacac------------cgcctct
AF461357_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AF461363_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013974_C_P-C      ccttctgacttctttccttctattcgaggtctcctcgacac------------cgcctct
JQ040163_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ386609_C_P-C      ccttctgacttctttccttctattcgagatctcatcgacac------------cgcctct
KY470900_C_P-C      ccttctgacttttttccttctattcgagatctccttgacac------------cgcctct
KY470894_C_P-C      ccttctgacttttttccttctattcgagatctccttgacac------------cgcctct
KY470895_C_P-C      ccttctgacttttttccttctattcgagatctccttgacac------------cgcctct
KY470897_C_P-C      ccttctgacttttttccttctattcgagatctccttgacac------------cgcctct
KY470899_C_P-C      ccttctgacttttttccttctattcgagatctccttgacac------------cgcctct
KY470901_C_P-C      ccttctgacttttttccttctattcgagatctccttgacac------------cgcctct
KY470902_C_P-C      ccttctgacttttttccttctattcgagatctccttgacac------------cgcctct
KY470903_C_P-C      ccttctgacttttttccttctattcgagatctccttgacac------------cgcctct
KY470904_C_P-C      ccttctgacttttttccttctattcgagatctccttgacac------------cgcctct
KY470905_C_P-C      ccttctgacttttttccttctattcgagatctccttgacac------------cgcctct
KY470896_C_P-C      ccttctgacttttttccttctattcgagatctccttgacac------------cgcctct
KC774293_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774239_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcatct
JX504546_C_P-C      ccttctgacttctttccttctattcgggatctcctcgacac------------cgcctct
EU939600_C_P-C      ccttctgacttcttcccttctattcgagatctcctcgacac------------cgcctct
EU916210_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KC774241_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
AB198077_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377578_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
FJ562283_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
GQ377579_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX429917_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
JX504544_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
KR013799_C_P-C      ccttctgacttctttccttctattcgagatctcctcgacac------------cgcctct
                                                                                

FJ562286_C_P-C      gccgcgtcgcagaagatctc--aatctcgggaatctcaatgttagtatcccttggactca
KC774226_C_P-C      gctctgtatcgggaggccttaaagtctccggaa---cattgttcacctcac-------ca
HM042269_C_P-C      gctctgtatcgggaagccttagagtctcctgag---cattgttcacctcat-------ca
KC774179_C_P-C      gctctgtatcgggatgccttagagtctccggaa---cattgttctcctcac-------ca
KC774297_C_P-C      gctctgtatcgggatgccttagagtctccggaa---cattgttctcctcac-------ca
HM011479_C_P-C      gctttrtatcgggaggccttagagtctccggaa---catwkytcasctcac-------ca
KX276837_C_P-C      gctttrtatcgggaggccttagagtctccggaa---catwkytcasctcac-------ca
MF488703_C_P-C      cctctgtatcgggaagccctaaagtctccggaa---ctttgtagacctctt-------cg
KX276850_C_P-C      gctctatatcgggaggccttagagtctccggaa---catkkttcacmtcac-------ca
JQ801508_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
JQ801517_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925403_C_P-C      gctttgtatcgggaggccttagagtctccggat---cattgtacaccccac-------ca
JQ801523_C_P-C      gctctgtatcgggaggccttaaagtctccggaa---cattgttcacctcac-------ca
KT347089_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
KX276849_C_P-C      gctctgtatsgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089804_C_P-C      gctctgtatggggaggccttagagtctccggaa---cattgttcagctcac-------ca
HM011468_C_P-C      gctctgtttcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
GQ184326_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
JQ801515_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803776_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcgcctcac-------ca
JQ801518_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KF214670_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803812_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
AB112066_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcat-------ca
JQ801499_C_P-C      gctctgcatcgggaggccttagagtctcctgaa---cattgttcatatcac-------ca
MG826122_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcatatcac-------ca
JQ801480_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF488701_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023652_C_P-C      gctctgtatcgggaggccttagagtctcctgaa---cattgttcacctcac-------ca
JQ429078_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC315399_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ361526_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925405_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
KF214667_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803760_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023651_C_P-C      gctctgtttcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803757_C_P-C      gctctgtatcgggaggctttagagtctccggaa---cattgttcacatcac-------ca
GQ924650_C_P-C      gctctgtttcgggaggccttagagtctccggaa---cattgttcacatcac-------ca
AB112408_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX276847_C_P-C      gctctrtatcgggaggccttagagtctccggaa---catgtttcagctcac-------ca
KF214671_C_P-C      gctctgtatcgggaagccttagagtctccggaa---cattgttcacctcac-------ca
MF925395_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801510_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801491_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
FJ023648_C_P-C      gctctgcatcgggaagccttagagtctccggaa---cattgttctcctcac-------ca
AB112348_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765822_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
DQ361534_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KF214669_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801472_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925374_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925369_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
JQ801503_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ855541_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ358153_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023639_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KT366464_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KF214677_C_P-C      tctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089803_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ855534_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765821_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
JN827423_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
JN827418_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
EF384201_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765850_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765844_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801519_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801482_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801475_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
JN827424_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
JN827425_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765848_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
JN827421_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765825_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801497_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925394_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925367_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcgcctcac-------ca
KF214673_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765828_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MH220971_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803792_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KF214675_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801520_C_P-C      gctctgtatcgggaggctttagagtctccggaa---cattgttcacctcac-------ca
KF214672_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC875271_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC875265_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC875264_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC875273_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC875269_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC875274_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttaacctcac-------ca
KC875267_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC875270_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC875272_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC875268_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ315782_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KF214676_C_P-C      gctctttatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801489_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925359_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470937_C_P-C      gctctgtatcaggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX774506_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcat-------ca
JQ801511_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023645_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
AB117758_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB074756_C_P-C      gctttgtatcgggaggccttagaatcttcggaa---cattgttcacctcac-------ca
KX765840_C_P-C      gctctgtatcgggaggctttagagtctccggaa---cattgttcacctcac-------ca
KT364719_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcaccgcac-------ca
KT364720_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcaccgcac-------ca
KT307719_C_P-C      gctctgtatcgggagggcttagagtctccggaa---cattgttcacctcac-------cc
KT307718_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KT364718_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KT987426_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU051427_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KT987423_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ924616_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801513_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765826_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925378_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925387_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925398_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801509_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803780_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MK286461_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765843_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765842_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacatcac-------ca
KF214668_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801496_C_P-C      gctctgtatcgggaggccttagagtctcctgaa---cattgttcacctcac-------ca
JQ801473_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ924609_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ855548_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ315781_C_P-C      gctctttatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ315783_C_P-C      gctctttatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925409_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ855523_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KT987424_C_P-C      gctctgtatcgggaagctttagagtctccagaa---cattgttcacctcac-------ca
GQ924612_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ924613_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KT987425_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU051423_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925410_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG725248_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801486_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cactgttcacctcac-------ca
KX774504_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MK628732_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925406_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925376_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925375_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925365_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470936_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765834_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765829_C_P-C      gctctgtatcgggagtccttagagtctccggaa---cattgttcacctcac-------ca
KT366463_C_P-C      gctctttatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KT364721_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803818_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801502_C_P-C      gctctgtatcgggaggccttagagtctccagaa---cattgttcacctcac-------ca
JQ801493_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023658_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023657_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU051424_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765851_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803800_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ924649_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ924614_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JN827422_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU051426_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925377_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF925408_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX774503_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765853_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765849_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765837_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765833_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765818_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU051425_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774236_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JN827420_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JN827416_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023649_C_P-C      gctctttatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023642_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF068756_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB247916_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GU563561_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JN827417_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801470_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803799_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765820_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765831_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765832_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765838_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765846_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX276855_C_P-C      gctctatatcgggatgccttagagtctccggaa---catttgtcacctcac-------ca
KF873536_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgytcacctcac-------ca
KU679937_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgtwcasctmac-------ca
KU679960_C_P-C      gctytatatcgggaggccttagagtctccggaa---cattgtwcasctcac-------ca
JQ027324_C_P-C      gctctgtatcgagatgccttggagtctccggag---cattgtacacctcac-------ca
KX276836_C_P-C      gctctgtatcgggaggcattagagtctccggaa---catatttcacctcac-------ca
EU939539_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670274_C_P-C      gctctatatcgggaggccttagagtctccacaa---cattgttcacctcac-------ca
EU547562_C_P-C      gctctgtatcgggaggccttagagtctcccgaa---cattgttcagctcac-------ca
EU717214_C_P-C      gctctgtatcgggaggccttagaatctccggaa---cattgttcacctcac-------ca
EU872005_C_P-C      gctctgtatcgggaggccttagaatctccggaa---cattgttcacctcac-------ca
GQ377552_C_P-C      gctctgtatcgggaggccttagagtgtccggaa---cattgttcacctccc-------ca
KJ803777_C_P-C      gcactgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GU357845_C_P-C      gccctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB176642_C_P-C      gctctgtatcgggaggccttagagtctccagaa---cattgttcacctcac-------ca
KJ803809_C_P-C      gctttgtatcgggaggccttagagtctccggaa---catgtttcacctcac-------ca
GQ377623_C_P-C      gctctgtatcgggaggccttagagtctccggaa---catgtttcacatcac-------ca
AB670263_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
KJ598760_C_P-C      gctctgtgtcgggaggccttagagtctccggga---cattgttcgcctcac-------ca
KJ598762_C_P-C      gctctgtgtcgggaggccttagagtctccggga---cattgttcacctcac-------ca
KX276833_C_P-C      gctctgtatcgggaggccttagagtctccagaa---cattgttcasctcac-------ca
AB670268_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013778_C_P-C      gctctgtatcgggaggccttagagtctccggaa---catatttcacctcac-------ca
AB670255_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgcacacctcac-------ca
AB300373_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttctccgcac-------ca
EU939643_C_P-C      gctttacatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562280_C_P-C      gctttatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939542_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ899767_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KF485390_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcwcctcay-------ca
KF214652_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562241_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MH818373_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
FJ562310_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939541_C_P-C      gctctgtatcgggaggccttaaagtctccggaa---cattgttcacctcac-------ca
DQ089772_C_P-C      gctttgtatagggaggccttagagtctccggaa---cattgttcatatcac-------ca
KU667576_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939558_C_P-C      gctttgtatcgtgaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670272_C_P-C      gctctgtatccggaggccctagagtctccggaa---cattgctcacctcac-------ca
AB670259_C_P-C      gctctgtatcgggaggccctagagtctcgggaa---cattgttcacctcac-------ca
AB115417_C_P-C      gctctgtatcgggaggcattagagtctccggaa---cattgttcacctcac-------ca
AB042285_C_P-C      gctctgtatctggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363252_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU919165_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
AB931170_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB931171_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU667914_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtccacctcac-------ca
KU576193_C_P-C      gctctgtatcgggaggcattagagtctccggaa---cattgttcacctcac-------ca
KU576196_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU668197_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386616_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY641563_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EF137803_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ027332_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939641_C_P-C      gctctgcatcgggaggccttagagtctccggaa---mattgtacacctcac-------ca
DQ890381_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089802_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670262_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670246_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB113877_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
AB300361_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363285_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670237_C_P-C      gctctgtatcgggaggcctnagagtctccggaa---cattgttcacctcac-------ca
AB670279_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475328_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475351_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363284_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787487_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
FJ787488_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787489_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU576284_C_P-C      gctctgtgtcgggatgccttagagtctccggaa---cattgttcacctcac-------ca
D00630_C_P-C        gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774353_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ040156_C_P-C      gctctctatcgggaggccttagartctccggaa---cattgttcacctcac-------ca
GQ377518_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023640_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ040164_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363260_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB900115_C_P-C      gctctgtatcgggaggccttagagtcttctgaa---cattgttcagctcac-------ca
AB367433_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MK321266_C_P-C      gctctttatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MK720629_C_P-C      gctctttatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MK720630_C_P-C      gctctttatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM011500_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367429_C_P-C      gctctgtatcgggaggccctagagtctccggag---cattgttcacctcac-------ca
AB367802_C_P-C      gctctgtatcgggaggccctagagtctccggag---cattgttcacctcac-------ca
FJ899768_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562250_C_P-C      gctctgtatcgggaggccttagagtctccgcaa---cattgttcacctcac-------ca
X52939_C_P-C        gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670264_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ848339_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ040143_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670258_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB298720_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB298721_C_P-C      gctctgtatcgggargccttagagtctccggaa---cattgttcacctcac-------ca
JQ040151_C_P-C      gctctrtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700517_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386625_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014394_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013943_C_P-C      gctctgcatcgggaggccttagagtctcctgaa---cattgttcacctcat-------ca
EU589344_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367405_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgcacacctcac-------ca
DQ993691_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
DQ993692_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
AB367421_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670260_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562255_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363282_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363283_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU668231_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774202_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ358158_C_C-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562243_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367422_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
EU306674_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcgcctcac-------ca
EU306675_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcgcctcac-------ca
KY363268_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363254_C_P-C      gctctgtatcgggaggctttagagtctccggaa---cattgttcacctcac-------ca
KJ803769_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787490_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY206386_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774354_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774355_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KM213037_C_P-C      gctctgtatcgggaggctttagagtctcctgaa---cattgttcacctcac-------ca
AB670306_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014363_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386620_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB111112_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgntcacctcac-------ca
AB049610_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgcacacctcac-------ca
AB014378_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
AB111125_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctccgcac-------ca
AB111124_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctccgcac-------ca
AB246344_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctccgcac-------ca
LC279247_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctccgcac-------ca
LC279248_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctccgcac-------ca
LC279249_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctccgcac-------ca
KC774279_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475330_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
HM011465_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386626_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
D50520_C_P-C        gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
D50517_C_P-C        gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
D50518_C_P-C        gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KM359441_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
DQ089797_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014398_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363277_C_P-C      gctctgtctcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX026878_C_P-C      gctctgtatcgggaggcattagagtctccggaa---cattgttcacctcac-------ca
DQ478899_C_P-C      gctctgtatcgggaggccttagagtctccagaa---cattgttcacctcac-------ca
AY641560_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY641559_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670288_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB195949_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014390_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014374_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG893556_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcgc-------ca
KY363278_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363279_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX036338_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939536_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670302_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367418_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014360_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363256_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363257_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475326_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562319_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939647_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774329_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715364_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367401_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB106895_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014367_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803766_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475355_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386638_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB176643_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014376_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB971714_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB971715_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475357_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
AB195942_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
AB195943_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
AB195944_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
GQ475336_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF533983_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670285_C_P-C      gctctgtatcsggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB205124_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939612_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562230_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475341_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386629_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ638218_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363253_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013766_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598637_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598638_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774348_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774334_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774272_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
JX661489_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX026877_C_P-C      gctctgtatcgggaggccttagagtctccggga---cattgttcacctcac-------ca
JQ040165_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ040135_C_P-C      gctctctatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
JN104434_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475350_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377618_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377523_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715350_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
FJ386602_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939578_C_P-C      gctctgtatcgggaggctttagagtctccggaa---cattgttcacctcac-------ca
AY596107_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB697494_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670297_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670275_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367431_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367423_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367408_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB182589_C_P-C      gctctgtatcgggaggccttagagtctccggaa---catggttcacctcac-------ca
KC774251_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774185_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774250_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774255_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774244_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562218_C_P-C      gctctgtatcgggaggccttagagtctcctgaa---cattgttcacctcac-------ca
FJ386605_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386589_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173393_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173394_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598642_C_P-C      gctctgtatcgggaggccttcgagtctccggaa---cattgttcacctcac-------ca
KJ598635_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598636_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598640_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598641_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598659_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598639_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598661_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598658_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598656_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598654_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598657_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598650_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598649_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598651_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598653_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598648_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598660_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598646_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598644_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598645_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598647_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598652_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598655_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM750132_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670265_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB113879_C_P-C      gcactgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475312_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcat-------ca
GQ475327_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcat-------ca
GQ475334_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcat-------ca
EU570068_C_P-C      gctctgtacagggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU570067_C_P-C      gctctgtacagggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU554537_C_P-C      gctctgtacagggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU554538_C_P-C      gctctgtacagggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU554539_C_P-C      gctctgtacagggaggccttagagtctccggaa---cattgttcacctcgc-------ca
AB367395_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089801_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562298_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
KU964032_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964020_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964021_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964022_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964024_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964025_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964026_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964027_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964028_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964029_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964030_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964031_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964033_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964023_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803761_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KF214655_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475321_C_P-C      gctctgtatagggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939597_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY022423_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013961_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013780_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013765_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013764_C_P-C      gctccgtatcgggaggccttagagtctccggaa---cattgtccacctcac-------ca
KF485389_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcat-------ca
KC774316_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774275_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774257_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774232_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774206_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JN104435_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475344_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475332_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475322_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475320_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475318_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
GQ377571_C_P-C      gctctgtatcgggaggccttagagtcaccggaa---cattgttcacctcac-------ca
GQ377540_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562320_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939549_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EF137802_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367402_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470878_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470884_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173313_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173314_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ144553_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcat-------ca
DQ144603_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcat-------ca
DQ144604_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcat-------ca
AB111116_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB111117_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
X04615_C_P-C        gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KT284753_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377585_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB042282_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY641561_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470934_C_P-C      gctctgtattgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470929_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470933_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013786_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013784_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013783_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774197_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013779_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013782_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013785_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013781_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KF779242_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM011489_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014377_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475339_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774192_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB697490_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475333_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
LC279252_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
LC279253_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774252_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670300_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JN400087_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JN400089_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173287_C_P-C      gctctgtatcgggaggccttagaatctccggaa---cattgttcacctcac-------ca
KJ173288_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964049_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964050_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964051_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964052_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964053_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964054_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964055_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964056_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964057_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964058_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964059_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964060_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964061_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964062_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964063_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475313_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475347_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF384364_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF384365_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF384366_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF384367_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470874_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470873_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KT284756_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013853_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013761_C_P-C      gctctgtatcgggaggcattagagtctccggaa---cattgttcacctcac-------ca
KC774259_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774233_C_P-C      gctctgtatagggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774223_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM750131_C_P-C      gctctgtatcgggaggcattagagtctccggaa---cattgttcacctcac-------ca
GQ475342_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475310_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377576_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377535_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377553_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715367_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715366_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386647_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU916229_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306673_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcgcctcac-------ca
D12980_C_P-C        gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY641558_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JN400088_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF286594_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670287_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670252_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367411_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB362932_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774243_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774346_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013797_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013768_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013767_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013762_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774220_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
KC774184_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX661492_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377600_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013798_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ688404_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173437_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173438_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013763_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
LC279254_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
LC279255_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
LC279256_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
LC279257_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KF779300_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ683578_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM750138_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363276_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470883_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670309_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562297_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
GQ475306_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475308_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475315_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475331_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB471851_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB471852_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB471853_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB033550_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP027477_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG893557_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
LC279251_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470889_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470886_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470888_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470881_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470875_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774270_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774209_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX661491_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX429905_C_P-C      gctctgtatcgggaggccttagcgtctccggaa---cattgttcacctcac-------ca
JF828918_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ872210_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475348_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475329_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475325_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475324_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475338_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475354_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475311_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475307_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcat-------ca
GQ377616_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377563_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377517_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU589345_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
D50519_C_P-C        gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB697500_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475345_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB675677_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670292_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670267_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB640730_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367409_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670283_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367403_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367399_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173283_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173284_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB300362_C_P-C      gctctgtatcgggaggccttagagtctcctgaa---cattgttcacctcac-------ca
AB222714_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB222715_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828913_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828915_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828916_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828917_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828919_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828920_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB042283_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367394_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB485808_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670247_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AP011098_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY057947_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ899763_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ899775_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377531_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377603_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475305_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475346_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774180_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774219_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774274_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173426_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ410519_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470876_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470877_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470879_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470890_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470891_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470892_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX276853_C_P-C      gctctktatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089785_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KF873539_C_P-C      gctctatatcgggatgccttagagtctccggaa---cattgttcacctcac-------ca
KF873541_C_P-C      gctctatatcgggatgccttagartctccggaa---cattgttcacctcac-------ca
JQ341517_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
JX507212_C_P-C      gctctgtatcgggaggccttagagtctccggaa---caatgttcacctcac-------ca
KJ410515_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089775_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
KX276852_C_P-C      gctctgcatagggaggccttggagtctccggaa---cattgttcasmycac-------ca
FJ904423_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttcacctcac-------ca
MG571332_C_P-C      gctctgtatcgggagggcttagaatctccggaa---cattgttcacatcac-------ca
KM875424_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
KM875425_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
HM011472_C_P-C      gctctgtatcgggaggccttagagtctccggaa---catttttcacctcac-------ca
MK818227_C_P-C      gctctgtatcgggaggccttagagtctccggaa---catttttcacctcac-------ca
MF674430_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
KX276841_C_P-C      gctctgtatagggaggccttagagtctccggaa---cattgtacacctcac-------ca
KJ410514_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
KJ803770_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX504535_C_P-C      gctctgtatcgggaggccctacagtctccggaa---cattgttcacctcac-------ca
JQ341518_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ410499_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
KJ410489_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
KJ410492_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
KJ410491_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
KJ410494_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
KJ410511_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX276846_C_P-C      gctctgtttcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
KJ803779_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089778_C_P-C      gctctgtatcgggaggccttrgagtctccggaa---cattgttcacctcac-------ca
DQ089776_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
DQ089777_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
KJ410493_C_P-C      gctctgcatcgggaggccttagagtctccggga---cattgttcacctcac-------ca
JX507211_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089792_C_P-C      gctctgtatcgggaagccttagagtctccggaa---cattgttcacctcac-------ca
KM875428_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ410518_C_P-C      gccttgtatcgggaggccctagagtctccggac---cattgttcagctcac-------ca
AY269140_C_P-C      gctctatatcgggatgctttagagtctgcagaa---cattgtacagctcac-------ca
HM011486_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089791_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX276840_C_P-C      gctctgtatcgggaggccttagagtctccggaa---catgtttcatctcac-------ca
DQ089756_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089773_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
DQ089757_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF223961_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674457_C_P-C      gctttgtacagggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089786_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ027318_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgytctcctcac-------ca
DQ089790_C_P-C      gctctstatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707768_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttcacctcac-------ca
JQ707769_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttcacctcac-------ca
JQ707770_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttcacctcac-------ca
JQ707771_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttcacctcac-------ca
JQ707772_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttcacctcac-------ca
JQ707773_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttcacctcac-------ca
JQ707774_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttcacctcac-------ca
JQ027333_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
DQ089761_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
MG571335_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803810_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803794_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttctcctcac-------ca
MF674425_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674458_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674474_C_P-C      gctctgtatcgggaggccttagggtctccggaa---cattgttcacctcac-------ca
MF674428_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674390_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KM875405_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EF197911_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KM875404_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ341541_C_P-C      gctctgyatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM011488_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089787_C_P-C      gctttgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY353910_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089788_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089759_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG571345_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674514_C_P-C      gctctgtatagggaggccttagagtctccggaa---cattgttcagctcac-------ca
FJ386673_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB112065_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089771_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
KM875430_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ410498_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX870000_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacttcac-------ca
GQ924655_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089780_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674475_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ027321_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
AY167099_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ341544_C_P-C      gctctatatcgggaggccttaragtctccggaa---cattgttcacctcac-------ca
GQ855543_C_P-C      gctctataccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB031262_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF324084_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB105174_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089766_C_P-C      gcactgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013996_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013823_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013822_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013825_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674504_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674444_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013857_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ349225_C_P-C      gctctataccgggaggccctagagtctccagaa---cattgttcacctcac-------ca
FJ023650_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013820_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013824_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013821_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013826_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EF494379_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
AB105173_C_P-C      gctctgtatcgggaggccttagagactccggaa---catagctcacctcac-------ca
MF674471_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674411_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG826123_C_P-C      gctctgtatcgggaggccctagagtctccagaa---cattgttcacctcac-------ca
MF674489_C_P-C      gctctctatcgggaggccttagagtctccggag---cattgctcacctcac-------ca
MF674463_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
MF674399_C_P-C      gctctatatcgggaggccttagagtctcctgaa---cattgttcacctcac-------ca
KJ410504_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX507214_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801490_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM011497_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcatctcac-------ca
FJ023653_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089789_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089770_C_P-C      gctctgtatcgggaggccttagagtctccggag---cattgttcacctcac-------ca
DQ089763_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089760_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089758_C_P-C      gctctgtatcgrgaggccttagagtctccggaa---cattgttcacctcac-------ca
AY862869_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcgc-------ca
AB205125_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB112472_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF223960_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803826_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674417_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ410505_C_P-C      gctctgtatcgggaggccttagagtctccggaa---catgtttcacctcac-------ca
KJ410508_C_P-C      gctctgtatcgggaggccttagagtctccggaa---catgtttcacctcac-------ca
MF674502_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674494_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674486_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674386_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX276851_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
KR013904_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013855_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013770_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
KJ410496_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173324_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801495_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ040133_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ478901_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089784_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089762_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY167092_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AJ748098_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcat-------ca
AF473543_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB246346_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB112471_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674467_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
DQ089782_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803774_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF223957_C_P-C      gccttgtatagagaggccttagagtctccggaa---cattgttcacctcac-------ca
JN104437_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674418_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
MF674403_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013935_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013856_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013854_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803793_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttctcctcac-------ca
KJ173285_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774227_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ855525_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377605_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377536_C_P-C      gctctgtatcgggaggccctagagtctccggaa---cattgttcacctcac-------ca
DQ089783_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089767_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EF688062_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ246215_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089781_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF324081_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674442_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF223955_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF223956_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF223959_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089779_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377631_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173286_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674468_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674398_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU305541_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU305542_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674402_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674484_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674408_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674472_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674435_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674388_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674412_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674454_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MF674501_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013927_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ410501_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ410513_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ410495_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089764_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF223954_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF223958_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AP011097_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089765_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089769_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU305540_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ688403_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013787_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765824_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX276848_C_P-C      gctttgtatcgggaggccttagagtctccggwa---catakttcabctcac-------ca
GQ924643_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
MG826132_C_P-C      gctctatatctggagggcttagagtctccggaa---cattgctcacctctc-------ca
EU547559_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089768_C_P-C      gctctgtatcgggaggccttagaatctccggaa---cattgtacacctcac-------ca
HM011495_C_P-C      gctttatatcgggaggccttagagtctccagaa---cattgttcrcctcac-------ca
EU939601_C_P-C      gctctatatcgggaggccttagagtctcaggaa---cactggtcacctcac-------ca
MG826140_C_P-C      gctttatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX276844_C_P-C      gccttgtaccgggaggccttagagtctccggaa---cattgtwcacctcac-------ca
GQ924619_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801500_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcccctcac-------ca
GQ924642_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598662_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598665_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598670_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598667_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598674_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598672_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598663_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598664_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598666_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598668_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598669_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598673_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598676_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598677_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598678_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598671_C_P-C      gccctgtatcgggagggcttagagtctccggaa---cattgttcacctcac-------ca
GQ924629_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562256_C_P-C      gctctgtatcgggaggctctagagtctccggaa---cattgctcacctcac-------ca
EU670263_C_P-C      gctctatatagggaggccttagaatctccggaa---cattgttcacctcac-------ca
GU721029_C_P-C      gctctatatagggaggccttagaatctccggaa---cattgttcacctcac-------ca
MG826137_C_P-C      gctttatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG826139_C_P-C      gctttatatcgggaggccttagagtctccggaa---cattgttccgctcac-------ca
MG826138_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG826136_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG826129_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG826128_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG826133_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG826134_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG826135_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG826131_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AP011106_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
AP011107_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB111946_C_P-C      gctctgtttcgggaggcattagagtctccggaa---cattgtacacctcac-------ca
AB112063_C_P-C      gctctgtttcgggaggcattagagtctccggaa---cattgtacacctcac-------ca
JQ027317_C_P-C      gcyttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB074755_C_P-C      gctttgtatcgggaggccttagaatcttcggaa---cattgttcacctcac-------ca
KC774321_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774361_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013883_C_P-C      gctctttatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KR013878_C_P-C      gctctttatcgggagtccttagagtctccggaa---cattgttctcctcac-------ca
KR013885_C_P-C      gctctttatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KC774221_C_P-C      gctctgtatcgggaggcattagagtctccggaa---cattgctcacctcac-------ca
KR013819_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774288_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KC774253_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939625_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939626_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013993_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774306_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774302_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386631_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774282_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KC774303_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774207_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774296_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KR013818_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013817_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774325_C_P-C      gctctgtatcgggaagccttagagtctccggaa---cattgttctcctcac-------ca
KC774308_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787451_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562323_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
FJ386664_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386623_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774304_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774300_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377591_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377529_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715341_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KT364751_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774280_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774204_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774285_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KT364752_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774330_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KC774298_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KC774351_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
JQ027322_C_P-C      gctctatatcgggaggccctagagtctccggaa---cattgtacacctcac-------ca
AB074047_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcgcctcac-------ca
KJ803754_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939552_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU498227_C_P-C      gctctatatcgggaggctttagagtctccggaa---cattgctcacctcac-------ca
JQ341545_C_P-C      gctctataccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803823_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG826126_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
FJ562288_C_P-C      gctctataccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386601_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562334_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG826143_C_P-C      gctttatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470908_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470911_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803814_C_P-C      gccttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803815_C_P-C      gccttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803811_C_P-C      gccttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803813_C_P-C      gccttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801501_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023571_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801487_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765839_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148563_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801488_C_P-C      gctttgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765852_C_P-C      gctttgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023655_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801522_C_P-C      gctttgtatcgtgaggctttagagtctccggaa---cattgttcacctcac-------ca
FJ023641_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ924615_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcatatcac-------ca
HM011491_C_P-C      gctttgtaccggcaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470916_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470913_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ924658_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801481_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801483_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470918_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470906_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470909_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470912_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470914_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470915_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470910_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470907_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470917_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470920_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765836_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148525_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148462_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ801504_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KP148534_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765827_C_P-C      gctttatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148537_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803759_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcat-------ca
KP148572_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148543_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148575_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148560_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148540_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148520_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148483_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148491_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148476_C_P-C      gctttgtatcgggaggccttcgagtctccggaa---cattgttcacctcac-------ca
KP148470_C_P-C      gctttgtatcgggaggccttagggtctccggaa---cattgttcacctcac-------ca
KC774228_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cactgttcacctcac-------ca
JQ801505_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF899336_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ924623_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023654_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB300363_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148567_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148566_C_P-C      gctttgtatcggggggccttagagtctccggaa---cattgttcacctcac-------ca
KP148557_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148554_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KP148548_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148513_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148523_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148528_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148570_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765830_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148487_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148489_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148574_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148573_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148568_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148564_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148562_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148559_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148558_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148547_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148546_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148526_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148519_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148530_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148552_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148517_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148514_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148488_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148480_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148479_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148475_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148474_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148468_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148469_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148471_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148472_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148473_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148477_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148481_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148482_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148492_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148493_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148465_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148315_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148464_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023656_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023647_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306685_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306688_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306689_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306690_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306691_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306694_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ924604_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148463_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148466_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148512_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148521_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148524_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148529_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148531_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148532_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148535_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148538_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148545_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148549_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148551_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148555_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148561_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KP148571_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306687_C_P-C      gctttgtatcgggaggccttagagcctccggaa---cattgttcacctcac-------ca
KR013796_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KR013792_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KR013793_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KR013794_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KR013795_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KJ598720_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964238_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964243_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598737_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598730_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964230_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598727_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964235_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598721_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964242_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598736_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598726_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964236_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598725_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964237_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598722_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598733_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964241_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598735_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598731_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964229_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598723_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598728_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598729_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598734_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598738_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598739_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964231_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964232_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964233_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964234_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964240_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598724_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ598732_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964239_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ536411_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ536413_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014368_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ536410_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ536414_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562300_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KF495606_C_P-C      gcgctgtatcgggaggcattagagtctccggaa---cattgctcacctcac-------ca
HM011493_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY629637_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774235_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX504537_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377555_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY629631_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173333_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963900_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963901_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963902_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963903_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963904_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963905_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963906_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963907_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963908_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963909_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963910_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963911_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963912_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963913_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963914_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470983_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470990_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470991_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470980_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470981_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470982_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470984_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470988_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470985_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470986_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470987_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY670782_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MG826127_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013841_C_P-C      gctctatatcgagaggccttagagactccggaa---cattgttcacctcac-------ca
KR013840_C_P-C      gctctatatcgagaggccttagagtctccggaa---cattgttcaccccac-------ca
KR013837_C_P-C      gctctatatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013839_C_P-C      gctctatatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013835_C_P-C      gctctatatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013838_C_P-C      gctctatatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013836_C_P-C      gctctatatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562225_C_P-C      gctctctatcgggaggccttggagtctccggaa---cattgttcacctcac-------ca
EU939573_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377545_C_P-C      gctctctatcgggaggcattagagtctccggaa---cattgttcacctcac-------ca
KY363274_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KT284757_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB198076_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386672_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU562218_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562268_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964215_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377562_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM750139_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964223_C_P-C      gctctctatcgggaggccttagaatctccggaa---cattgttcacctcac-------ca
KU964226_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KT284758_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377554_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715395_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715397_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377559_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377570_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774260_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774267_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964228_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964214_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964222_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964225_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964218_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964224_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964216_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964217_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964219_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964220_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964221_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU964227_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765823_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ924636_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803765_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765845_C_P-C      gctctatatcgggaggcattagagtctccggaa---cattgttcacctcac-------ca
JQ027320_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ358154_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX276854_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ855544_C_P-C      gctctatatcgggaagccttagagtctccggaa---cattgttcacctcac-------ca
FJ023646_C_P-C      gctctatatcgggaggccctagagtctccggaa---cattgttcacctcac-------ca
FJ023643_C_P-C      gctctatatcgggaagccttagagtctccggaa---cattgttcccctcac-------ca
FJ023644_C_P-C      gctctatatcgggaagccttagagtctccggaa---cattgttcccctcac-------ca
GQ855528_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765819_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765847_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX765855_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU679951_C_P-C      gctctgtttcgggakgccttagaatctccggaa---cattgywcacctcac-------ca
KU679949_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgctcacctcac-------ca
AB900109_C_P-C      gctctgtatggggaggccttagagtctccygaa---cattgttcacctcac-------ca
KF873544_C_P-C      gctctgtaccaggaagccttagagtctcaggaa---cattgttctcctcac-------ca
KX276831_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
AB115418_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
KC774240_C_P-C      gctctgtatcgggaggccttaaagtctccggaa---cattgttcacctcac-------ca
KM875412_C_P-C      gcactataccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803790_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013870_C_P-C      gctctgtaccgggaggccttagagtctccggag---cattgttcacctcac-------ca
KR013871_C_P-C      gctctgtaccgggaggccttagagtctccggag---cattgttcacctcac-------ca
GQ924622_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB241111_C_P-C      gctctgtatcgggaggccttagagtctccagaa---cattgttcacctcac-------ca
AB241110_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU410081_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU410079_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU410080_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AP011100_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcgcctcac-------ca
KM526745_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KM526744_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AP011099_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KM526746_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AP011101_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JN827414_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JN827415_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ924620_C_C-C      gctctataccgggatgccttagagtctccggaa---cattgttcacctcac-------ca
AF241411_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AF241410_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173335_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173336_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562329_C_P-C      ccactgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM011481_C_P-C      gctctgtatcgggaggccttagagtctcctgaa---cattgttcacctcac-------ca
KX276839_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023677_C_P-C      gctttatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023592_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023624_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023625_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023589_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023567_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023566_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023568_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023587_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023590_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ023591_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU679947_C_P-C      gctctataccgagaggccttagagtctccggaa---cactgcacacctcac-------ca
KU679957_C_P-C      gctctatatcgagaggccttagagtctccggaa---cactgctcacctcac-------ca
KF873520_C_P-C      gctctgtatcgagatgccttagagtctccagaa---cattgctcagctcac-------ca
KU679936_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgctcacctcac-------ca
KF873514_C_P-C      gctctgtatcgagagkccttagagtctccggaa---cattgctcagctcac-------ca
KF873516_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgctcacctcac-------ca
AB670295_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB195931_C_P-C      gctctatatcgggaggccttagaatctcaagaa---cattgttcagctcac-------ca
AB195932_C_P-C      gctctatatcgggaggccttagaatctcaagaa---cattgttcagctcac-------ca
AB113878_C_P-C      gctctatatcgggaggccttagaatctcaagaa---cattgttcagctcac-------ca
AB195930_C_P-C      gctctatatcgggaggccttagaatctcaagaa---cattgttcagctcac-------ca
AY167091_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcaccccac-------ca
MG826124_C_P-C      gctctgtatcgggaggccctagagtctccggaa---cattgttcacctcac-------ca
KC774319_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
KY363258_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386679_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttcccctcac-------ca
KU667678_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU576863_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU576860_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU576864_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU576865_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU667741_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU668127_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377620_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttcacctcac-------ca
FJ562221_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386614_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670298_C_P-C      gctctgtatcgggaggccttagagtctcgggaa---cattgttcagctcac-------ca
KY470925_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470926_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670242_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939548_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386677_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367426_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgcacacctcac-------ca
AB367801_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgcacacctcac-------ca
GQ227692_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ227697_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ227696_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ227693_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ227694_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ259588_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ227695_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ040131_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY206376_C_P-C      gcactgtatcgggaggccttagagtctccggaa---cattgcacacctcac-------ca
AY206379_C_P-C      gcactgtatcgggaggccttagagtctccggaa---cattgcacacctcac-------ca
AB300360_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
AB365451_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013769_C_P-C      gctctgtatcgggaggccttagagtctccggaa---catgtttcacctcac-------ca
JX026880_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU522071_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014386_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU576747_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013777_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB195945_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
FJ562273_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386617_C_P-C      gctctctatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386596_C_P-C      gctctgtatcgggaggccttagagtctcccgaa---cattgttcacctcac-------ca
FJ386687_C_P-C      gctctgtatcgggaggccttagagtctcccgaa---cattgttcacctcac-------ca
EU939654_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939613_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562301_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939562_C_P-C      gctctgtatcgggaggccttaaagtctccggaa---cattgttcacctcac-------ca
AY206385_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
AB670310_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
KY363264_C_P-C      gctctgtatcgggaggccttagggtctccggaa---cattgttcacctcac-------ca
FJ899783_C_P-C      gctctgtatcgggaggccttagagtctccgaaa---cattgttcacctcac-------ca
AB014372_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
FJ715422_C_P-C      gctctgtatcgcgaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715424_C_P-C      gctctgtatcgcgaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715392_C_P-C      gctctgtatcgcgaggccttagagtctccggaa---tattgttcacctcac-------ca
FJ386659_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB195946_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562306_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562264_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
EU939540_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY641562_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KF214678_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377621_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386604_C_P-C      gctctgtatcgggaggccttagagtctccagaa---cattgttcacctcac-------ca
FJ787437_C_P-C      gctctgtatcgggaggccttagagtctccagaa---cattgttcacctcac-------ca
KU576929_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939579_C_P-C      gctctatatcgggaggccttagaggctccggaa---cattgttcacctcac-------ca
FJ899774_C_P-C      gctctatatcgggaggccttagaggctccggaa---cattgttcacctcac-------ca
GQ475349_C_P-C      gctctgtatcgggaggccttagagtccccggaa---cattgttcacctcac-------ca
FJ562325_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939592_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475356_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963926_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963920_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963915_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963916_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963918_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963919_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963921_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963922_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963923_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963924_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963925_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963927_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963928_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963929_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU963917_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774340_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774313_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ872211_C_P-C      gctctgtatagggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562279_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939607_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939594_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB111114_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB042284_C_P-C      gctctgtatcgggaggccttacagtctccggaa---cattgttcacctcac-------ca
AB014365_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562333_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787468_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787469_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX504536_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939614_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670256_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014392_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774284_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF436920_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU916218_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377593_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562299_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774245_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828910_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828908_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828905_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828906_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828907_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828911_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828912_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367430_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB111123_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX504542_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB111121_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB111122_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386689_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367398_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939570_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ899764_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ899761_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ899765_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470880_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562307_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EF536065_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EF536066_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013851_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475337_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939593_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939538_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173445_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013850_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB697502_C_P-C      gctctgtatagggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700576_C_P-C      gctctgtaccgggaggctttagagtctccggaa---cattgttcacctcac-------ca
HQ700571_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700570_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700569_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700545_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700564_C_P-C      gctttgtaccgggaggccttagagtctccggag---cattgttcacctcac-------ca
HQ700565_C_P-C      gctttgtaccgggaggccttagagtctccggag---cattgttcacctcac-------ca
HQ700573_C_P-C      gctttgtaccgggaggccttagagtctccggag---cattgttcacctcac-------ca
HQ700563_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700556_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700502_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700504_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700562_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700568_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700574_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700567_C_P-C      gctttgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700578_C_P-C      gctctgtaccgggaggccttagagtctccagaa---cattgttcacctcac-------ca
HQ700575_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700577_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700495_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700496_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700476_C_P-C      gctctttacagggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700490_C_P-C      gctctgtacagggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700456_C_P-C      gctctttacagggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700544_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700555_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700558_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700561_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700566_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700572_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700559_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
X75665_C_P-C        gctctgtatcgggaggccttagagtctccggag---cattgttcacctcac-------ca
HQ700543_C_P-C      gctctttatcgggatgccttagagtctccggaa---cattgctcacctcac-------ca
HQ700506_C_P-C      gctctgtatcgggaggccttagagtctccggag---cattgttcacctcac-------ca
GQ358157_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700522_C_P-C      gctctttatcgggatgccttagaatctccggaa---cattgctcacctcac-------ca
KC836842_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939617_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX026888_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670270_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
AB670308_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
GU827639_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367420_C_P-C      gctttatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU668000_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU667964_C_P-C      gctctatatcgggaggccttagggtctccggaa---cattgttcacctcac-------ca
KU667969_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU667984_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU668013_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU668018_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386611_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939653_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386624_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ372968_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367406_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
KY363286_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363287_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ032333_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386665_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939569_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ899788_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ899789_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774242_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939615_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386671_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386678_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU577055_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU577062_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU577049_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU577057_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattggtcacctcac-------ca
KU577056_C_P-C      gctctatatcgggaggccttagagtctccggga---cattgttcagctcac-------ca
KU577051_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU577052_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ040158_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475309_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR819180_C_P-C      gcgctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774225_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ622095_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU562216_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939582_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU916226_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB250109_C_P-C      gccctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939572_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX560519_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562282_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU916225_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377572_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787457_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787458_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670253_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB195936_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB195937_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB195938_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU916223_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX560520_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562232_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386652_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670281_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU562215_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU562217_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU916224_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377514_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JN104440_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787442_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787443_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774194_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB198081_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774215_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774216_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377528_C_P-C      gctctataccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670239_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670240_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367425_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MH891502_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670273_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MH887433_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB900116_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367404_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB642100_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377577_C_P-C      gctctatatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386588_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787481_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU589340_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU589341_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU589342_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX429914_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787449_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB198082_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377601_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KM229703_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HQ700516_C_P-C      gctttatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KX276838_C_P-C      gctatgtttggggaggccttagagtctccggaa---cattgcwcacctcac-------ca
AB642097_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgytcagctcac-------ca
JQ027323_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgctcacctcac-------ca
KF779327_C_P-C      gctctgtaccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ803762_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
JQ040139_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
KF165568_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
D23682_C_P-C        gctctgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
D23683_C_P-C        gctctgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
KJ410510_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY206378_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM011502_C_P-C      gctctgtatcgggaggccttagartctccggaa---cattgttcacctcac-------ca
AB367432_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367804_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ027319_C_P-C      gctctgtatcgggaggccttagagtctccagaa---cattgttcacctcac-------ca
FJ562304_C_P-C      gctctatatagggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY167096_C_P-C      gctctgtatcgggaggccttagagtctccggag---cattgttcacctcac-------ca
DQ089796_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173316_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB202071_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
AB202072_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
EU939590_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939591_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939588_C_P-C      gctctatatcgggaggccttagagtctccagaa---cattgttcacctcac-------ca
FJ899778_C_P-C      gctctatatcgggaggccttagagtctccagaa---cattgttcacctcac-------ca
JQ040144_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089795_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttcacctcac-------ca
AB014361_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670291_C_P-C      gccctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367412_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttcacctcac-------ca
KR013842_C_P-C      gctctgtatcgggaggcctcagagtctccggaa---cattgttcacctcac-------ca
KR013846_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013847_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcgcctcac-------ca
KR013845_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013844_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013848_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013849_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM750135_C_P-C      gctctgtatcgggaggccttaaagtctccggaa---cattgttcacctcac-------ca
FJ386627_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939651_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ751764_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ751765_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
V00867_C_P-C        gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562284_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY206382_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
AB670278_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774229_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
JN104432_C_P-C      gctctgtatcgggaggccctagagtctccggaa---cattgctcacctcac-------ca
JN104433_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
EU939550_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ478900_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939553_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
AB367435_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386685_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939537_C_P-C      gcactgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670301_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcagctcac-------ca
KX276835_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU881996_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670266_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774311_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707729_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707719_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707716_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707707_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707709_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707710_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707711_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707712_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707713_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707715_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707717_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707718_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707720_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707721_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707722_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707723_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707724_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707725_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707726_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707727_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707728_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707730_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707731_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707732_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707733_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ707708_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670277_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377583_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM750134_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670243_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014373_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670290_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ751770_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ151413_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774264_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JN315779_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386607_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ993693_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ478885_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY206389_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM750137_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774343_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787467_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787466_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787464_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787465_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774265_C_P-C      gctctgtatagggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774217_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715372_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367803_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367416_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB033553_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715371_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715398_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715400_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774190_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB033551_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB033552_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367396_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB033556_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ790199_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367417_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173327_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ993690_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ924633_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173446_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KF873525_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
KF873526_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
AB900113_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
JQ801498_C_P-C      gctttatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475343_C_P-C      gctctgtatcgggaggccttagagtcttcggaa---cattgttcacctcac-------ca
GQ475352_C_P-C      gctctgtatcgggaggccttagagtcttcggaa---cattgttcacctcac-------ca
AF323463_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
FJ562326_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EF494377_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014387_C_P-C      gctctgtatcgggaagccttagagtctccggag---cattgttcacctcac-------ca
AB697510_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
EU939583_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU554540_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367392_C_P-C      gctctgtatcgggaggccttagagtctccggaa---catcattcacctcac-------ca
AB113875_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB113876_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367413_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
AB111113_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
KF214651_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377599_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB485809_C_P-C      gctctgtatcgggaggccttagagtcaccggaa---cattgttcacctcac-------ca
AB485810_C_P-C      gctctgtatcgggaggccttagagtcaccggaa---cattgttcacctcac-------ca
KU668280_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363275_C_P-C      gctctccatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY689435_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY689525_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939648_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367410_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JF828937_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363280_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ040152_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939616_C_P-C      gctctacatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
AY247031_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939587_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367427_C_P-C      gctctgtatcgagaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774238_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670294_C_P-C      gctctgtatcgggaggccctagagtctccggag---cattgttcacctcac-------ca
AB670305_C_P-C      gctctgtatcgggaggccctagagtctccggag---cattgttcacctcac-------ca
JX036339_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774211_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX036335_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX036336_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX036337_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774277_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774254_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774256_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774213_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774214_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774335_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774191_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM750136_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774283_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774189_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
MH094411_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386575_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU916216_C_P-C      gctctccatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774287_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774187_C_P-C      gctctgtatcgggaggctttagagtctccggaa---cattgttcacctcac-------ca
KC774352_C_P-C      gctctgtatcgggaggctttagagtctccggaa---cattgttcacctcac-------ca
KC774338_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386630_C_P-C      gctctataccgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY363281_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774309_C_P-C      gctctatatcgggaggccctagagtctccggaa---cattgttcacctcac-------ca
KC774247_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ032331_C_P-C      gctctctatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
JX661490_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386603_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774181_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
HM750141_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
LC279274_C_P-C      gctctgtatcgggaggccctagagtctccggag---cattgttcacctcac-------ca
KC774342_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ040166_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386576_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AY247032_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB026815_C_P-C      gctctgtatcgcgaggccttagagtctccggaa---cattgttcacctcac-------ca
EU560440_C_P-C      gctctgtatagggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU579442_C_P-C      gctctgtatagggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774196_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774336_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562318_C_P-C      gctctacatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562330_C_P-C      gctctacatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470887_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470882_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KY470885_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774337_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774299_C_P-C      gctctgtatcgggaggccttagagtctccggag---cattgttcacctcac-------ca
KC774278_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774200_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774205_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774208_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774182_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377541_C_P-C      gcactgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377533_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB367424_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB198078_C_P-C      gctctatatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU916237_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC875261_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774261_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774262_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013852_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC875263_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774345_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475317_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386639_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475314_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475319_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC875262_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ475316_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB670238_C_P-C      gctctgtatcgggaggcattagagtctccggaa---cattgttcacctcac-------ca
EU916238_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ040127_C_P-C      gctctgtatcgggaggccttrgagtctccggaa---cattgttcacctcac-------ca
EU939657_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
AB014371_C_P-C      gctctgtatcgggaggccttggagtctccggaa---cattgttcacctcac-------ca
FJ899795_C_P-C      gctctgcgtagggaggccttagagtctccggaa---catgtttcacctcac-------ca
KJ410521_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
FJ562331_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
KU576449_C_P-C      gctctgtatcgggaggccctagagtctccggaa---cattgttcacctcat-------ca
GQ377586_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ899793_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcccctcac-------ca
FJ899794_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcccctcac-------ca
AY220702_C_P-C      gctctgtatcgggaggccttagattctccggaa---cattgttcacctcac-------ca
EU939585_C_P-C      gctctgtatcgggaggccttagagtctcctgaa---cattgtacacctcac-------ca
FJ386621_C_P-C      gctctgcatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
GQ377557_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgtacacctcac-------ca
KU576454_C_P-C      gctctgtatcgggaggccttagagtctccggga---cattgttcacctcac-------ca
FJ032346_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ032347_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013942_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013789_C_P-C      gctttgtatcgggaggccttagagtccccggaa---cattgttcacctcac-------ca
KR013788_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KR013790_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU576453_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089794_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
EU939649_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ562295_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939566_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KJ173439_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
KJ173440_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgctcacctcac-------ca
KC774266_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttctcctcac-------ca
JX429909_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ089793_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX429907_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KC774195_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JQ040129_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU576455_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
KU576457_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ787471_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ032355_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcgcctcac-------ca
FJ032356_C_P-C      gctttgtatcgggaggccttagagtctccggaa---cattgttcgcctcac-------ca
FJ787470_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ386641_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939658_C_P-C      gctctgtatcgggaggccttagagactccggaa---cattgttcacctcac-------ca
KC774331_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU939571_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU439013_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715383_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715403_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715407_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715409_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715382_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715402_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715381_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
FJ715421_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
JX429913_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306725_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU439014_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU439005_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306722_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ377163_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306727_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306719_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ377165_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ377162_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ377161_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306713_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306714_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306720_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306721_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU306729_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ377164_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
DQ377160_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU439012_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcaccccac-------ca
EU439009_C_P-C      gctctgtatcgggaggccttagagtctccggaa---cattgttcacctcac-------ca
EU439008_C_P-C      gctctgtatcgggaggccttagagtc