HBVdb

Dataset for nucleotide sequence PreS2 of genotype B

[Download (right click)] [Edit] [Sequences] [Repertoires]

2818 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


AB048705_PreS2_P-B      atgcagtgga------actccacagcattccaccaagctctgcag---ga
KC793066_PreS2_P-B      rtgmagtgga------actccaccacyttccacyamactcttcaa---ga
KP659249_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB287323_PreS2_P-B      atgcaatgga------actccaccacgttccaccaaactcttcaa---ga
KP659239_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP659248_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaacycttcaa---ga
AB287325_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB287321_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ463795_PreS2_P-B      atgcagtgga------attccaccacgttccaccaaactcttcaa---ga
KP659238_PreS2_P-B      atgcagtgga------actctacaacattccaccaaactcttcaa---ga
DQ463791_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ463797_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JN792895_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ463789_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JN792896_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JN792901_PreS2_P-B      gtacagtgga------actccaccacgttccaccaaactcttcaa---ga
JN792902_PreS2_P-B      gtacagtgga------actccaccacgttccaccaaactcttcaa---ga
AB287320_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP659244_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ463799_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ463802_PreS2_P-B      atgcagtgga------attccaccacgttccaccaaactcttcaa---ga
KP659251_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP659245_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ463787_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB287316_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB287318_PreS2_P-B      atacagtgga------actcccccacgttccaccaaactcttcaa---ca
KP659219_PreS2_P-B      atacagtgga------actccaccacgttccaccaaactcttcaa---ga
JN792894_PreS2_P-B      gtgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ463793_PreS2_P-B      gtgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ463801_PreS2_P-B      gtgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JN792893_PreS2_P-B      gtgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JN792897_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ463800_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JN792898_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ463798_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JN792899_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ463796_PreS2_P-B      atgcaatgga------actccaccacgttccaccaaactcttcaa---ga
DQ463792_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JN792900_PreS2_P-B      atgcaatgga------actccaccacgttccaccaaactcttcag---ga
DQ463788_PreS2_P-B      atgcaatgga------actccaccacgttccaccaaactcttcaa---ga
DQ463790_PreS2_P-B      atgcaatgga------actccaccacgttccaccaaactcttcaa---ga
KP659240_PreS2_P-B      atgcagtgga------attccaccacgttccaccaaactcttcaa---ga
KP659250_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP659220_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP659253_PreS2_P-B      atgcagtgga------actccaccacgtttcaccaaactcttcaa---ga
KP659223_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB287322_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB287319_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP659255_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP659254_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ463794_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP659224_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP659252_PreS2_P-B      atgcagtgga------actccacctcgttccacccaactcttcaa---ga
KP659234_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP659235_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP659246_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP659237_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP659247_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB287314_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB287315_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB287317_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KX276962_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
HM011499_PreS2_P-B      atrcrgtgga------actccmccacgttccaccatactcttcaa---ga
KX276858_PreS2_P-B      atrcrgtgga------actccmccacgttccaccawactcttcar---ga
HM011469_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KX276822_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
HM011487_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KX276996_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KX276821_PreS2_P-B      atgaagtgga------actccaccacgttccaccaaactcttcaa---ga
KJ717840_PreS2_P-B      atgcggtgga------actccaccacgttccaccaaactctgcta---ga
KJ803824_PreS2_P-B      atgcggtgga------actccaccacgttccaccaaactctgcta---ga
DQ141626_PreS2_P-B      atgcagtgga------attccaccacgttccaccaaactcttcaa---ga
KX276830_PreS2_P-B      atgcggtgga------actcccccacgttccaccaaactctgcaa---ga
KX276814_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KX276825_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KX276828_PreS2_P-B      atgcagtgga------actccaccaagttccaccaaactctgcaa---ga
KX276970_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ924617_PreS2_P-B      atgcagtgga------actccgccaagttccaccaaactcttcaa---ga
DQ141631_PreS2_P-B      gtgcagtgga------actccaccacattccacaaaactcttcaa---ga
GQ924621_PreS2_P-B      atgcagtgga------actccacaacgttccaccaaactcttcaa---ga
KX765854_PreS2_P-B      atgcagtgga------actccaccacgttcctccaaactcttcaa---ga
KJ717798_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactctgcta---ga
DQ141642_PreS2_P-B      atgcagtgga------actcctccacgttccaccaaactcttcaa---ga
LC349879_PreS2_P-B      gtgaagtgga------actccaccacgttccaccaaactcttcaa---ga
KX276829_PreS2_P-B      atgcaktgga------actccaccavgttccaccaaactcttcaa---ga
KJ717835_PreS2_P-B      atgcagtgga------actccaccaagttccaccaagctctgcta---ga
KJ803819_PreS2_P-B      atgcagtgga------actccaccaagttccaccaagctctgcta---ga
KF053191_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KJ803786_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141635_PreS2_P-B      atgcagtgga------actccacaacgttccaccaaactcttcaa---ga
KX276818_PreS2_P-B      gtgcagtgga------actccaccacgttccaccaaactcttcaa---ga
HM011492_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB493833_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JQ341607_PreS2_P-B      atrcagtgga------actccaccacgttccaccaaactcttcaa---ga
KJ717807_PreS2_P-B      atgcagtgga------actccaccactgtccaccaaactcttcta---ga
KJ803796_PreS2_P-B      atgcagtgga------actccaccactgtccaccaaactcttcta---ga
JQ429081_PreS2_P-B      gtgcagtgga------actccaccacgttccaccaaactcttcagatcga
HM011490_PreS2_P-B      rtgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141636_PreS2_P-B      atgcagtgga------actctaccacgttccaccaaactcttcaa---ga
DQ141638_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KX276823_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
FJ023637_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KF053162_PreS2_P-B      atacagtgga------actccaccacgttccaccaaactcttcaa---ga
KF053165_PreS2_P-B      atacagtgga------actccaccacgttccaccaaactcttcaa---ga
KJ803755_PreS2_P-B      atacagtgga------actccaccacgttccaccaaactcttcaa---ga
KJ803758_PreS2_P-B      atacagtgga------actccaccacgttccaccaaactcttcaa---ga
JQ341597_PreS2_P-B      atgcaktgga------actccaccamgttccaccaaactctgcaa---ga
JQ341599_PreS2_P-B      atgcaktgga------actccaccamgttccaccaaactctgcaa---ga
DQ141640_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
HQ700548_PreS2_P-B      atgcagtgga------actccaccavgttccaccaaactcttcaa---ga
DQ141634_PreS2_P-B      atacagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141637_PreS2_P-B      atgcagtgga------actctaccacgttccaccaaactcttcaa---ga
LC349870_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
D00331_PreS2_C-B        atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141624_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141625_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
LC349874_PreS2_P-B      gtgaagtgga------actcccccacgttccaccaaactcttcaa---ga
KF053190_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KJ803784_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ358136_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB033554_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB713529_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaaatcttcaa---ga
AB713530_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaaatcttcaa---ga
LC349872_PreS2_P-B      atgcagtgga------actccaccaagttccaccaaactcttcaa---ga
LC349875_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JQ429082_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141633_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141630_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141627_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB033555_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
LC349873_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141628_PreS2_P-B      gtgcggtgga------actcccccacgttccaccaaactcttcaa---ga
LC349869_PreS2_P-B      gtgaagtgga------actcccccacgttccaccaaactcttcaa---ga
AB219430_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB493835_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AP011085_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141629_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141632_PreS2_P-B      atgcagtgga------actccactacgttccaccaaactcttcaa---ga
DQ141623_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KJ717792_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KJ803787_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EF473971_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141622_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EF473972_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
M54923_PreS2_P-B        atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ924641_PreS2_P-B      gtgaagtgga------actcccccacgttccaccaaactcttcaa---ga
KX276817_PreS2_P-B      gtgcagtgga------actycaccacgttccaccaaactcttcaa---ga
KX276827_PreS2_P-B      atgcagtgga------actccaccamgttccaccaaactcttcaa---ga
KX276819_PreS2_P-B      atgcagtgga------aytccaccacgttccaccaaactcttcaa---ga
GQ924660_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141641_PreS2_P-B      gtaaagtgga------actcccccacgttccaccaaactcttcaa---ga
DQ141654_PreS2_P-B      gtgcagtgga------actccaccaagttccaccaaactcttcaa---ga
JQ027311_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU660230_PreS2_P-B      gtgcggtgga------actccaccacgttccaccaaactcttcaa---ga
EU660231_PreS2_P-B      gtgcggtgga------actccaccacgttccaccaaactcttcaa---ga
EU660232_PreS2_P-B      gtgcggtgga------actccaccacgttccaccaaactcttcaa---ga
EU660233_PreS2_P-B      gtgcggtgga------actccaccacgttccaccaaactcttcaa---ga
HM011467_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ924645_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141643_PreS2_P-B      atgcagtgga------actccacaacgttccacaaaactcttcaa---ga
JN604123_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
HM011496_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148457_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148458_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148460_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148455_PreS2_P-B      atgcagtgga------actccaccacgttccaccagactcttcaa---ga
KP148453_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148452_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148456_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148459_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148461_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JQ027334_PreS2_P-B      gtgmagtgga------actccaccamgttccaycaaactcttcaa---ga
JN604141_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB219429_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB219427_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AP011086_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AP011087_PreS2_P-B      atgcagtgga------attccaccacgttccaccaaactcttcaa---ga
AB241117_PreS2_P-B      acgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB219426_PreS2_P-B      atgcggtgga------actcccccacgttccaccaaactcttcaa---ga
AB219428_PreS2_C-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ924624_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ924640_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KY881955_PreS2_P-B      atgcactgga------actccaccaagttccaccaaactcttcaa---ga
KY881952_PreS2_P-B      atgcactgga------actccaccaagttccaccaaactcttcaa---ga
KY881944_PreS2_P-B      atgcactgga------actccaccaagttccaccaaactcttcaa---ga
KY881957_PreS2_P-B      atgcactgga------cctccaccaagttccaccaaactcttcaa---ga
KY881953_PreS2_P-B      atgcactgga------actccaccaagttccaacaaactcttcaa---ga
KY881949_PreS2_P-B      atgcactgga------actccaccaagttccaccaaactcttcaa---ga
KY881950_PreS2_P-B      atgcactgga------actccaccaagttccaccaaactcttcaa---ga
KY881945_PreS2_P-B      atgcactgga------actccaccaagttccaccaaactcttcaa---ga
KY881947_PreS2_P-B      atgcactgga------actccaccaagttccaccaaactcttcaa---ga
KY881951_PreS2_P-B      atgcactgga------actccaccaagttccaccaaactcttcaa---ga
KY881956_PreS2_P-B      atgcactgga------actccaccaagttccaccaaactcttcaa---ga
KY881958_PreS2_P-B      atgcactgga------actccaccaagttccaccaaactcttcaa---ga
KY881948_PreS2_P-B      atgcactgga------actccaccaagttccaccaaactcttcaa---ga
KY881946_PreS2_P-B      atgcactgga------actccaccaagttccaccaaactcttcaa---ga
KY881954_PreS2_P-B      atgcactgga------actccaccaagttccaccaaactcttcaa---ga
KP148419_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148427_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148426_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148437_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148438_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148420_PreS2_P-B      atgcattgga------actccaccaagttccaacgaactcttcaa---ga
KP148407_PreS2_P-B      atgcattgga------actccaccaagttccaccaaactcttcaa---ga
KP148433_PreS2_P-B      atgcattgga------actccaccaagttccaccaaactcttcaa---ga
KP148406_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148440_PreS2_P-B      atgcattgga------actccaccaagttccaccaaactcttcaa---ga
KP148435_PreS2_P-B      atgcattgga------actccaccaagttccaccaaactcttcaa---ga
KP148424_PreS2_P-B      atgcattgga------actccaccaagttccaccaaactcttcaa---ga
KP148410_PreS2_P-B      atgcattgga------actccaccaagttccaccaaactcttcaa---ga
KP148432_PreS2_P-B      atgcattgga------actccaccaagttccaccaaactcttcaa---ga
KP148418_PreS2_P-B      atgcattgga------actccaccaagttccaccaaactcttcaa---ga
KP148439_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148430_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148429_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148414_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148425_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148421_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148416_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148411_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148409_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148405_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148413_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148415_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148423_PreS2_P-B      atgcattgga------actccaccaagttccaacaaactcttcaa---ga
KP148373_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148377_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148391_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148387_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148398_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148380_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148376_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148374_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148371_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148367_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148401_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148400_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148402_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148394_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148384_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148383_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148379_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148369_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148375_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148451_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148368_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148385_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148386_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148370_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148372_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148378_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148382_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148388_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148389_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148390_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148392_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148395_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148396_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148397_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148399_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KP148403_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ924635_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU330995_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
FJ023638_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU330989_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU330990_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU330994_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU330996_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU330997_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU330998_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU330999_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU330992_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU331000_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU331001_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ924638_PreS2_P-B      atgcagtgga------actccaccacgttcctcctaactcttcag---ga
GQ924639_PreS2_P-B      atgcagtgga------actccaccacgttcctccaaactcttcag---ga
KX276820_PreS2_P-B      ayaaagtgga------actcccccacgttccaccaaactcttcaa---ga
KX276815_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141646_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141651_PreS2_P-B      atgcagtgga------actccaccacgtttcaccaaactcttcaa---ga
DQ141655_PreS2_P-B      atgcagtgga------actccaccacattccaccaaactcttcaa---ga
GQ358144_PreS2_P-B      atgcagtgga------actccaccacattccaccaaactcttcaa---ga
GQ358147_PreS2_P-B      atgcagtgga------actccaccacattccaccaaactcttcaa---ga
GQ358145_PreS2_P-B      atgcagtgga------actccaccacattccaccaaactcttcaa---ga
GQ358146_PreS2_P-B      atgcagtgga------actccaccacattccaccaaactcttcaa---ga
LC416037_PreS2_P-B      atgcactgta------actccggcacgttccaccaaactcttcaa---ga
AY800391_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AY800392_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ924656_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB713528_PreS2_P-B      atgcagtgga------actcccccaagttccaccaaactcttcaa---ga
KC774418_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JQ027316_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JQ341590_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AP011094_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JQ341554_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141639_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AP011089_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcag---ga
DQ141647_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AP011093_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ358148_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ358149_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ358151_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ358152_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ358150_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AP011096_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AP011095_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AP011092_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ358142_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141653_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EF473977_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ924651_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ924654_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ358140_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AP011088_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ358143_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141649_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141650_PreS2_P-B      atgcagtgga------actccaccacgtttcaccaaactcttcaa---ga
EF473976_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ358139_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141648_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
HQ700549_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ358137_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ358138_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141652_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AP011091_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AP011090_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ358141_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB713532_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KJ717841_PreS2_P-B      atgcagtgga------actccaccacgttccaccaagctctgcta---ga
LC349877_PreS2_P-B      atgcagtgga------actctgccacgttccaccaaactcttcaa---ga
GQ924625_PreS2_P-B      atacagtgga------actccaccacgttccaccaaactcttcaa---ga
LC349868_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
LC349878_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ141644_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ924637_PreS2_P-B      atgcagtgga------actccaccaagttccaccaaactcttcaa---ga
AB713527_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB493827_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB713531_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
LC349871_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
GQ924628_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB976562_PreS2_P-B      atgcagtgga------attccaccacgttccaccaaactcttcaa---ga
DQ141645_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KX276824_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
HM011466_PreS2_P-B      atgcagtgga------actccaccackttccaccaaactcttcar---ga
KJ717829_PreS2_P-B      atgcagtgga------actccaccacgttccaccaagctctgcta---ga
KJ803816_PreS2_P-B      atgcagtgga------actccaccacgttccaccaagctctgcta---ga
DQ993694_PreS2_P-B      atgcagtgga------actccaacactttccatcaaactcttcaa---ga
DQ993687_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281161_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MG826152_PreS2_P-B      atgcagtgga------actccaccacattccaccaaactcttcaa---ga
JQ281221_PreS2_P-B      atacagtgga------actcccccactttccatcaaactcttcaa---ga
DQ993684_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281258_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281207_PreS2_P-B      atgcagtgga------attccaccacktttcatcaaactcttcaa---ga
JQ281239_PreS2_P-B      atgcagtgga------actccaccactttcctccaaactcttcaa---ga
JQ281152_PreS2_P-B      atgmagtgga------actccaccactytccatcaaactcttcaa---ga
JN604132_PreS2_P-B      atgcagtgga------actccacaactttccatcaaactcttcaa---ga
JN604219_PreS2_P-B      atrcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281244_PreS2_P-B      atgcrgtgga------attccaccactttccatcaaactcttcaa---ga
JQ281248_PreS2_P-B      atgcrgtgga------attccaccactttccatcaaactcttcaa---ga
JQ281164_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JN604234_PreS2_P-B      atgcagtgga------actccaccaccttccatcaaactcttcaa---ga
JQ281137_PreS2_P-B      gtgcagtgga------actccaaaactttccatcagactcttcaa---ga
AB117759_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ993686_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ707740_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707747_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707739_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707755_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707767_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707762_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707750_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707749_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707745_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707735_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707734_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707737_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707738_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707742_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707743_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707744_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707746_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707753_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707758_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707759_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707763_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707765_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707766_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707764_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674492_PreS2_P-B      atgaagtgga------actccaccactttccatcaaactctacaa---ga
JQ281133_PreS2_P-B      atgcagtgga------actccaccactttccwtcaaactcttcaa---ga
DQ993682_PreS2_P-B      gtgcagtgga------actccaccactttccatcaaactcttcaa---ga
DQ993683_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
AB073835_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
DQ993680_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
DQ993685_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
DQ993681_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
KY629635_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173401_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KJ173402_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KY629636_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774369_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774370_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MF674464_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281240_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281171_PreS2_P-B      atgcagtgga------actccaccactttccatcamactcttcaa---ga
JQ281158_PreS2_P-B      gtgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281131_PreS2_P-B      atacagtgga------actccaaaactttccatcaaactcttcaa---ga
JQ281252_PreS2_P-B      atgcagtgga------actccacaactttccatcaaactcttcaa---ga
JQ281193_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707760_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707757_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707761_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707751_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707754_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707736_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707748_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707752_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707756_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ707741_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674446_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281160_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281153_PreS2_P-B      atgcagtgga------actccaccaatttccatcaaattcttcaa---ga
JQ281150_PreS2_P-B      atgcagtgga------actcaaccactttccatcaaactcttcaa---ga
AB031267_PreS2_P-B      atgcaatgga------actccgccacttttcatcaaactcttcaa---ga
MF674419_PreS2_P-B      gtgcggtgga------actccaccactttccatcaaactcttcaa---ga
JQ341604_PreS2_P-B      atrcrrtgga------acyccmccactttccatcaaactcttcaa---ga
JQ281190_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674440_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ341605_PreS2_P-B      atgcagtgga------actccaycactttccttcaaactcttcaa---ga
JQ281241_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281170_PreS2_P-B      atgcagtgga------actccacaactttccatcaaactcttcaa---ga
JQ281157_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674396_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF621878_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281236_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ281148_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281132_PreS2_P-B      atacagtggc------acacccctactttccatcaaactcttcaa---ga
JQ281129_PreS2_P-B      atgcagtgga------actccwccactttccatcaaactcttcaa---ga
JN604212_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
AY517489_PreS2_P-B      atgcagtgga------accccacaacgttccatcaaactcttcaa---ga
AY517619_PreS2_P-B      atgcagtgga------actccaccacgttccatcaaactcttcaa---ga
JQ281144_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281138_PreS2_P-B      atacagtgga------attccaccactttccatcaaactcttcaa---ga
JQ281134_PreS2_P-B      atgcagtgga------ackccacmactttccatcaaactcttcaa---ga
LT992442_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MF674479_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ341596_PreS2_P-B      atgcagtgga------attccaccactttccatcaaactcttcaa---ga
JQ341585_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281255_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281238_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281196_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674439_PreS2_P-B      atgcagtgga------acagcaccactttccatcaaactcttcaa---ga
MF674473_PreS2_P-B      atgcagtgga------actccaccactttccatcagactcttcaa---ga
MF674389_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
KX765841_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281214_PreS2_P-B      aygcagtgga------actycaycactttccatcaaactcttcaa---ga
AB212626_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674436_PreS2_P-B      gtgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674385_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
AB212625_PreS2_P-B      atgcagtgga------actccaccgctttccatcaaactcttcaa---ga
MF674491_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674478_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281224_PreS2_P-B      atgcagtgga------acaccaccactttccatcaaactcttcaa---ga
JQ281163_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674415_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ341601_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281253_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281229_PreS2_P-B      atgcagtgga------actccaccacttttcatcaaactcttcaa---ga
JQ281151_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcag---ga
JN604221_PreS2_P-B      rtgcagtgga------actccaccactktccatcaaactcttcaa---ga
AB231909_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
AB205122_PreS2_P-B      gtgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674462_PreS2_P-B      atgcggtgga------actcccccactttccatcaaactcttcaa---ga
MF674392_PreS2_P-B      atgcggtgga------actcccccacttttcatcaaactcttcaa---ga
JQ281154_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
AB368295_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674508_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674456_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674432_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281242_PreS2_P-B      atacagtgga------actccaccacttttcatcaaactcttcaa---ga
JN604138_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ341608_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281195_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674409_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281225_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281218_PreS2_P-B      atgcagtgga------actcaaccactttccatcaaactcttcaa---ga
JQ281188_PreS2_P-B      atgcagtgga------actccaccaatttccatcaaactcttcaa---ga
JQ281167_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281141_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JN604143_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
FJ023636_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
AB115551_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674416_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
JN604244_PreS2_P-B      atgcagtgga------actccacaactttccatcaaactcttcaa---ga
MF674434_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ341580_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
GQ924626_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674461_PreS2_P-B      atacagtgga------actccaccactttccatcaaactcttcaa---ga
MF674460_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674441_PreS2_P-B      atacagtgga------actccacaactttccatcaaactcttcaa---ga
JQ281159_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JN604213_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281234_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
AY033073_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674414_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281237_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcar---ga
JQ281231_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281194_PreS2_P-B      atgcagtgga------actccacaactttccatcaaactcttcaa---ga
JQ281227_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281168_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674476_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674481_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674459_PreS2_P-B      gtgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674420_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ341589_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281222_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281165_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
AB100695_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674448_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
FJ023632_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
HQ700546_PreS2_P-B      atgcagtgga------actccaccaatttccatcaaactcttcaa---ga
MF674423_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674495_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674490_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281230_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281149_PreS2_P-B      gtgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674505_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674496_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674466_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674445_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674424_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674407_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674406_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674404_PreS2_P-B      atgcagtgga------actccacaactttccatcaaactcttcaa---ga
MF674387_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674382_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281226_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281217_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactctccaa---ga
JQ281197_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281185_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281180_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JN604223_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JN604119_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
FJ023634_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281216_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281204_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281192_PreS2_P-B      atgcagtgga------actccaccacttttcatcaaactcttcaa---ga
JQ281181_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674401_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674482_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674500_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674433_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281220_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674513_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281210_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JN604253_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JN604125_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281200_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674393_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674394_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674395_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674413_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674452_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674510_PreS2_P-B      atgaagtgga------actccaccactttccatcaaactcttcaa---ga
MF674507_PreS2_P-B      atgcggtgga------actccaccactttccatcaaactcttcaa---ga
MF674443_PreS2_P-B      atacagtgga------actccacaactttccatcaaactcttcaa---ga
AY033072_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281208_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281202_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281203_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674515_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674497_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674487_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674470_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674469_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674438_PreS2_P-B      atgcagtgga------actccaccactttccatcaaacgcttcaa---ga
MF674437_PreS2_P-B      atgcagtgga------actccaccacttttcatcaaactcttcaa---ga
MF674493_PreS2_P-B      atgcagtgga------actccaccacttttcatcaaactcttcaa---ga
MF674421_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ341603_PreS2_P-B      atgcagtgga------actccacaactttccatcaaactcttcaa---ga
JQ341588_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281257_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281249_PreS2_P-B      atgcagtgga------acaccaccactttccatcaaactcttcaa---ga
JQ281254_PreS2_P-B      atgcagtgga------acaccaccactttccatcaaactcttcaa---ga
JQ281245_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281235_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281205_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281189_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281166_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281143_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281140_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
FJ023635_PreS2_P-B      atgcagtgga------actccactactttccatcaaactcttcaa---ga
FJ023633_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674447_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281256_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674511_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674477_PreS2_P-B      atgcagtgga------actccaccacttttcatcaaactcttcaa---ga
MF674455_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281213_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674383_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281199_PreS2_P-B      atgcartgga------actccaccactttccatcaaactcttcaa---ga
JQ281212_PreS2_P-B      atgcartgga------actccaccactttccatcaaactcttcaa---ga
JQ281228_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674400_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674405_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674499_PreS2_P-B      gtgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674488_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281147_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281187_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281209_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281139_PreS2_P-B      atgcagtgga------actccaccactttccatcaaacgcttcaa---ga
JQ281179_PreS2_P-B      atgcagtgga------actccaccactttccatcaaacgcttcaa---ga
MF674509_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674498_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674453_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674451_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674410_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
KU234318_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674483_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281186_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281178_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281184_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281172_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281176_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674384_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674397_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
FJ349236_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JN604154_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JN604284_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281215_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281223_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281246_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
MF674431_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ281211_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
KC792950_PreS2_P-B      rtgcagtgga------actccaccacsttccaccaaactcttcaa---ga
KC792946_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792840_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KC792997_PreS2_P-B      atgcagtgga------ackccaccactttccaccaaactcttcaa---ga
MG571366_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgc-------
KC792846_PreS2_P-B      gtgmrgtgga------actccaccackttccaccaaactcttcaa---ga
KC792859_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
FJ386608_PreS2_P-B      attcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571353_PreS2_P-B      atgcagcgga------actccaccactttccaccaaactcttcag---ga
MG571376_PreS2_P-B      atgcagcgga------actccaccactttccaccaaactcttcag---ga
KJ717837_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KJ803821_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KY417926_PreS2_P-B      atgcagtgga------actccaccacttttcaccaacctcttcaa---ga
EU570075_PreS2_P-B      attcagtgga------actccaccactttccaccaaactcttcaa---ga
EU579441_PreS2_P-B      attcagtgga------actccaccactttccaccaaactcttcaa---ga
EU589335_PreS2_P-B      attcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386656_PreS2_P-B      attcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276802_PreS2_P-B      atgcagtgga------actccacmactttccaccaaactcttcaa---ga
KX276791_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
KC792663_PreS2_P-B      atgcrgtgga------actycaccactktccaccaaactcttcaa---ga
KC792992_PreS2_P-B      ----agtgga------actacacaactttccaccaaactcttcaa---aa
KC792937_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
MG571331_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
KC792865_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
KC793181_PreS2_P-B      atgcagtgga------actccaccactgtccaccaaactcttcaa---ga
KC793161_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactctgcaa---ga
JQ341567_PreS2_P-B      atgmtgkgga------actccaccactttccaccaaactcttcag---ga
KC792722_PreS2_P-B      atgcagtgga------actccaccactttccaccaractcttcaa---ga
KC792715_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
MG571321_PreS2_P-B      atgaggtgga------actccaccactttccaccaaactcttcaa---aa
KC793191_PreS2_P-B      atgcagtgga------actccaacactttccaccaaactcttcaa---ga
KC792794_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ717817_PreS2_P-B      atgcagtgga------actccacaacattccaccaagctctgcta---ga
KJ803805_PreS2_P-B      atgcagtgga------actccacaacattccaccaagctctgcta---ga
KC793092_PreS2_P-B      atgcagtggc------acctcaccactttctaccaaactcttcaa---ga
MG571357_PreS2_P-B      atccagtgga------actccaccactttccaccaaactcttcaa---ga
JQ281206_PreS2_P-B      atgcrrtgga------actccaccactttccaccaaactcttcaa---ga
KU964381_PreS2_P-B      atgcagtgga------actccaccactttccaccaaaatcttcaa---ga
KU964382_PreS2_P-B      atgcagtgga------actccaccactttccaccaaaatcttcaa---ga
KU964383_PreS2_P-B      atgcagtgga------actccaccactttccaccaaaatcttcaa---ga
KU964384_PreS2_P-B      atgcagtgga------actccaccactttccaccaaaatcttcaa---ga
KU964385_PreS2_P-B      atgcagtgga------actccaccactttccaccaaaatcttcaa---ga
KU964388_PreS2_P-B      atgcagtgga------actccaccactttccaccaaaatcttcaa---ga
KU964391_PreS2_P-B      atgcagtgga------actccaccactttccaccaaaatcttcaa---ga
KU964393_PreS2_P-B      atgcagtgga------actccaccactttccaccaaaatcttcaa---ga
KU964395_PreS2_P-B      atgcagtgga------actccaccactttccaccaaaatcttcaa---ga
KU964397_PreS2_P-B      atgcagtgga------actccaccactttccaccaaaatcttcaa---ga
MG372436_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
JQ801516_PreS2_P-B      atgcagtgga------attccaccacgttccatcaaactcttcaa---ga
KC792947_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792737_PreS2_P-B      atgcagtgga------acaccaccactttccaccaaactcttcaa---ga
KC793083_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KC792709_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
AY217368_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793094_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
HM011475_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY167102_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
KC793164_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792788_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276801_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
KP406283_PreS2_P-B      atacagtgga------anncnnnnnnnnnnnnnnnnnnnnnnnnn---nn
KJ717818_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcta---ga
FJ562312_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX870001_PreS2_P-B      atgcagtgga------actccaccactttccaccagactcttcaa---ga
AB073823_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792785_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaacccttcaa---ga
KU964146_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964138_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964140_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964142_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964144_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964145_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964147_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964148_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964150_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964151_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964152_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964139_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964141_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964143_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964149_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276779_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792957_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaacgcttcaa---ga
JQ040147_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
EU939675_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU564822_PreS2_P-B      atgcagtgga------acgccaccactttccaccaaactcttcaa---ga
AY206390_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341577_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU939676_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
JQ341581_PreS2_P-B      atrcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571337_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KM213034_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341592_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
HM011470_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ410500_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793160_PreS2_P-B      atgcagtgga------acaccaccactttccaccaaactcttcaa---ga
JQ341572_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792742_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792729_PreS2_P-B      atgcagtgga------actcaaccactttccaccaaactcttcaa---ga
KC793001_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
JX504538_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JN827419_PreS2_P-B      atgcagtgga------actccacaactttccaccaaactcttcaa---ga
KY470834_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470837_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470841_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470833_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KY470832_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470840_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470835_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470836_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470839_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470838_PreS2_P-B      atgcagtgga------accccaccactttccaccaaactcttcaa---ga
KY470830_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793016_PreS2_P-B      atccagtgga------acgccaccactttccaccaaactcttcaa---ga
EU796071_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY206383_PreS2_P-B      atgcagtgga------actcaaccactttccaccacactcttcaa---ga
GU815574_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815577_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815573_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815554_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815561_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
GU815569_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
GU815571_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815578_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815570_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815565_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815567_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815576_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815560_PreS2_P-B      atgcagtgga------actctaccaatttccatcaaactcttcaa---ga
GU815557_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815550_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815549_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815548_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815558_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815562_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815563_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815572_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815575_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815551_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815552_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815553_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815555_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815556_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815559_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815564_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815566_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
GU815568_PreS2_P-B      atgcagtgga------actctaccactttccatcaaactcttcaa---ga
EU595031_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ032349_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386675_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KT749820_PreS2_P-B      gtgcagcgga------actccaccactttccaccaaactcttcaa---ga
EU796067_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP406287_PreS2_P-B      atacagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406285_PreS2_P-B      atacagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406289_PreS2_P-B      atacagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406292_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406286_PreS2_P-B      atacagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406284_PreS2_P-B      atacagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406294_PreS2_P-B      atacagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406291_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406281_PreS2_P-B      atacagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406282_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406293_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406311_PreS2_P-B      ctgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406304_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406305_PreS2_P-B      atgcagtgga------acgccaccacttttcaccaaactcttcaa---ga
KP406312_PreS2_P-B      atgcagtgga------acgccaccacttttcaccaaactcttcaa---ga
KP406314_PreS2_P-B      atgcagtgga------acgccaccacttttcaccaaactcttcaa---ga
KP406301_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaaatcttcaa---ga
KP406298_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406317_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406306_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406307_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406308_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406309_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406310_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406313_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406315_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406316_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406288_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406290_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406303_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406302_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406297_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406296_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406295_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406299_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406300_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
MG571370_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571348_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---aa
KX276793_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC793084_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC792711_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
DQ993702_PreS2_P-B      atggaatgga------actccaccactttccaccaaactcttcaa---ga
DQ141618_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EF473974_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792982_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792797_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792755_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792736_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
AY800389_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB195934_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB195935_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571372_PreS2_P-B      atacagtgga------cctccaccactttccaccaaactcttcaa---ga
GU332695_PreS2_P-B      atgcagtgga------actccacaactttccaccaaactcttcaa---ga
DQ993700_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ993701_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571364_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571328_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
MG571344_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793070_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ027315_PreS2_P-B      acgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KX276781_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793192_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792908_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ924606_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB073829_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377629_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306711_PreS2_P-B      atgcagtgga------actccatcactttccaccaaactcttcaa---ga
FJ032352_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ032353_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ032354_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377525_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386682_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148334_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793089_PreS2_P-B      atgcagtgga------aytccaccacttttcaccagactcttcaa---ga
KC792938_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JN604311_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU139543_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148318_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793122_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562321_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AF282917_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB900110_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792735_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU939663_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
KC792766_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386681_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571342_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148325_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792869_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792838_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341566_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ924610_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU564823_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306710_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306707_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306704_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306703_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793010_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792872_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KC792893_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964079_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964081_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964084_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964085_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964086_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964089_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964090_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964091_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964080_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964082_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964083_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964087_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964088_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964092_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306709_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306700_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306701_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306702_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306706_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306708_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306712_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306705_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963852_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963842_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963843_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963844_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963845_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963846_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963847_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963848_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963849_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963850_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963851_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963853_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793153_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX661482_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386583_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB300364_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774393_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792687_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MF674391_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX661478_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173347_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173348_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JN604134_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510651_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MH663473_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MH061283_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571374_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963799_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963800_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963801_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963802_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963803_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963804_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963805_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963806_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963807_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963808_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963809_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963810_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963811_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963812_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963813_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ410507_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173424_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173425_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510658_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510655_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ924632_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377542_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU564824_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX507210_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793135_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KM359440_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MF674449_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB642101_PreS2_P-B      atgcggtgga------actccataactttccaccaaactcttcaa---ga
AB302095_PreS2_P-B      gtgaagtgga------actccaccactttccaccaaactcttcaa---ga
AB073849_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB300371_PreS2_P-B      atgcagtgga------actctaccactttccaccaaactcttcaa---ga
AB900096_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB287327_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073847_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB931168_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcag---ga
AB931169_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcag---ga
KC793156_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactctccaa---ga
AB900097_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
D50521_PreS2_P-B        atgcagtgga------actccaccactttccaccaaactcttcaa---ga
D50522_PreS2_P-B        atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB900107_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073854_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB014366_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
AB106884_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
AB073851_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
AB246343_PreS2_P-B      atgcagtgga------actccaccattttccaccaaactcttcag---ga
AB900105_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB362933_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB900095_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073838_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
AB010292_PreS2_P-B      atacagtgga------acgccaccactttccaccaaactcttcaa---ga
AB900106_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB900111_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073858_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073843_PreS2_P-B      atgcagtgga------attccacaactttccaccaaactcttcaa---ga
AB010290_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB010291_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341571_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB828708_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB900103_PreS2_P-B      atgcagtgga------actcgaccactttccaccaaactcttcaa---ga
AB073852_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073842_PreS2_P-B      atacagtgga------actccaccattttccaccaaactcttcaa---ga
AB900112_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073844_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB073855_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB900102_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB900104_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
D23678_PreS2_P-B        atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073856_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
AB900108_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
AB287326_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073845_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB246342_PreS2_P-B      atgcagtgga------actccaccattttccaccaaactcttcag---ga
AB246341_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073850_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB010289_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
D00329_PreS2_P-B        atgcagtgga------actccaccactttccaccaaactcttcaa---ga
D23679_PreS2_P-B        gtgcagtgga------actccgccactttccaccaaactcttcaa---ga
MH932712_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073848_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073846_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
AB205121_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
LC279268_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
LC279269_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
LC279270_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
LC279271_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
LC279272_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
LC279273_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB642093_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC793149_PreS2_P-B      rtgmagtgga------wcwscmccwytttccaccaaactcttcaa---ga
KC793184_PreS2_P-B      rygywttgga------actccaycaggttccrmmaaactcttcma---ga
KC793162_PreS2_P-B      atgcagtgga------actcgaccactttccaccaaactcttcaa---ga
KC792683_PreS2_P-B      gtgmagtgga------actccaycactttcctccaaactcttcaa---ga
KX276796_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792808_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ023631_PreS2_P-B      atgcagtgga------actccaccactttccaccgagctcttcaa---ac
DQ141621_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaacttttcaa---ga
KX276772_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276782_PreS2_P-B      atgcagtgga------actccaccactttccacaaaactcttcaa---ga
KY881845_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
KY881865_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
KY881869_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
KY881849_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
KY881853_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
KY881864_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
MG826153_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792837_PreS2_P-B      atgcagtgga------actccaccackttccaccaaactcttcaa---ga
JQ341561_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341587_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ra
KC792800_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571336_PreS2_P-B      attcagtgga------actcccccactttccaccaaactcttcag---ga
KC793154_PreS2_P-B      atgcagtgga------actccaccactttccaccaractcttcaa---ga
KC793032_PreS2_P-B      atkcrgtgga------actccaccactttccaccaaactcttcaa---ga
KC792976_PreS2_P-B      atgaagtgga------attccaccactttccaccaaactctkcag---ga
HM011503_PreS2_P-B      atgcrgtgga------actccaccactttccaccaaactcttcaa---ga
HM011471_PreS2_P-B      atgaagtgga------actccaccacttttcaccaaactctccaa---ga
KC792829_PreS2_P-B      atgaagtgga------actccacaactttccaccaaactcttcaa---ga
KU963815_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KU963814_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KU963817_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KU963818_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KU963819_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KU963820_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KU963821_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KU963822_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KU963823_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KU963824_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KU963825_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KU963826_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KU963827_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KU963854_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KC792807_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
JQ341560_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
KY881893_PreS2_P-B      ------caaactcttcactccaccactttccaccaaactcttcaa---ga
KY881847_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881851_PreS2_P-B      gtgtagtgga------actccaccgctttccaccaaactcttcaa---ga
KY881863_PreS2_P-B      gtacagtgga------actccaccactttccaccaaactcttcaa---ga
KY881904_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881867_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881856_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881906_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881908_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881858_PreS2_P-B      gtgcagtgga------actccaccgctttccaccaaactcttcaa---ga
KY881910_PreS2_P-B      gtgcagtgga------actccaccgctttccaccaaactcttcaa---ga
KY881909_PreS2_P-B      gtgcagtgga------actccaccaatttccaccaaactcttcaa---ga
KY881844_PreS2_P-B      gtacagtgga------actccaccactttccaccaaactcttcaa---ga
KY881846_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881894_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881902_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881903_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881905_PreS2_P-B      gtacagtgga------actccaccactttccaccaaactcttcaa---ga
KY881907_PreS2_P-B      gtacagtgga------actccaccactttccaccaaactcttcaa---ga
KY881911_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881862_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881868_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881861_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881857_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881848_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881866_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881852_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881854_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881859_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881901_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881900_PreS2_P-B      ttgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881895_PreS2_P-B      tttcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881897_PreS2_P-B      tttcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881898_PreS2_P-B      tttcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881855_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881860_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881899_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881912_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881913_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881896_PreS2_P-B      taccagtgga------actccaccactttccaccaaactcttcaa---ga
KY881914_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU939667_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KJ173375_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KJ173376_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
AB073825_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KJ173298_PreS2_P-B      atgcagtgga------actccaccactttccatcaagctcttcaa---ga
KJ173379_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
MK052962_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
MK052964_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
MK052965_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
MG571355_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148583_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148580_PreS2_P-B      atgcagtgga------accccaccactttccaccaagctcttcaa---ga
KJ173297_PreS2_P-B      atgcagtgga------actccaccactttccatcaagctcttcaa---ga
JN604187_PreS2_P-B      atgcaatgga------actccaccactttccaccaagctcttcaa---ga
FJ562246_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148581_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148349_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148348_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148342_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KJ173362_PreS2_P-B      atgcaatgga------actccaccactttccaccaagctcttcaa---ga
KJ173357_PreS2_P-B      atgcagtgga------actccaccactttccaccaagttcttcaa---ga
JQ341555_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
EU306696_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ377158_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306695_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306697_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306698_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173351_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KJ173353_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
MG571349_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148582_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148579_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148343_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148340_PreS2_P-B      atgcagtgga------acgccaccactttccaccaagctcttcaa---ga
KP148338_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148336_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148339_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148341_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148344_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148345_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148346_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KP148347_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KJ173361_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
AB675676_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
JX661483_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KJ173355_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KJ173356_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KJ173389_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KJ173390_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
MG571362_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KC774402_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KC792805_PreS2_P-B      atgcagtgga------actccaccrctttccaccaaactcttcaa---ga
KC792812_PreS2_P-B      atgcagtgga------actccaccrctttccaccaaactcttcaa---ga
JX026883_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276771_PreS2_P-B      atgcagtgga------actccaccactytccaccaaactcttcaa---ga
EU939674_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ899790_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ899791_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881820_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881821_PreS2_P-B      atgcagtgga------actccaccactttcaaccaaactcttcaa---ga
KY881841_PreS2_P-B      atgcagagga------actccaccacttttcaccaaactcttcaa---gg
KY881842_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881833_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KY881825_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KY881835_PreS2_P-B      atgcagtgga------actccaccactttgcaccaaactcttcaa---ga
KY881834_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
KY881838_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KY881830_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KY881826_PreS2_P-B      aggcagtgga------actccaccacttttcaccaaactcttcaa---ga
KY881843_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KY881839_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881831_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881827_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KY881824_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KY881823_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KY881836_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KY881822_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KY881828_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KY881829_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KY881837_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
EU939637_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU939636_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964259_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KU964270_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KU964269_PreS2_P-B      atgcagtgga------actccatcacgttccaccaaactcttcaa---ga
KU964265_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964267_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964271_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964260_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964262_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964257_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964261_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964263_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964264_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964266_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964268_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ904357_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacgcttcaa---ga
KC792689_PreS2_P-B      atgcagtgga------actccaccacyttccaccaaactcttcaa---ga
KP406253_PreS2_P-B      atgcagtgga------actccaccactgttcaccaaactcttcaa---ga
KP406245_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406249_PreS2_P-B      atgcagtgga------actccaccactgttcaccaaactcttcaa---ga
KP406244_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406246_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406248_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406252_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406254_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406247_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406250_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406251_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC793061_PreS2_P-B      atdcagtgga------actccaccactttccaccaaactcttcaa---ga
KF053180_PreS2_P-B      atgcaatgga------actccaccactttccaccaaactcttcaa---ga
KJ803773_PreS2_P-B      atgcaatgga------actccaccactttccaccaaactcttcaa---ga
KF053182_PreS2_P-B      gagcaatgga------actccaccactttccaccaaactcttcaa---ga
KJ803775_PreS2_P-B      gagcaatgga------actccaccactttccaccaaactcttcaa---ga
KY881808_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
KY881787_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881794_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881799_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881791_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctccaa---ga
KY881785_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881800_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881797_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881786_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881783_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881795_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881781_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881784_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881850_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881793_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881790_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881789_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881788_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881782_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881780_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881798_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881801_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU939669_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ899779_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964277_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964272_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964273_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964274_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964275_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964276_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964278_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964279_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964281_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964284_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964285_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964282_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964283_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964280_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KU964286_PreS2_P-B      nngcagtgga------actccaccaagttccaccaaacgcttcaa---ga
KP406273_PreS2_P-B      gtgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406272_PreS2_P-B      gtgcagtgga------actccatcacttttctccaaactcttcaa---ga
KP406263_PreS2_P-B      gtgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406257_PreS2_P-B      gtgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406275_PreS2_P-B      gtgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406262_PreS2_P-B      gtgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406276_PreS2_P-B      gtgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406279_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406271_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406269_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406260_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406266_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406258_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406264_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406268_PreS2_P-B      gtgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406265_PreS2_P-B      gtgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406280_PreS2_P-B      gtgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406274_PreS2_P-B      gtgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406255_PreS2_P-B      gtgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406270_PreS2_P-B      gtgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406278_PreS2_P-B      gtgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC793096_PreS2_P-B      atgcagagaa------aytccaccactttccaccaaactcttcag---ga
KC793036_PreS2_P-B      atgcagtgga------actcaaccactttccaccaaactcttcaa---ga
KC792699_PreS2_P-B      rtgmaktgga------actccaccactttccaacaaactcttcaa---ga
EU939670_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
HM011477_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
KX276795_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctrcaa---ga
KC792718_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793041_PreS2_P-B      atgcagtgga------aytccaccactttccaccaaactcttcaa---ga
KC793171_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792688_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KC792770_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP406179_PreS2_P-B      atgcagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406190_PreS2_P-B      atgcagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406212_PreS2_P-B      atgcagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406216_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406194_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406182_PreS2_P-B      atgcagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406176_PreS2_P-B      gtgcagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406177_PreS2_P-B      gtgcagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406178_PreS2_P-B      gtgcagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406180_PreS2_P-B      gtgcagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406181_PreS2_P-B      gtgcagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406183_PreS2_P-B      gtgcagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406184_PreS2_P-B      gtgcagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406185_PreS2_P-B      gtgcagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406203_PreS2_P-B      gtacagtgga------acttcaccacttttcaccaaactcttcaa---ga
KP406188_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406195_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406200_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406217_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406186_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406191_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406193_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406196_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406198_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406201_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406202_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406204_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406205_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406206_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406207_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406209_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406211_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406213_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406215_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406218_PreS2_P-B      gtacagtgga------actccaccacctttcaccaaactcttcaa---ga
KP406187_PreS2_P-B      gtacagtgga------acttcaccacctttcaccaaactcttcaa---ga
KP406189_PreS2_P-B      gtacagtgga------acttcaccacctttcaccaaactcttcaa---ga
KP406192_PreS2_P-B      gtacagtgga------acttcaccacctttcaccaaactcttcaa---ga
KP406197_PreS2_P-B      gtacagtgga------acttcaccacctttcaccaaactcttcaa---ga
KP406199_PreS2_P-B      gtacagtgga------acttcaccacctttcaccaaactcttcaa---ga
KP406208_PreS2_P-B      gtacagtgga------acttcaccacctttcaccaaactcttcaa---ga
KP406210_PreS2_P-B      gtacagtgga------acttcaccacctttcaccaaactcttcaa---ga
KP406214_PreS2_P-B      gtacagtgga------acttcaccacctttcaccaaactcttcaa---ga
KP406219_PreS2_P-B      gtacagtgga------acttcaccacctttcaccaaactcttcaa---ga
KC792761_PreS2_P-B      atgcagtgga------acwccaccactttccaccaaactcttcaa---ga
HM011504_PreS2_P-B      atgcagtgga------actccacmactttccaccaaactcttcaa---ga
KC793104_PreS2_P-B      atgcagtgga------actccatcactttcctcaatactcttcaa---ac
KC774397_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
KC792791_PreS2_P-B      atgcagtgga------aytcaaccactttccaccaaactcttcaa---ga
KC792768_PreS2_P-B      atgcagtgga------aytccaccactttccaccaaactcttcaa---ga
KM213035_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792842_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
AF461360_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
KJ843165_PreS2_P-B      gtgcagtgga------actccagaactttccaccaaactcttcaa---ga
KC792650_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ra
KC793177_PreS2_P-B      atgcagtgga------acgccaccactttccaccaaactcttcaa---ga
FJ787475_PreS2_P-B      atgcaatgga------actccaccactttccaccaaactcttcaa---ga
KC792887_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792844_PreS2_P-B      rtgcagtgga------attccaccactttccaccaaactcttcaa---ga
JQ341557_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792904_PreS2_P-B      atgmagtgga------actccaccactttccaccaaactcttcaa---ga
KX276784_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
KC792884_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC792765_PreS2_P-B      atgcagwgga------actccaccactttccaccaaactcttcaa---ga
KC792824_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792781_PreS2_P-B      attcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793158_PreS2_P-B      atgcagtgga------actccaccactttccaccagactcttcaa---ga
KC793109_PreS2_P-B      atgcagtgga------actccaccacyttccaccaaactcttcaa---ga
KC793069_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
KC792958_PreS2_P-B      gtgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC792866_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
JX026879_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
HM011494_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacycttcaa---ga
KJ717842_PreS2_P-B      atgcagggga------actccaccactttccaccaaactctgcta---ga
KC792789_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KC793175_PreS2_P-B      atrcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792750_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341586_PreS2_P-B      atrcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ924647_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
HM011483_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793147_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
EU939635_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774362_PreS2_P-B      atgaagtgga------actccaccacttttcaccaaactcttcaa---ga
JX504532_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562259_PreS2_P-B      atgcagtgga------actccaccactttccacctaactcttcaa---ga
FJ562236_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964258_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793048_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793042_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792890_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
KC792930_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964118_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964115_PreS2_P-B      atgcagtgga------actcaaccactttccaccaaactcttcaa---ga
KU964112_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964114_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964116_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964119_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964121_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964108_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964109_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964110_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964122_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964111_PreS2_P-B      atgcagtgga------actcaaccactttccaccaaactcttcaa---ga
KU964113_PreS2_P-B      atgcagtgga------actcaaccactttccaccaaactcttcaa---ga
KU964120_PreS2_P-B      atgcagtgga------actcaaccactttccaccaaactcttcaa---ga
KM213032_PreS2_P-B      atacagtgga------attccaccactttccaccaaactcttcaa---ga
EU939671_PreS2_P-B      gtgcagtgga------actccaccactttcctccaaactcttcaa---ga
KF053174_PreS2_P-B      atgcagtgga------actccaccactttcctccaaactcttcaa---ga
KJ803768_PreS2_P-B      atgcagtgga------actccaccactttcctccaaactcttcaa---ga
EU939639_PreS2_P-B      atacagtgga------actccaccacttttcaccaaactcttcaa---ga
KJ173341_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KJ173342_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctcttcaa---ga
KJ173385_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793055_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562257_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562240_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
EU939673_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KU964094_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964093_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964095_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964097_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964099_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964100_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964105_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964106_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964098_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964096_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964101_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964102_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964104_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964107_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792681_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ040128_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY167093_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774389_PreS2_P-B      atgcagtgga------actccaccacttttcacaaaactcttcag---ga
KC774380_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC774388_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC774385_PreS2_P-B      atgcaatgga------actccaccacttttcaccaaactcttcaa---ga
KC774381_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC774379_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC774391_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC774390_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC774386_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC774387_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC774383_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC774378_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC774363_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC774382_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC774384_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KC774392_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
MG571339_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
KU964137_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792668_PreS2_P-B      atgcagtgga------actccaccaatttccaccaaactcttcaa---ga
AY596111_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571327_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KR152339_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
JQ341559_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY596104_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073833_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY167098_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792996_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792815_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562303_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY217355_PreS2_P-B      atgcagtgga------actcccccactttccaccaaactcttcag---ga
AY217356_PreS2_P-B      atgcagtgga------actcccccactttccaccaaactcttcag---ga
AY217357_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY217358_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793130_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792835_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562296_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793157_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774413_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562219_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562234_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY596105_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793007_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MF674506_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377622_PreS2_P-B      atgcagtgga------actccaacactttccaccaaactcttcaa---ga
KU964135_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964131_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964136_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964124_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964125_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964126_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964127_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964128_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964129_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964130_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964133_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964134_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964123_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964132_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY217361_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
KC792686_PreS2_P-B      atgcagtgga------actcaaccactttccaccaaactcttcaa---ga
DQ993711_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792773_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY167094_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793143_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ801524_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY596106_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU796066_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793179_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774374_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY596110_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY596112_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276776_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
JQ027313_PreS2_P-B      rtgcagtgga------actccaccacwttccacaaaactcttcaa---ga
KX276794_PreS2_P-B      atgmagtgga------actccaccacwttccacaaaactcttcaa---ga
KJ717801_PreS2_P-B      atgcagtgga------actccacaacattccaccaagctctgcta---ga
KX276783_PreS2_P-B      atgcagtgga------actccacmrctttccaccaractcytcaa---ga
KC792929_PreS2_P-B      mtwmagtgga------actcyctcacgttccaccaaactcttcaa---ga
KC793075_PreS2_P-B      atgcagtgga------actccacmackttccaccaaactcttcaa---ga
DQ993696_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ040157_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793189_PreS2_P-B      atgcagtgga------actccaccactttcctccaaactcttcaa---ga
KC792942_PreS2_P-B      atgcaatgga------actccaccactttccatcaaactcttcar---ga
KC792662_PreS2_P-B      ataaagtgga------actccmccactttycaccaaactcttcaa---ga
KX276797_PreS2_P-B      atgcagtgga------actccaccacsttccaccaaactcttcaa---ga
KX276787_PreS2_P-B      atgmagtgga------actccaccacyttccaycaaactcttcaa---ga
KC792983_PreS2_P-B      atgcagtgga------attcmacmackttycaccaaactctycaa---ga
KC792870_PreS2_P-B      rtaaagtgga------actccmccacttgccaccaaactctgcaa---ra
FJ386648_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792676_PreS2_P-B      atscagtgga------actccacyactttccaccaaactcttcaa---ga
JN604130_PreS2_P-B      atgcagtgga------acaccaccacgtttcatcaaactcttcaa---ga
KC793011_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KX276786_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276774_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341595_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
KC793188_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
KC793185_PreS2_P-B      atrcagtgga------actccaccackttccaycaaactcttcaa---ga
KC793134_PreS2_P-B      atrmrrtgga------actccatcactttccaccaaactcttcma---gg
KC792998_PreS2_P-B      atgcaatgga------actacaccaacttccaccgaactcttcaa---aa
KC792811_PreS2_P-B      atgcrgtgga------aytccaccacyttccaccaaactcttcaa---ga
KX276792_PreS2_P-B      atgcggtgga------acwscacmactttccaccaaactcttcaa---ga
KC793034_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JF436921_PreS2_P-B      atacagtgga------actacaccactttccaccaaactcttcaa---ga
KC793139_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcma---ga
KC793076_PreS2_P-B      atryaktgga------actcccccactttcmaccaaactcttcam---ga
KC792769_PreS2_P-B      atgcagtgga------actccaccactttcctccaaactcttcra---ga
MG571352_PreS2_P-B      atgcagggga------acgccaccactttccaccaaactcttcaa---ga
AB073853_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793136_PreS2_P-B      atgcagtgga------attccacaactttccaccaaactcttcag---ga
KC792920_PreS2_P-B      atgcagtgga------actccaccactttcctccaaactcttcaa---ga
KC792777_PreS2_P-B      atgcagtgga------acwccaccactttccaccaaactctgcar---ga
KC792724_PreS2_P-B      atacagtgga------actccaccactttccaccwaactcttcaa---ga
KC792675_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792881_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793044_PreS2_P-B      atgaagtgga------aytccaccactttccaccaaactcttcaa---ga
KC792987_PreS2_P-B      atgcagwgga------actccaccactttccaccaaactcttcaa---ga
KC792659_PreS2_P-B      atgcagtgga------actccacmactttccaccaaactcttcar---ga
KC793017_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
KC793118_PreS2_P-B      rtgcrgtgga------actccaccactttccwycaaactctgcaa---ga
KC793028_PreS2_P-B      atgcggtgga------actcccccaccttccacaaaactcttcaa---ga
KC792966_PreS2_P-B      atgcagtgga------actcaaccactttccaccaaactcttcaa---ga
KC792843_PreS2_P-B      atgcagtgga------acaccacwactttccaccaaactcttcag---ga
KX276800_PreS2_P-B      atgcagtgga------actcmacmactttccaccaaacycttcaa---ga
KC793128_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793159_PreS2_P-B      atgcagtgga------actcaacaactttccaccaaactcttcaa---ga
KC793060_PreS2_P-B      atgcagtgga------actcmaccactttccaycaaactcttcaa---ga
EU939678_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
KC792723_PreS2_P-B      atgcagtgga------attccaccackttccaccaaactcttcar---ga
X97850_PreS2_P-B        atgcagtgga------actccacaactttcctccaaactcttcaa---ga
MG571351_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ717820_PreS2_P-B      atgcagtgga------actcaaccactttccaccaaactcttcaa---ga
KJ803808_PreS2_P-B      atgcagtgga------actcaaccactttccaccaaactcttcaa---ga
KX276806_PreS2_P-B      atgcagtgga------actccacmacyttccaccaaactctccaa---ga
KX276798_PreS2_P-B      wtgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC793145_PreS2_P-B      atgcagtgga------actccaccackttccaccaaactcttcaa---ga
KC793038_PreS2_P-B      gcgcagtgga------attccaccaccgtcaaccagactcttcaa---gr
KC792936_PreS2_P-B      atrcagtgga------aywccaccactttccaccaaactcttcaa---ga
EU939634_PreS2_P-B      gtgaagtgga------actccaccactttccaccaaactcttcaa---ga
KX276770_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792850_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC792694_PreS2_P-B      atgcagtgga------acwmcaccactttccaccaaactcttcag---ga
KC793095_PreS2_P-B      atacagtgga------actccaccactttccaycaaactcttcaa---ga
KC793009_PreS2_P-B      atgcagtgga------actccacaactttccaccaaactcttcaa---ga
KC792863_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276813_PreS2_P-B      atgcagtgga------attccacaactttccaccaaactcttcaa---ga
KC792845_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792804_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792786_PreS2_P-B      atrcagtgga------attccaccactttccatcaaactcttcaa---ga
FJ562260_PreS2_P-B      atgcagtgga------attccaccacattccaccaaactctacaa---ga
KC792712_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
KC792651_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
DQ995804_PreS2_P-B      acgcagtgga------actccaccaagttccaccaaactcttcaa---ga
MG571338_PreS2_P-B      atacagtgga------actccaccaccttccaacaaactcttcaa---ga
KC792986_PreS2_P-B      atgcagtgga------actccaccacbttccaccaaactcttcaa---ga
KC792878_PreS2_P-B      atgcagtgga------atkccaccactttcctccaaactcttcac---ga
KY881792_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
KC793080_PreS2_P-B      atgcagtgga------aytccaccacgttccaccaaactcttcag---ra
KC793078_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793116_PreS2_P-B      atgmagtgga------acwccaccactttccaccaaacrcttcaa---ga
KC792721_PreS2_P-B      atgmagtgga------actccaccackttccaccaaactcttcaa---ga
KC792677_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792953_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---aa
KX276785_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
KC793125_PreS2_P-B      rtgyrgtgga------aytccaccactttccaccaaactcttcaa---ga
KC792991_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792802_PreS2_P-B      atgcagtgga------acwccaccacyttccaccaaactcttcaa---ga
KC793057_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC792745_PreS2_P-B      gtgaagtgga------actccaccactttccaccaaactcttcaa---aa
KC792743_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
KC792764_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
HM011476_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactattcaa---ga
KC793166_PreS2_P-B      rtgcagtgga------actccaccactttcctccaaactcttcaa---ga
KC793155_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792752_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
KC792748_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792727_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaacycttcag---ga
KC792705_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctccaa---ga
GQ377644_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793049_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EF494381_PreS2_P-B      atacagtgga------actcaaccactttccaccaaactcttcaa---ga
KC793087_PreS2_P-B      atgmagtgga------attccaccactttccaccaaactcttcaa---ga
KC792848_PreS2_P-B      gtgcrgtgga------attccaccactttccaccaaactcttcaa---ga
KC792897_PreS2_P-B      atacagtgga------acaccaccactttccaccaaactcttcaa---ga
JQ027325_PreS2_P-B      atacagtgga------actccaccactttccaccwaactcttcaa---ga
AB900098_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ717836_PreS2_P-B      atgcggtgga------actccaccactttccaccaaactcttcaa---ga
KJ803820_PreS2_P-B      atgcggtgga------actccaccactttccaccaaactcttcaa---ga
KC793197_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
EU487256_PreS2_P-B      atgcagtgga------actccaccactttcctccaaactcttcaa---ga
EU660224_PreS2_P-B      atgcagtgga------actccaccactttcctccaaactcttcaa---ga
KX276799_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793200_PreS2_P-B      atgcagtgga------acwcaaccactttccaccaaactcttcaa---ga
KC793056_PreS2_P-B      atgaagtgga------actccaccacttcccaccaaactcttcaa---ga
KC792931_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
KC793120_PreS2_P-B      atrcagtgga------actccaccackttccaccaaactcttcaa---ga
KC793072_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793059_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
KC793012_PreS2_P-B      atgmagtgga------acwccaccactttccaccaaactcttcaa---ga
KC793054_PreS2_P-B      gtgcagtgga------actccaccactttccacaaaactctgcaa---ga
KC792956_PreS2_P-B      rtgaagtgga------actccaccactttccaccaaactcttcaa---ga
HM011484_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ032342_PreS2_P-B      acgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ717808_PreS2_P-B      atgcagtgga------actccaccactgtccaccaaactctccta---ga
KJ803797_PreS2_P-B      atgcagtgga------actccaccactgtccaccaaactctccta---ga
KJ717806_PreS2_P-B      atgcagtgga------actccaccactgtccaccaagctatgcta---ga
KJ803795_PreS2_P-B      atgcagtgga------actccaccactgtccaccaagctatgcta---ga
KF053194_PreS2_P-B      atgcagtgga------actccaccactgtccaccaagctctgcta---ga
KJ803781_PreS2_P-B      atgcagtgga------actccaccactgtccaccaagctctgcta---ga
KJ717805_PreS2_P-B      atgcagtgga------actccaccactgtccaccaagctctgcta---ga
KC793043_PreS2_P-B      atgcagtgga------actccaccactttccaycaaactcttcaa---ga
KC792847_PreS2_P-B      atgcagtgga------actccacccctttccaccaaactcgtcaa---ga
KC792744_PreS2_P-B      atgcagtgga------actymaccactttccaccaaactcttcaa---ga
KC792652_PreS2_P-B      atgcagtgga------attccaccaacttccaccaaactcttcaa---ga
HM011478_PreS2_P-B      atgcagtgga------actccaccacyttccaccaaactcttcaa---ga
EU547563_PreS2_P-B      atgcagtgga------acgccaccacgttccaccaaactcttcaa---ga
AY163869_PreS2_P-B      atgcagtgga------actccaccacgttccacaaaactcttcaa---ga
AY163870_PreS2_P-B      atgcagtgga------actccaccacgttccacaaaactcttcaa---ga
MK818223_PreS2_P-B      atgcagtgga------actccaccacsttccaccaaactcttcaa---ga
KC792939_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792905_PreS2_P-B      atgcagtgga------actccaccackttccaccaaactcttcaa---ga
KC792861_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
KC792860_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX429901_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ027312_PreS2_P-B      atgcagtgga------acwccaccactttccaccaaactcttcaa---ga
KC792664_PreS2_P-B      ataaagtgga------attcccccactttccacaaaactctgcaa---ga
KC792900_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactctgcaa---ga
KC793173_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792975_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC792882_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
KC792701_PreS2_P-B      atgcagtgga------actccaccactktccaccaaactcttcaa---ga
JQ341553_PreS2_P-B      atgmagtgga------actcctccactttccaccaaactctccaa---ra
EU158262_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
AB555499_PreS2_P-B      atgcagtgga------actccaccactttccaccactctcctcat---gg
KJ717843_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcta---ga
KJ803825_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcta---ga
KC793182_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793151_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793148_PreS2_P-B      atgcagtgga------actccaccackttccaccaaactcttcaa---ga
KC793088_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctkcaa---ga
KC793004_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KC792780_PreS2_P-B      atrcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792760_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
KC792758_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792733_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
KC792918_PreS2_P-B      atgcagtgga------attacgccactttccatcaaactcttcaa---gt
KC792810_PreS2_P-B      ataaggtggr------gcaaccccactttccaccaaactcttcaa---ga
KC792726_PreS2_P-B      atgcagtgga------actccaccacyttccaccaaactcttcaa---ga
FJ032344_PreS2_P-B      attcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ995802_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY220697_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
KP406161_PreS2_P-B      atgcagtgga------actccaccacctttcaccaaactcttcaa---ga
KJ717797_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793194_PreS2_P-B      atgcagtgga------actcccccactttccaccaaactcttcaa---ga
KC792928_PreS2_P-B      atgcagtgga------actcttccactttccaccaaactcttcaa---ga
KC792825_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
DQ995801_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctccaa---ga
KC793090_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793071_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793015_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793000_PreS2_P-B      atgcagtgga------ackccaccactttcctccaaactcttcaa---ga
KC792970_PreS2_P-B      atgcagtgga------actccacmactttccaccaaactcttcaa---ga
KC792725_PreS2_P-B      atgcagtgga------actmcaccactktccaccaaactcttcaa---ga
JX026886_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
JQ341582_PreS2_P-B      atgmartgga------actccaccactttccaccaaactcttcaa---ga
JQ341562_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
HM011482_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU939661_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
KJ717795_PreS2_P-B      atgcagtgga------actccacaacattccaccaagctctgcta---ga
KJ803789_PreS2_P-B      atgcagtgga------actccacaacattccaccaagctctgcta---ga
KC793190_PreS2_P-B      atgaagtgga------actccaccackttccaccaaactcttcaa---ga
KC793047_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
KX276809_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KC793174_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793163_PreS2_P-B      atgcagtgga------actccaccactttccaccacactcttcaa---ga
KC792730_PreS2_P-B      atgcagtgga------actccaccacyttccaccaaactcttcaa---ga
AB302942_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcac---ga
AB302943_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcac---ga
AB302944_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcac---ga
AB302945_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcac---ga
KC793124_PreS2_P-B      atgcagtgga------actccacaactttccaccaaactcttcaa---ga
KC792988_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792822_PreS2_P-B      atrcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792696_PreS2_P-B      atgcagtgga------actccaccacyttccaccaaactcttcaa---ga
KC792671_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ787477_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793117_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
KC792924_PreS2_P-B      atgcagtgga------actccaccactttccaccatactcttcaa---ga
KC792851_PreS2_P-B      atgaagtgga------actccaccactttccacaaaactcttcaa---ga
GQ924630_PreS2_P-B      atgcggtgga------actccaccactttccaccaaactcttcaa---ga
AB073857_PreS2_P-B      atgcagtgga------actccaccaatttccatcaaactcttcaa---ga
KP406162_PreS2_P-B      atgaagtgga------actcccccacttttcaccaaactcttcaa---ga
KP406163_PreS2_P-B      atgaagtgga------actcccccacttttcaccaaactcttcaa---ga
KP406165_PreS2_P-B      atgaagtgga------actcccccacttttcaccaaactcttcaa---ga
KP406167_PreS2_P-B      atgaagtgga------actcccccacttttcaccaaactcttcaa---ga
KP406172_PreS2_P-B      atgaagtgga------actcccccacttttcaccaaactcttcaa---ga
KP406171_PreS2_P-B      atgaagtgga------actcccccacttttcaccaaactcttcaa---ga
KP406173_PreS2_P-B      atgaagtgga------actcccccacttttcaccaaactcttcaa---ga
MG571358_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792728_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
KC792692_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
HM153811_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173383_PreS2_P-B      atgcattgga------actccaccaaattccaccaaactcttcaa---ga
KJ173384_PreS2_P-B      atgcattgga------actccaccaaattccaccaaactcttcaa---ga
KX276811_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276805_PreS2_P-B      atgcagtgga------aytccaccactttccaccaaactcttcaa---ga
KC793199_PreS2_P-B      atgcagtgga------actccaccacbttccaccaaactcttcaa---ga
KC793081_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793008_PreS2_P-B      atgcagtgga------actccaccactttccacctaactcttcaa---ga
KC792990_PreS2_P-B      atgcagtgga------actccaccacyttccaccaaacwctkcaa---ga
KC792925_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792778_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792660_PreS2_P-B      atgcagtgga------acaccaccactttccaccaaactcttcaa---ga
JX504543_PreS2_P-B      atgcagggga------tctccatcactttccaccaaactcttcaa---ga
FJ032358_PreS2_P-B      atgcggtgga------actcccccactttccaccaaactcttcaa---ga
AY167100_PreS2_P-B      atgcattgga------actccaccactttccaccaaactcttcaa---ga
MF674422_PreS2_P-B      atgcggtgga------actccaccactttccaccaaactcttcaa---ga
KC793121_PreS2_P-B      atgcagtgga------actccaccactttccaycaaactcttcaa---ga
KC793053_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792959_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792907_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
KC792888_PreS2_P-B      atgcagtgga------actcaaccackttccaccaaactcttcaa---ga
KC792875_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC792741_PreS2_P-B      atrcahtgga------acaccaccactttccaccaaactcttcaa---ga
GQ924646_PreS2_P-B      atacagtgga------actccaccactttccaccaaactctgcaa---ga
KX276807_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276804_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793150_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793137_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792852_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MF674426_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792943_PreS2_P-B      atacagtgga------actcaaccactttccaccaaactcttcaa---ga
KC792871_PreS2_P-B      atgcagtgga------actccmccactttccaccaaamtcttcaa---ga
KM875426_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KM875427_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KC793180_PreS2_P-B      atacagtkga------actccaccacyttccaccaaactcttcaa---ga
KC793126_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC792954_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC792901_PreS2_P-B      atacagtgga------actccaccactttccaccaaactctgcaa---ga
KC792782_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792665_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU939633_PreS2_P-B      gtgaagtgga------actccaccactttccaccaaactcttcaa---ga
DQ995803_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
FJ899784_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ899787_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU939672_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ899786_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ899785_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
X98077_PreS2_P-B        atgaagtgga------actccaccactttccaccaaactcttcaa---ga
KC793079_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793014_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792684_PreS2_P-B      atacagtgga------actccaccactttccatcaaactcttcaa---ga
FJ386669_PreS2_P-B      atgacccgga------actccaccactttccaccaaactcttcaa---ga
AB073824_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571334_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ790200_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173378_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793098_PreS2_P-B      atgcagtgga------actccacaactttccaccaaactcttcaa---ga
KC793030_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793006_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792977_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792963_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792952_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792933_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792885_PreS2_P-B      atrcagygga------actccaccactttccaccaaactcttcaa---ga
KC792839_PreS2_P-B      atgcagtgga------actccaccactttccacaaaactcttcaa---ga
KC792821_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792720_PreS2_P-B      atgcagtgga------actccmccactttccaccaaactcttcaa---ga
KC792657_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaacactkcaa---ga
JQ801474_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341594_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacacttcaa---ga
JN604149_PreS2_P-B      atgcagtgga------acagcaccactttccaccaaactcttcaa---ga
FJ386600_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306699_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY206375_PreS2_P-B      atgcagtgga------actccacaactttccaccaaactcttcaa---ga
AF121251_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793146_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacgcttcaa---ga
KC793132_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793058_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793033_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793025_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792969_PreS2_P-B      atacagtgga------acaccaccactttccaccaaactcttcaa---ga
KC792896_PreS2_P-B      atrcggtgga------actccaccactttccaccaaactcttcaa---ga
KC792883_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792879_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792648_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792678_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341576_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU357842_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964244_PreS2_P-B      atgcagtgga------actccgccactttccaccaaactcttcaa---ga
KU964251_PreS2_P-B      atgcagtgga------actccgccactttccaccaaactcttcaa---ga
KU964253_PreS2_P-B      atgcagtgga------actccgccactttccaccaaactcttcaa---ga
KU964254_PreS2_P-B      atgcagtgga------actccgccactttccaccaaactcttcaa---ga
KU964250_PreS2_P-B      atgcagtgga------actccgccactttccaccaaactcttcaa---ga
KU964252_PreS2_P-B      atgcagtgga------actccgccactttccaccaaactcttcaa---ga
KU964248_PreS2_P-B      atgcagtgga------actccgccactttccaccaaactcttcaa---ga
KU964255_PreS2_P-B      atgcagtgga------actccgccactttccaccaaactcttcaa---ga
KU964256_PreS2_P-B      atgcagtgga------actccgccactttccaccaaactcttcaa---ga
KU964246_PreS2_P-B      atgcagtgga------actccgccactttccaccaaactcttcaa---ga
KU964247_PreS2_P-B      atgcagtgga------actccgccactttccaccaaactcttcaa---ga
KU964249_PreS2_P-B      atgcagtgga------actccgccactttccaccaaactcttcaa---ga
KU964394_PreS2_P-B      atgcagtgga------actccgccactttccaccaaactcttcaa---ga
KC793138_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793027_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctacaa---ga
KC792945_PreS2_P-B      atgcagtgga------actccacmactttccaccaaactcttcag---ga
KC792898_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC792877_PreS2_P-B      rtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792783_PreS2_P-B      atgcggtgga------actccaccactttccaccaaactcttcaa---ga
KC792738_PreS2_P-B      atgcagtgga------ackccaccrctttccaccaaacacttcaa---ga
KC792697_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB073839_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571333_PreS2_P-B      atgcagtgga------actccaccacgtttcaccaaactcttcaa---ga
MF674465_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
KC792796_PreS2_P-B      atrcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792774_PreS2_P-B      atgcagtgga------actccacaactttccaccaaactcttcaa---ga
FJ787476_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---aa
AY766463_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY206391_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571326_PreS2_P-B      atgcagtgga------actccaccacyttccaccaaactcttcaa---ga
MG571329_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
KP406318_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406319_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406320_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406321_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406322_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406323_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406324_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406325_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406326_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406328_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406329_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406327_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406333_PreS2_P-B      atgcagtgga------actcaaccacttttcaccaaactcttcaa---ga
KP406332_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406330_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406334_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406331_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406335_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KJ173373_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793021_PreS2_P-B      atgcagtgga------actccaccaccttccatcaaactcttcaa---ga
KC792767_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341551_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386680_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
EU882003_PreS2_P-B      atgcagtgga------actccaccactttccacaaaactcttcaa---ga
KU964291_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964292_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---aa
KU964296_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964302_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964300_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964287_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964288_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964289_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964290_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964294_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964295_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964297_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964298_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964299_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964301_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KU964293_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
KC793020_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KC792772_PreS2_P-B      atgcagtgga------actccaccacattccaccaaactcttcaa---ga
GQ377606_PreS2_P-B      atacagagga------actccaccactttccaccaaactcttcaa---ga
EU881997_PreS2_P-B      atgcagtgga------actccaccgctttccaccaaactcttcaa---ga
AB555498_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571367_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571354_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
MG571323_PreS2_P-B      atgaaatgga------actccaccactttccaccaaactcttcaa---ga
KX276812_PreS2_P-B      atgcagtgga------actccaccackttccaccaaactcttcaa---ga
KX276790_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
KX276778_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793196_PreS2_P-B      atgcaatgga------actccacaactttccaccaaactcttcaa---ga
KC793114_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacycttcaa---ga
KC793113_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793067_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctccaa---ga
KC793005_PreS2_P-B      atgcagtgga------acaccaccactttccaccaaactcttcaa---ga
KC792903_PreS2_P-B      atgcagtgga------actccaccagtttccaccaaactcttcaa---ga
KC792894_PreS2_P-B      atgcagwgga------actccaccactttccaccaaactcttcaa---ga
KC792719_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC792666_PreS2_P-B      atgcagtgga------actccaccackttccaccaaactcttcaa---ga
KC792661_PreS2_P-B      atgcagtgga------actcaaccactttccaccaaactcttcaa---ga
JQ341606_PreS2_P-B      atgcagtgga------actccaccacrttccaccaaactcttcaa---ga
JQ341552_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377567_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377550_PreS2_P-B      atgcagagga------actccaccactttccaccaaactctgcaa---ga
EU939664_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU522072_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU487257_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EF494380_PreS2_P-B      atgcagtgga------gctccaccactttccaccaaactcttcaa---ga
AB073830_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcag---ga
KP406239_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406237_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406236_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406220_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406221_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406222_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406223_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406224_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406225_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406226_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406227_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406228_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406229_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406230_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406231_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406234_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406232_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406233_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406235_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406242_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406243_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406238_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406240_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP406241_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KJ173371_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173372_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KM213036_PreS2_P-B      atgcagtgga------actccaccactttccaccagactcttcaa---ga
KJ717796_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctctgcta---ga
KC793023_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792985_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792964_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
KC792892_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792814_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JN604224_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
HM011473_PreS2_P-B      atgcagtgga------acwccaccackttccaccaaactcttcaa---ga
KJ173368_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctctgcta---ga
KF053163_PreS2_P-B      atgcggtgga------actccaccactttccaccaaactcttcaa---ga
KJ803756_PreS2_P-B      atgcggtgga------actccaccactttccaccaaactcttcaa---ga
KC793152_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC793052_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
KC792916_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792698_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX504531_PreS2_P-B      gtgaagtgga------accccaccactttccaccaaactcttcaa---ga
JQ027330_PreS2_P-B      atgcagtgga------actccaccactytccaccaaactcttcaa---ga
JQ027331_PreS2_P-B      atgcagtgga------actccaccactytccaccaaactcttcaa---ga
FJ032357_PreS2_P-B      atgcggtgga------actcccccactttccaccaaactcttcaa---ga
EU939638_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY220698_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY206373_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB365445_PreS2_P-B      atgcagtgga------actcaacaactttccaccaaactcttcaa---ga
AB073836_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073832_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
KC793063_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
KC792849_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792813_PreS2_P-B      atgcagtgga------actccaacacgttccaccaaactcttcaa---ga
KC792809_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX429897_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386688_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ717813_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcta---ga
KJ803801_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcta---ga
KC793193_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
KC792967_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792703_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792702_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KC792649_PreS2_P-B      atgcagtgga------actccaccackttccaccaaactcttcaa---ga
EU939677_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792832_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792827_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792787_PreS2_P-B      atgcagtgga------acaccaccactttccatcaaactcttcaa---ga
KC792717_PreS2_P-B      gtgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JX661484_PreS2_P-B      atgcagtgga------actccaccactttccaccagactcttcaa---ga
FJ386636_PreS2_P-B      atgcagtgga------actctgccaatttccaccaaactcttcaa---ga
MG571375_PreS2_P-B      atgcagtgga------acgccaccactttccaccaaactcttcaa---ga
MG571373_PreS2_P-B      atgcaatgga------actccaccactttccaccaaactcttcaa---ga
MG571341_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KX276788_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964153_PreS2_P-B      atgcaatgga------actccaccactttccaccaaactcttcaa---ga
KP406277_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
KP148317_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793183_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793140_PreS2_P-B      atgcartgga------actccaccactttccaccaaactcttcaa---ga
KC793077_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792971_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
KC792955_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792935_PreS2_P-B      atgcagtgga------actccaccactttcctccaaactcttcaa---ga
KC792913_PreS2_P-B      atgcagtgga------actccacaactttccaccaaactcttcaa---ga
KC792855_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX507213_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341556_PreS2_P-B      atgcagtgga------actccacaactttccaccaaactcttcaa---ga
FJ562311_PreS2_P-B      atgcagtgga------actccaccactttcmaccaaactcttcaa---ra
FJ386642_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386610_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU305547_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY596103_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY220704_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
AB073837_PreS2_P-B      atacattgga------aaccccccactttccaccaaactcttcaa---ga
KU963946_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793186_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793115_PreS2_P-B      atgcagtgga------actcaaccactttccatcaaactcttcaa---ga
KC793111_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793099_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793022_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792867_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792654_PreS2_P-B      atgcagtgga------actccaccactktccaccaaactcttcaa---ga
JX026881_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
HM011480_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562253_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562224_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386658_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB073841_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276810_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964245_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcac---ga
KM875420_PreS2_P-B      atgcagtgga------actccaccacctttcaacaaactcttcaa---ga
KC793106_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792978_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792749_PreS2_P-B      atgcagtgga------actccaccackttccaccaaactcttcaa---ga
JQ801494_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386634_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---aa
EU919171_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
EU522067_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AF121248_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
DQ993698_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
DQ993699_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
EU939679_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP406166_PreS2_P-B      atgaagtgga------acttccccacttttcaccaaactcttcaa---ga
KC793131_PreS2_P-B      atgcagtgga------attccaccacttttcatcaaactcttcaa---ga
KC793013_PreS2_P-B      atgcagtgga------actccaccactttcctccaaactcttcaa---ga
KC792763_PreS2_P-B      atrcagtgga------actccaccactttccaccaaactcttcaa---ga
AY167101_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
DQ993710_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KJ717831_PreS2_P-B      gtgcagtgga------actccaccactttccaccaagctctgcta---ga
KJ803817_PreS2_P-B      gtgcagtgga------actccaccactttccaccaagctctgcta---ga
JX504533_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
AY220703_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
KC792917_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792948_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964166_PreS2_P-B      gtgcagtgga------actccaccactttcctccaaactcttcaa---ga
KU964154_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964158_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964159_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964160_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964156_PreS2_P-B      atgcagtgga------actccaccactttcctccaaactcttcaa---ga
KU964157_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964161_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964163_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964165_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964168_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881721_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881722_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881723_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881724_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881725_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881726_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881727_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881728_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881729_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881730_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881731_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881732_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881733_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881734_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881735_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881740_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881741_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881745_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881746_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881747_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881752_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881753_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881756_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881757_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881759_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881760_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881761_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881778_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881779_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276808_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276777_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ410502_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173377_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793172_PreS2_P-B      atamagtgga------actccaccactttccaccaaactcttcaa---ga
KC793170_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793127_PreS2_P-B      atgcagtgga------actccrccactttccaccaaactcttcaa---ga
KC793086_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793045_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793029_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793002_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792980_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792974_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KC792960_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792949_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792910_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792889_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792841_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792836_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792819_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792754_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774412_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
JX661480_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
JX429911_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JQ801485_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
JQ341600_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341598_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ281247_PreS2_P-B      atgcagtgga------acaccaccactttccaccaaactcttcaa---ga
JQ281243_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JN604127_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562289_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
FJ386683_PreS2_P-B      atgcagtgga------cctccaccactgtccaccaaactcttcaa---ga
FJ386615_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU939665_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU882004_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU881998_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ993705_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ975271_PreS2_P-B      atgcagtgga------actccaccactttccaccagactcttcaa---ga
AY217362_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
AP011084_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AF121247_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
AB287329_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571325_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173366_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---gg
KF053192_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctccaa---ga
KJ803763_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctccaa---ga
KC793031_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792915_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
JQ040138_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
HM011474_PreS2_P-B      atacggtgga------actccaccactttccaccaaactcttcaa---ga
AF121250_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB642094_PreS2_P-B      atgcagtgga------actcaaccactttccaccaaactcttcaa---ga
MG571346_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470962_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148322_PreS2_P-B      atgcagtgga------acaccaacactttccaccaaactcttcaa---ga
KJ173386_PreS2_P-B      atgaagtgga------actccaccactttccaccaaactcttcaa---ga
KC793073_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792944_PreS2_P-B      atgcggtgga------actccaccactttccaccaaactcttcaa---ga
KC792674_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774415_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ801506_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341563_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY217359_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KM875421_PreS2_P-B      atgcaatgga------actccaccacttttcaacaaactcttcaa---ga
KC793065_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792973_PreS2_P-B      atgcagtgga------actccaccackttccaccaaactcttcaa---ga
KC792820_PreS2_P-B      attcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774396_PreS2_P-B      atgcagtgga------actccaccactttccaccagactcttcaa---ga
EU919172_PreS2_P-B      atgcagtgga------actcccccactttccaccaaactcttcaa---ga
MG571361_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
KJ173374_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793018_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
GQ377610_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073821_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562237_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173343_PreS2_P-B      atgcagtgga------actccaccacttttcatcaaactcttcaa---ga
KJ173345_PreS2_P-B      atgcagtgga------actccaccacttttcatcaaactcttcaa---ga
EU919175_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU919176_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571350_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MF674503_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964164_PreS2_P-B      atgcagtgga------actccacaactttccaccaaactcttcaa---ga
KU963948_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963955_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KR232337_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148357_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148324_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KM875418_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KM875416_PreS2_P-B      atgcagtgga------actccacaactttccaccaaaatcttcaa---ga
KM392084_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KM392072_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KF053189_PreS2_P-B      atgcagtgga------actccaccactgtccaccaaactcttcaa---ga
KJ803783_PreS2_P-B      atgcagtgga------actccaccactgtccaccaaactcttcaa---ga
KC793178_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793101_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792932_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792919_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792906_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792874_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774410_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774403_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
KC774401_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774398_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
KC774377_PreS2_P-B      atgcagtgga------actccaccacattccaccaaactcttcaa---ga
KC774368_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774367_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
JX661474_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341570_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341569_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341568_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341564_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341549_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JN604146_PreS2_P-B      atgcagtgga------actccacaactttccaccatactcttcaa---ga
GU815779_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815722_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU434372_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377558_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562322_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562316_PreS2_P-B      atgcagtgga------actccaccactttccaccaatctcttcaa---ga
FJ518812_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386676_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386655_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
FJ386582_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
EU796068_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU564826_PreS2_P-B      atgcagtgga------actccaccactttccacaaaactcttcaa---ga
EU522074_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU439021_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU439020_PreS2_P-B      atgcagtgga------actccaccgctttccaccaaactcttcaa---ga
EU306677_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ993709_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY217360_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB246339_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
AB287328_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
AB205120_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073840_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173403_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173404_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MF674512_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148314_PreS2_P-B      gtgcggtgga------actccaccactttccaccaaactcttcaa---ga
KP036970_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793198_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX429910_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341573_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
GU815713_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ924648_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
GQ377582_PreS2_P-B      atgcagtgga------actccaccacttttcaccaaactcttcaa---ga
EU919173_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
KP148326_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX869998_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB246340_PreS2_P-B      atgcagtgga------actccaccactttccaccagactcttcaa---ga
EU939559_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793064_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341550_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815780_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU305548_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ448624_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276803_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793144_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
KC793091_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792934_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774416_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774409_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774405_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774404_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774376_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510646_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341591_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ281177_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ281156_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ924634_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ448622_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AJ627225_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
AB073831_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774406_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
KC792899_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX276773_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AF279464_PreS2_P-B      atgaagtgga------actcccccactttccaccaaactcttcaa---ga
GU815611_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815610_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815608_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815607_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815602_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815596_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815587_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815581_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815579_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815583_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815585_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815586_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815588_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815589_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815590_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815591_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815593_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815594_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815595_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815597_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815598_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815599_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815600_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815601_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815603_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815604_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815605_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815606_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815609_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815612_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815613_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815614_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GU815584_PreS2_P-B      atgcagtgga------actccaccaccttccaccaaactcttcaa---ga
GQ924644_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ924607_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341609_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MF674485_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU451682_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MF674480_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EF134945_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EF134946_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU158263_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ924631_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341579_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793165_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KF053171_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KJ803764_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KC792972_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792909_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792685_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792667_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774417_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774408_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793082_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774375_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774372_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774371_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774365_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510652_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX661470_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792984_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815733_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815729_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815720_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815718_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815712_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815716_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815717_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815719_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815724_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815725_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815739_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU882002_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173397_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173398_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ141619_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY596109_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ801514_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571356_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY167089_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ448620_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX661481_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510641_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510647_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774366_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774373_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774395_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774407_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774411_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774419_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792731_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793062_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KX765856_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MK075117_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963980_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX661475_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073826_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963976_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963977_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963978_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963986_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963987_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963979_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY293309_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU434373_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ040173_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963981_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963982_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963983_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963984_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963985_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963988_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963989_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963841_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963833_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963828_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963830_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963831_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963832_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963834_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963835_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963836_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963837_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963838_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963839_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963840_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963855_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963829_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792823_PreS2_P-B      atacagtgga------actccaccactttccaccaaactcttcaa---ga
GU815773_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815776_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815783_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815777_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815774_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815772_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815775_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815781_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815782_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964155_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964162_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964167_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ717830_PreS2_P-B      atgcagtgga------actccaccactttccaccaagctctgcta---ga
KC792864_PreS2_P-B      rtgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774400_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
EU939666_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ141615_PreS2_P-B      atgcaatgga------actccaccactttccaccaaactcttcaa---ga
GU815710_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815709_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815699_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815701_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815702_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KF053159_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ803752_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ412092_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ801479_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306678_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306681_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470960_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470961_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470956_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470954_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963962_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KU963963_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KU963951_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963949_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963816_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148365_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
KP148361_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148330_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KM392083_PreS2_P-B      atgcagtgga------actccagcactttccaccaaactattcaa---ga
KJ173422_PreS2_P-B      atgcagtgga------actccaccgctttccaccaaactcttcaa---ga
KJ173423_PreS2_P-B      atgcagtgga------actccaccgctttccaccaaactcttcaa---ga
KJ173418_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173419_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173367_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173363_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173364_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173360_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793168_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792994_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792858_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792854_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
KC792714_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774394_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510653_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510643_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX661479_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX661476_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX661471_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ801512_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
JQ341593_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341578_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341565_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
JQ341558_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815778_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815770_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815747_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815748_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815735_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815728_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815711_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815657_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815639_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815634_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815620_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815621_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815617_PreS2_P-B      atgcagtgga------actccaccactttccacaaaactcttcaa---ga
GU815622_PreS2_P-B      atgcagtgga------actccaccactttccacaaaactcttcaa---ga
GQ924603_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacacttcaa---ga
GQ475340_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377641_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377638_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377625_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377561_PreS2_P-B      atgcagtgga------actccaacactttccaccaaactcttcaa---ga
GQ377519_PreS2_P-B      atgcagtgga------actccagcactttccaccaaactcttcaa---ga
FJ562231_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562222_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386654_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386584_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
EU570069_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU439023_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcctcaa---ga
EU439022_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EF473973_PreS2_P-B      atgcaatgga------actccaccactttccaccaaactcttcaa---ga
DQ448628_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
D00330_PreS2_P-B        atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY518556_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AF282918_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
X97851_PreS2_P-B        atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB471854_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
AB073828_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
DQ993697_PreS2_P-B      atgcagtgga------attccaccactttccaccaaactcttcaa---ga
GU815743_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815741_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815734_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815723_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815715_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815726_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815736_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815738_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815744_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815745_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815746_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815761_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815764_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815760_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815756_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815752_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB205119_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815749_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815750_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815751_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815753_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815754_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815757_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815759_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815762_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815765_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815766_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815767_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815768_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815769_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815771_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510650_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815755_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815727_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815721_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815730_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815731_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815732_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815737_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815740_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815742_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815706_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815707_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815680_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY596102_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815679_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815683_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815684_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815685_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815686_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815687_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815688_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815689_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815691_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815692_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815693_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815694_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815695_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815696_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815697_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815698_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815700_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815703_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815704_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815705_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815708_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510649_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC774399_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815681_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY470953_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963970_PreS2_P-B      atgcggtgga------actccaccactttccaccaaactcttcaa---ga
KC510654_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX429902_PreS2_P-B      atgcggtgga------actccaccactttccaccaaactcttcaa---ga
GQ377569_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377537_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
KC792784_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
KC792856_PreS2_P-B      atgcagtgga------actccaccactttccatcaaactcttcaa---ga
EU306679_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU306680_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377566_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815651_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815653_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ141616_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ141617_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EF473975_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU964103_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148356_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AF100309_PreS2_P-B      gtgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571369_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571365_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571347_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MF674427_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963968_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963967_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963964_PreS2_P-B      atgcagtgga------actccaccacgttccaccaaactcttcaa---ga
KU963960_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963961_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963965_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963966_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963969_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963971_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963972_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963973_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963974_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963975_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963945_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963947_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963950_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963952_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963953_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963954_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963956_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963957_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963958_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KU963959_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148363_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148331_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148329_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148328_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148321_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ410516_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173420_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173421_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173416_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
KJ173417_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctgcaa---ga
KJ173411_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
KJ173412_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
KJ173405_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173406_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173409_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173410_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148319_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148320_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148323_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148327_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148332_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148333_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148335_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148359_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148360_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148362_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148364_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KP148366_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173381_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173382_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173413_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173414_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173415_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173369_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173365_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173359_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793102_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactctccaa---ga
KC793085_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792912_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792798_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792795_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792756_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510660_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510642_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510648_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX869999_PreS2_P-B      atgcaatgga------actccaccactttccaccaaactcttcaa---ga
JX661477_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC492739_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX429908_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX429900_PreS2_P-B      atgcagtgga------actccaccactttccaccaaacccttcaa---ga
JX429899_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ801471_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ412090_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341575_PreS2_P-B      atgcagtgga------actcaaccactttccaccaaactcttcaa---ga
JQ040171_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ040170_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JN604122_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JF412801_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815678_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815670_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815663_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815658_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815656_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815650_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX507215_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815633_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815626_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815619_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815618_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ924653_PreS2_P-B      atgcagtgga------actccaacactttccaccaaactcttcaa---ga
GQ924608_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510659_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377643_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377639_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377612_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377587_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173387_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173388_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377568_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ787444_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386684_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386666_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU570070_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU570071_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ993707_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ993704_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ993706_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ448627_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ448625_PreS2_P-B      atgcagtgga------acttcaccactttccaccaaactcttcaa---ga
AF121249_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU350409_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386668_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792828_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571368_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AF121244_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AF121243_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AF121245_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AF121246_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ924627_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510656_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB471855_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
DQ993703_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
GQ377547_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
KC792895_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
KC793105_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcag---ga
AB195933_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AF479684_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073834_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AF100308_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AY167097_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ141620_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ448621_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ448623_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ448626_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ993708_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
EU439018_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ924611_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815623_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815624_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815632_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815646_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815647_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815648_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815649_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815652_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815654_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815659_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815660_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815661_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815662_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815664_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815665_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815666_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815667_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815668_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815669_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815672_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815673_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815674_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815675_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815676_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815677_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JF899335_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JN406371_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ040125_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341574_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341583_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ688405_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ801507_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX661472_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792747_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC792993_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793167_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC793176_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173339_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173340_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173352_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173354_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173399_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173400_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173407_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ173408_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ410490_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KJ410517_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MF674450_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571340_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571371_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073822_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ377588_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
AB073827_PreS2_P-B      atgcagtgga------aytccaccactttccaccaaactcttcaa---ga
GU815616_PreS2_P-B      atgtagtgga------actccaccactttccaccaaactcttcaa---ga
GU815635_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ562254_PreS2_P-B      atgcagtgga------actccaccgctttccaccaaactcttcaa---ga
GU815640_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815644_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815643_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815642_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815638_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815625_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815627_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815628_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815629_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815630_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815631_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815636_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815637_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815641_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GU815645_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JN604124_PreS2_P-B      atgcagtgga------actccaccgctttccaccaaactcttcaa---ga
KC792981_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KM875417_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571360_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
FJ386660_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KY881796_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510657_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
MG571322_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX978431_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JX661473_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
JQ341584_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
DQ448619_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
GQ924605_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
KC510644_PreS2_P-B      atgcagtgga------actccaccactttccaccaaactcttcaa---ga
                                                                          

AB048705_PreS2_P-B      tcccagagtaaggggtctgtattttcctgctggtggctccagttccggaa
KC793066_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
KP659249_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggga
AB287323_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP659239_PreS2_P-B      ccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP659248_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggga
AB287325_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB287321_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagtttaggaa
DQ463795_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP659238_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ463791_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ463797_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN792895_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ463789_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN792896_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN792901_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggga
JN792902_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggga
AB287320_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP659244_PreS2_P-B      tcccagagtcagggctctgtatttccctgctggtggctccagttcaggga
DQ463799_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ463802_PreS2_P-B      ttccacagtcaggactctgaaccttcctgctggtggctccagttcaggaa
KP659251_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
KP659245_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttccggga
DQ463787_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB287316_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggag
AB287318_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggag
KP659219_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggag
JN792894_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggca
DQ463793_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ463801_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN792893_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN792897_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ463800_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN792898_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ463798_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN792899_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ463796_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
DQ463792_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN792900_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ463788_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ463790_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
KP659240_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggga
KP659250_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggga
KP659220_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggag
KP659253_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
KP659223_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggag
AB287322_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB287319_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggag
KP659255_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
KP659254_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggga
DQ463794_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
KP659224_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggag
KP659252_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggga
KP659234_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP659235_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
KP659246_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
KP659237_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
KP659247_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
AB287314_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggag
AB287315_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggag
AB287317_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggag
KX276962_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
HM011499_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
KX276858_PreS2_P-B      tcccagagtcagggctctgtacyttcctgctggtggctccagttcmgraa
HM011469_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KX276822_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
HM011487_PreS2_P-B      tcccagagtccgggctctgtactttcctgctggtggctccagttcaggaa
KX276996_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KX276821_PreS2_P-B      tccgagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KJ717840_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KJ803824_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141626_PreS2_P-B      tcccagagtcagggctctgttccttcctgttggtggctccagttcaggaa
KX276830_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KX276814_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcagaaa
KX276825_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KX276828_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KX276970_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ924617_PreS2_P-B      taccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141631_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggcggctccagttcaggaa
GQ924621_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KX765854_PreS2_P-B      tcccagagtcagggctctatactttcctgctggtggctccagttcaggaa
KJ717798_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
DQ141642_PreS2_P-B      tcccgtagtcagggctctgtaccttcctgttggtggctccagttcaggaa
LC349879_PreS2_P-B      tcccagggtcagggctctgtacagtcctgctggtggctccagttcaggaa
KX276829_PreS2_P-B      tccmagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KJ717835_PreS2_P-B      tcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
KJ803819_PreS2_P-B      tcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
KF053191_PreS2_P-B      tcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
KJ803786_PreS2_P-B      tcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
DQ141635_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
KX276818_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
HM011492_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB493833_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
JQ341607_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KJ717807_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KJ803796_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ429081_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
HM011490_PreS2_P-B      tcccagagtcagggctctgtatcttcctgctggtggctccagttcaggaa
DQ141636_PreS2_P-B      tccgagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141638_PreS2_P-B      ttccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
KX276823_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
FJ023637_PreS2_P-B      tccaagagtcagggcgctgtactttcctgctggtggctccagttcaggaa
KF053162_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KF053165_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KJ803755_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KJ803758_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ341597_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ341599_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141640_PreS2_P-B      ttccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
HQ700548_PreS2_P-B      ttccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
DQ141634_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141637_PreS2_P-B      tccgagagtcagggctctgtactttcctgctggtggctccagttcaggaa
LC349870_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
D00331_PreS2_C-B        tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141624_PreS2_P-B      tccgagagtcagggcgctgtactttcctgctggtggctccagttcaggaa
DQ141625_PreS2_P-B      tccgagagtcagggcgctgtactttcctgctggtggctccagttcaggaa
LC349874_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KF053190_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
KJ803784_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
GQ358136_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB033554_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB713529_PreS2_P-B      ccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB713530_PreS2_P-B      ccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
LC349872_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
LC349875_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ429082_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
DQ141633_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
DQ141630_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141627_PreS2_P-B      ccccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
AB033555_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
LC349873_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141628_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
LC349869_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB219430_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB493835_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AP011085_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141629_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagtttaggaa
DQ141632_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141623_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcagaaa
KJ717792_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
KJ803787_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
EF473971_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141622_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcagaaa
EF473972_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcagaaa
M54923_PreS2_P-B        tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ924641_PreS2_P-B      tcctcgagtcagggctctgtaccttcctgctggtggctccagttcaggaa
KX276817_PreS2_P-B      tcctcragycagggctctgtaccttcctgctggtggctccagttcaggaa
KX276827_PreS2_P-B      tcctcgtgtcagggctctgtactttcctgctggtggctccagttcaggaa
KX276819_PreS2_P-B      tcctcgagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ924660_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141641_PreS2_P-B      tcccagggtcaaggctctgtactttcctgctggtggctccagttcaggaa
DQ141654_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
JQ027311_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU660230_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU660231_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU660232_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU660233_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
HM011467_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
GQ924645_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141643_PreS2_P-B      tccccgagtcagggcgctgtactttcctgctggtggctccagttcaggaa
JN604123_PreS2_P-B      tcctcgagtcagggctctgtactttcctgctggtggctccagttcaggaa
HM011496_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148457_PreS2_P-B      tccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
KP148458_PreS2_P-B      tccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
KP148460_PreS2_P-B      tccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
KP148455_PreS2_P-B      tccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
KP148453_PreS2_P-B      tccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
KP148452_PreS2_P-B      tccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
KP148456_PreS2_P-B      tccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
KP148459_PreS2_P-B      tccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
KP148461_PreS2_P-B      tccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
JQ027334_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
JN604141_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB219429_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB219427_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AP011086_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AP011087_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB241117_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB219426_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB219428_PreS2_C-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ924624_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ924640_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
KY881955_PreS2_P-B      tccaagggtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881952_PreS2_P-B      tccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
KY881944_PreS2_P-B      tccaagggtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881957_PreS2_P-B      tccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
KY881953_PreS2_P-B      tccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
KY881949_PreS2_P-B      tccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
KY881950_PreS2_P-B      tccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
KY881945_PreS2_P-B      tccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
KY881947_PreS2_P-B      tccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
KY881951_PreS2_P-B      tccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
KY881956_PreS2_P-B      tccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
KY881958_PreS2_P-B      tccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
KY881948_PreS2_P-B      tccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
KY881946_PreS2_P-B      tccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
KY881954_PreS2_P-B      tccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
KP148419_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148427_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148426_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148437_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148438_PreS2_P-B      tccaagagtcagggctctgtaccctcctgctggtggctccagttcaggaa
KP148420_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148407_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148433_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148406_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148440_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148435_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148424_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148410_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148432_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148418_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148439_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148430_PreS2_P-B      tctaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148429_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148414_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148425_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148421_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148416_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148411_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148409_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148405_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148413_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148415_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148423_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148373_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148377_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148391_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148387_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggccccagttcaggaa
KP148398_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggccccagttcaggaa
KP148380_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148376_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148374_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148371_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148367_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148401_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148400_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148402_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148394_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcagaaa
KP148384_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148383_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148379_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148369_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148375_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148451_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148368_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148385_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148386_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148370_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148372_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148378_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148382_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148388_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148389_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148390_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148392_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148395_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148396_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148397_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148399_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148403_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ924635_PreS2_P-B      tccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
EU330995_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
FJ023638_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU330989_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU330990_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU330994_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU330996_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU330997_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU330998_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU330999_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU330992_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU331000_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EU331001_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ924638_PreS2_P-B      tcatcgagtcagggatctgtactttcctgctggtggctccagttcaggaa
GQ924639_PreS2_P-B      tcctcgagtcagggctctgtactttcctgctggtggctccagttcaggaa
KX276820_PreS2_P-B      tcctcgagtcagggctctgtactttcctgctggtggctccagttcaggaa
KX276815_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141646_PreS2_P-B      tcctcgagtcagggctctgtaccttcctgctggtggctccagttcaggaa
DQ141651_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggac
DQ141655_PreS2_P-B      tccgagagtcagggctctgtactttcctgctggtggctcccgttcaggaa
GQ358144_PreS2_P-B      tccgagagtcagggctctgtactttcctgctggtggctcccgttcaggaa
GQ358147_PreS2_P-B      tccgagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ358145_PreS2_P-B      tccgagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ358146_PreS2_P-B      tccgagagtcagggctctgtactttcctgctggtggctccggttcaggaa
LC416037_PreS2_P-B      tccccgagtcaaggctctgtactttcctgctggtggcttatgttaaagag
AY800391_PreS2_P-B      tcccagggtcagggctctgtactttcctgctggtggctccagttcaggaa
AY800392_PreS2_P-B      tcccagggtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ924656_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
AB713528_PreS2_P-B      tccccgagtcagggctctgtacttccctgctggtggctccagttcaggaa
KC774418_PreS2_P-B      tcccagggtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ027316_PreS2_P-B      tccccgagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ341590_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
AP011094_PreS2_P-B      ccccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
JQ341554_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141639_PreS2_P-B      ccccagagtcagggcgctgtactttcctgctggtggctccagttcaggaa
AP011089_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
DQ141647_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggac
AP011093_PreS2_P-B      ccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ358148_PreS2_P-B      ccccagagtcagggcgctgtactttcctgctggtggctccagttcaggaa
GQ358149_PreS2_P-B      ccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ358151_PreS2_P-B      ccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ358152_PreS2_P-B      ccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ358150_PreS2_P-B      ccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AP011096_PreS2_P-B      ccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AP011095_PreS2_P-B      ccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AP011092_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ358142_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141653_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
EF473977_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ924651_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ924654_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ358140_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
AP011088_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ358143_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141649_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
DQ141650_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
EF473976_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
GQ358139_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
DQ141648_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
HQ700549_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
GQ358137_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
GQ358138_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
DQ141652_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
AP011091_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
AP011090_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
GQ358141_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
AB713532_PreS2_P-B      tccccgagtcagggctctgtactttcctgctggtggctccagttcaggaa
KJ717841_PreS2_P-B      tcccagagtcagggctctgtactttactgttggtggctccagttcaggaa
LC349877_PreS2_P-B      tccccgagtcagggctctgtaccttcctgctggtggctccagttcaggag
GQ924625_PreS2_P-B      tccccgagtcagggctctgtactttcctgctggtggctccagttcaggaa
LC349868_PreS2_P-B      tccccgagtcagggctctgtacctccctgctggtggctccagttcaggaa
LC349878_PreS2_P-B      tccccgagtcagggctctgtaccttcctgctggtggctccagttcaggaa
DQ141644_PreS2_P-B      tccccgagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ924637_PreS2_P-B      tcctcgagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB713527_PreS2_P-B      tccccgagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB493827_PreS2_P-B      tccccgagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB713531_PreS2_P-B      tccccgagtcagggctctgtactttcctgctggtggctccagttcaggaa
LC349871_PreS2_P-B      tcctcgagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ924628_PreS2_P-B      tccccgagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB976562_PreS2_P-B      tcctcgagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ141645_PreS2_P-B      tcctcgagtcagggctctgtactttcctgctggtggctccagttcaggaa
KX276824_PreS2_P-B      tcctcgagtcagggctctgtactttcctgctggtggctccagttcaggaa
HM011466_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagraa
KJ717829_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KJ803816_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
DQ993694_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ993687_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281161_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MG826152_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281221_PreS2_P-B      tcccagagtcagggctctgtacdttcctgctggtggctccagttccggaa
DQ993684_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ281258_PreS2_P-B      tcccagagtcagggcyctgtaytttcctgctggtggctccagttcaggaa
JQ281207_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281239_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281152_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN604132_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN604219_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281244_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281248_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281164_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN604234_PreS2_P-B      tcccagagtcagagctctgtactttcctgctggtggctccagttcaggaa
JQ281137_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB117759_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ993686_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ707740_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707747_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707739_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707755_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707767_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707762_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707750_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707749_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707745_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707735_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707734_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707737_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707738_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707742_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707743_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707744_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707746_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707753_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707758_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707759_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707763_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707765_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707766_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707764_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
MF674492_PreS2_P-B      tcccagagtcagggctctgtacgttcctgctggtggctccagttcaggaa
JQ281133_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ993682_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ993683_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB073835_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ993680_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ993685_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
DQ993681_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY629635_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KJ173401_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KJ173402_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY629636_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KC774369_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KC774370_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674464_PreS2_P-B      tcccagagtaagggctctgtattttcctgctggtggctccagttcaggaa
JQ281240_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcagraa
JQ281171_PreS2_P-B      tcccagagtcagggctctgtacyttcctgctggtggctccagttcaggaa
JQ281158_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281131_PreS2_P-B      ycccagagtcagggctctgtactctcctgctggtggctccagtttaggaa
JQ281252_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281193_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ707760_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ707757_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707761_PreS2_P-B      tcccagagtcagggctctgtatcctcctgctggtggctccagttcaggaa
JQ707751_PreS2_P-B      tcccagagtcagggatctgtattttcctgctggtggctccagttcaggaa
JQ707754_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707736_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707748_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707752_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707756_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ707741_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
MF674446_PreS2_P-B      tccaagggtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281160_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281153_PreS2_P-B      gccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281150_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
AB031267_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
MF674419_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
JQ341604_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281190_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674440_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ341605_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281241_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
JQ281170_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281157_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674396_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF621878_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281236_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
JQ281148_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281132_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281129_PreS2_P-B      tcccagagtaagggctctgtactttcctgctggtggctccagttcaggaa
JN604212_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AY517489_PreS2_P-B      tcccaaagtcagggctctgtacttccctgctggtagctccagttcaggaa
AY517619_PreS2_P-B      tcccaaagtcagggctctgtacttccctgctggtggctccagttcaggaa
JQ281144_PreS2_P-B      tccaagagtcagggctctatactttcctgctggtggctccagttcaggaa
JQ281138_PreS2_P-B      tccaagagtcagggctctctactttcctgctggtggctccagttcaggaa
JQ281134_PreS2_P-B      tcccmgagtcagggctctgtactttcctgctggtggctccagttcaggaa
LT992442_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674479_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggga
JQ341596_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ341585_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281255_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281238_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ281196_PreS2_P-B      tcccagagtcagggstctgtactttcctgctggtggctccagttcaggaa
MF674439_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674473_PreS2_P-B      taccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674389_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
KX765841_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281214_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB212626_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
MF674436_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674385_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
AB212625_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674491_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674478_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281224_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281163_PreS2_P-B      tcccaaagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674415_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ341601_PreS2_P-B      tccaagggtcagggctctgtacttccctgctggtggctccagttcaggaa
JQ281253_PreS2_P-B      ccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281229_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281151_PreS2_P-B      tccaagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JN604221_PreS2_P-B      tcccaragtcagggctctgtactttcctgctggtggctccagttcaggaa
AB231909_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB205122_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcagaaa
MF674462_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674392_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281154_PreS2_P-B      tccgagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB368295_PreS2_P-B      tccccgagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674508_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674456_PreS2_P-B      tcccagagtaagggcgctgtactttcctgctggtggctccagttcaggaa
MF674432_PreS2_P-B      tcccagagtcacggctctacactaccctgctggcgggtccagttcagaaa
JQ281242_PreS2_P-B      tccmagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN604138_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ341608_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
JQ281195_PreS2_P-B      tcccagagtcagggctctgtacyttcctgctggtggctccagttcaggaa
MF674409_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281225_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttccggaa
JQ281218_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281188_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281167_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281141_PreS2_P-B      tccaagagtcagggctctatactttcctgctggtggctccagttcaggaa
JN604143_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
FJ023636_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB115551_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
MF674416_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagtttaggaa
JN604244_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674434_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ341580_PreS2_P-B      tcccaaagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ924626_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674461_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674460_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674441_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281159_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN604213_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
JQ281234_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagtttaggaa
AY033073_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
MF674414_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281237_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281231_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281194_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281227_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281168_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674476_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674481_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674459_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674420_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ341589_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281222_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281165_PreS2_P-B      tcccagagtcagggctctttactttcctgctggtggctccagttcaggaa
AB100695_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
MF674448_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
FJ023632_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
HQ700546_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674423_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674495_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674490_PreS2_P-B      tccgagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281230_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281149_PreS2_P-B      tccgagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674505_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674496_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674466_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcagaaa
MF674445_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674424_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggcttcagttcaggaa
MF674407_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674406_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674404_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674387_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674382_PreS2_P-B      tcccagagtcagggctctatactttcctgctggtggctccagttcaggaa
JQ281226_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcagraa
JQ281217_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281197_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281185_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281180_PreS2_P-B      ccccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JN604223_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN604119_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
FJ023634_PreS2_P-B      tcccagagtcagggctctatactttcctgctggtggctccagttcaggaa
JQ281216_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281204_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281192_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281181_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674401_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674482_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674500_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674433_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281220_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674513_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281210_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN604253_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN604125_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281200_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674393_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674394_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674395_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674413_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674452_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674510_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674507_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674443_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AY033072_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281208_PreS2_P-B      tcccagagtcagggctctatactttcctgctggtggctccagttcaggaa
JQ281202_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281203_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674515_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674497_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674487_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674470_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674469_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674438_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674437_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674493_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674421_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ341603_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcargaa
JQ341588_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281257_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281249_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281254_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281245_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281235_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281205_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281189_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281166_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281143_PreS2_P-B      tccaagagtcagggctctgtattttcctgctggtggctccagttcaggaa
JQ281140_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
FJ023635_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
FJ023633_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674447_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281256_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674511_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674477_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674455_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281213_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674383_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281199_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281212_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281228_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674400_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674405_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674499_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674488_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281147_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccggttcaggaa
JQ281187_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281209_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281139_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281179_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674509_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674498_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674453_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674451_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674410_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KU234318_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674483_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281186_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281178_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281184_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281172_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281176_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674384_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674397_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
FJ349236_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN604154_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JN604284_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281215_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281223_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281246_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MF674431_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281211_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KC792950_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggra
KC792946_PreS2_P-B      tcccagagtcagggccctgtaytttcctgctggtggctccagttcaggaa
KC792840_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagraa
KC792997_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
MG571366_PreS2_P-B      --ccaaagtcagggccctgtaccttcctgctggtggcttcagttcaggaa
KC792846_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792859_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386608_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571353_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
MG571376_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
KJ717837_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ803821_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY417926_PreS2_P-B      tcccagagtcagggccctctactttcctgctggtggctccagttcaggaa
EU570075_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
EU579441_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
EU589335_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ386656_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KX276802_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276791_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792663_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792992_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792937_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571331_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792865_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793181_PreS2_P-B      tcccagagacagggccctgtctcttcctgctggtggctccagttcaggaa
KC793161_PreS2_P-B      tcccagagtcagggcccwgtactttcctgctggtggctccagttcaggaa
JQ341567_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792722_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792715_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
MG571321_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793191_PreS2_P-B      tcccagagtccgggccctgtactttcctgctggtggctccagttcaggaa
KC792794_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ717817_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KJ803805_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793092_PreS2_P-B      aaccagtgtcagggccctgaactctcctgctggtggctccagttcaggaa
MG571357_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
JQ281206_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
KU964381_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964382_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964383_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964384_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964385_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964388_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964391_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964393_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964395_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964397_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG372436_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
JQ801516_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792947_PreS2_P-B      tcccagagtcagagccctgtactttcctgctggtggctccagttcaggaa
KC792737_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793083_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792709_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
AY217368_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793094_PreS2_P-B      tcccagagtcagagccctgtactttcctgctggtggctccagttcaggaa
HM011475_PreS2_P-B      tcccagagtcagggccctgtacttycctgctggtggctccagttcagraa
AY167102_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC793164_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792788_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
KX276801_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406283_PreS2_P-B      nnnnnnnnnnagggccctgtactttcctgctggtggctccagttcaggaa
KJ717818_PreS2_P-B      tcccagagtccgggccctgtatcttcctgctggtggctccagttcaggaa
FJ562312_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
JX870001_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
AB073823_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792785_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KU964146_PreS2_P-B      tcccagagtcagggccctgtactttactgctggtggctccagttcaggaa
KU964138_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964140_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964142_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964144_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964145_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964147_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964148_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964150_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964151_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964152_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964139_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964141_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964143_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964149_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276779_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792957_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
JQ040147_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939675_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU564822_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
AY206390_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341577_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939676_PreS2_P-B      tcccagagtcagggccctgtatcttcctgctggtggctccagttcaggaa
JQ341581_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571337_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KM213034_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341592_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
HM011470_PreS2_P-B      tcccagagtcagggccctgcacgttcctgctggtggctccagttcaggaa
KJ410500_PreS2_P-B      tccccgagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793160_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341572_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792742_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
KC792729_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793001_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX504538_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JN827419_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470834_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470837_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470841_PreS2_P-B      tcccagagtcaggcccctgtactttcctgctggtggctccagttcaggaa
KY470833_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470832_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470840_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470835_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470836_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470839_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470838_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470830_PreS2_P-B      tcccagagtcagggccctgtgctttcctgctggtggctccagttcaggaa
KC793016_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU796071_PreS2_P-B      tcccagagtcagggccctgtaccatcctgctggtggctccagttcaggaa
AY206383_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815574_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815577_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815573_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815554_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815561_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815569_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815571_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815578_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815570_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815565_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggccccagttcaggaa
GU815567_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggccccagttcaggaa
GU815576_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggccccagttcaggaa
GU815560_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815557_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815550_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815549_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815548_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815558_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815562_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815563_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815572_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815575_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815551_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815552_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815553_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815555_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815556_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815559_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815564_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815566_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815568_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU595031_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ032349_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ386675_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KT749820_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU796067_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406287_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406285_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406289_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406292_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406286_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406284_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406294_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406291_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406281_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406282_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406293_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406311_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406304_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406305_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406312_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406314_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406301_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406298_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406317_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406306_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406307_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406308_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406309_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406310_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406313_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406315_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406316_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406288_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406290_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406303_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406302_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406297_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406296_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406295_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406299_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406300_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571370_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571348_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggga
KX276793_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793084_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792711_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993702_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ141618_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EF473974_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792982_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792797_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792755_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792736_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY800389_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
AB195934_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB195935_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571372_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU332695_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
DQ993700_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993701_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571364_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571328_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571344_PreS2_P-B      tcccagagtcagggccctgtatcttcctgctggtggctccagttcaggaa
KC793070_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
JQ027315_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276781_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793192_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792908_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
GQ924606_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073829_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377629_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306711_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ032352_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ032353_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ032354_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
GQ377525_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386682_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148334_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793089_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792938_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JN604311_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU139543_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148318_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793122_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562321_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AF282917_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB900110_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792735_PreS2_P-B      tcccagagtcagagccctgtactttcctgctggtggctccagttcaggaa
EU939663_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC792766_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386681_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571342_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148325_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792869_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792838_PreS2_P-B      tcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
JQ341566_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ924610_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU564823_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306710_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccaattcaggaa
EU306707_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306704_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
EU306703_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793010_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792872_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792893_PreS2_P-B      tcccagagtcagggccctgtactttcctgttggtggctccagttcaggaa
KU964079_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964081_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964084_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964085_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964086_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964089_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964090_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964091_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964080_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964082_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964083_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964087_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964088_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964092_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306709_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306700_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306701_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306702_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306706_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306708_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306712_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306705_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963852_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963842_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963843_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963844_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963845_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963846_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963847_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963848_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963849_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963850_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963851_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963853_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793153_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661482_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386583_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB300364_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774393_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792687_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MF674391_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661478_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173347_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173348_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JN604134_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510651_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MH663473_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MH061283_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571374_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963799_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963800_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963801_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963802_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963803_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963804_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963805_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963806_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963807_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963808_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963809_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963810_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963811_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963812_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963813_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ410507_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173424_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173425_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510658_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510655_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ924632_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377542_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU564824_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX507210_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793135_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KM359440_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MF674449_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB642101_PreS2_P-B      tcccaaagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB302095_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
AB073849_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB300371_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB900096_PreS2_P-B      tcccagagtcagggctctgtacctccctgctggtggctccagttcaggaa
AB287327_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB073847_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
AB931168_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB931169_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KC793156_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
AB900097_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
D50521_PreS2_P-B        tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
D50522_PreS2_P-B        tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
AB900107_PreS2_P-B      ccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB073854_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
AB014366_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
AB106884_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
AB073851_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
AB246343_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB900105_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcagaaa
AB362933_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB900095_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB073838_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
AB010292_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB900106_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB900111_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB073858_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
AB073843_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB010290_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
AB010291_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
JQ341571_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
AB828708_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
AB900103_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB073852_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB073842_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB900112_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB073844_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB073855_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB900102_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB900104_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
D23678_PreS2_P-B        tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB073856_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
AB900108_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB287326_PreS2_P-B      tcccagagtcagggctctctactttcctgctggtggctccagttcaggaa
AB073845_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB246342_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB246341_PreS2_P-B      tcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
AB073850_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB010289_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
D00329_PreS2_P-B        tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
D23679_PreS2_P-B        tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
MH932712_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB073848_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB073846_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB205121_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
LC279268_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
LC279269_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
LC279270_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
LC279271_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
LC279272_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
LC279273_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
AB642093_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KC793149_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagraa
KC793184_PreS2_P-B      wcccaragtcagggccctgtacyttcctgctggtggctccagttcaggaa
KC793162_PreS2_P-B      tcccaragtcagggccctgwaccttcctgctggtggctccagttcaggaa
KC792683_PreS2_P-B      tcccagagtcagggccctgyacyktcctgctggtggctccagttcaggaa
KX276796_PreS2_P-B      tcccaaastcagggccctgtacattcctgctggtggctccagttcaggaa
KC792808_PreS2_P-B      tcccagagtcagggccctgtacytycctgctggtggctccagttcagraa
FJ023631_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ141621_PreS2_P-B      tcccagagtcaggggcctgtactttcctgttggtggctccagttcaggaa
KX276772_PreS2_P-B      tcccagagtcagggccttgtactttcctgctggtggctccagttcaggaa
KX276782_PreS2_P-B      tccaagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881845_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881865_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881869_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881849_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881853_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881864_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG826153_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792837_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341561_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341587_PreS2_P-B      tcccagagtacgggccctgtactttcctgctggtggctccagttcaggaa
KC792800_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571336_PreS2_P-B      tccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KC793154_PreS2_P-B      tcccagagtcagagccctgtactttcctgctggtggctccagttcaggaa
KC793032_PreS2_P-B      tcccaragtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792976_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
HM011503_PreS2_P-B      ycccagagtcagggccctgtacwttcctgctggtggctccagttcaggaa
HM011471_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792829_PreS2_P-B      tcccagagtcaggaccctgtatcttcctgctggtggctccagttcaggaa
KU963815_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU963814_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU963817_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU963818_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU963819_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU963820_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU963821_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU963822_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU963823_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU963824_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU963825_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU963826_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU963827_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU963854_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KC792807_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
JQ341560_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881893_PreS2_P-B      tcccagagtcagggacctgtactttcctgctggtggctccagttccggaa
KY881847_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881851_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881863_PreS2_P-B      tcccagagtcagggccctgtgccttcctgctggtggctccagttcaggaa
KY881904_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881867_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881856_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881906_PreS2_P-B      tcccagagtcagggatctgtactttcctgctggtggctccagttcaggaa
KY881908_PreS2_P-B      tcccagagtcagggacctgtactttcctgctggtggctccagttcaggaa
KY881858_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881910_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881909_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881844_PreS2_P-B      ccccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881846_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881894_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881902_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881903_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881905_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881907_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881911_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881862_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881868_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccatttcaggaa
KY881861_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881857_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881848_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881866_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881852_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881854_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881859_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881901_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881900_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881895_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881897_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881898_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881855_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881860_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881899_PreS2_P-B      tcccagagtcagggccctgtacctttctgctggtggctccagttcaggaa
KY881912_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881913_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881896_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881914_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
EU939667_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173375_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173376_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073825_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KJ173298_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KJ173379_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MK052962_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MK052964_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MK052965_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571355_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148583_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcatgaa
KP148580_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173297_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JN604187_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562246_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148581_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148349_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggga
KP148348_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148342_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173362_PreS2_P-B      tcccagagtcagggccctgtactttcctgttggtggctccagttcaggaa
KJ173357_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341555_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306696_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ377158_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306695_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306697_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306698_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173351_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173353_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571349_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148582_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148579_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148343_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148340_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148338_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148336_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148339_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148341_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148344_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148345_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148346_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148347_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173361_PreS2_P-B      tcccagagtcagggccctgtactttcctgttggtggctccagttcaggaa
AB675676_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661483_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173355_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173356_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173389_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173390_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571362_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774402_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792805_PreS2_P-B      tcccagagtcagggccctgtactttcmtgctggtggctccagttcaggaa
KC792812_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX026883_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KX276771_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
EU939674_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ899790_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ899791_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KY881820_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881821_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881841_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881842_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881833_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881825_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctctagttcaggaa
KY881835_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881834_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881838_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881830_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881826_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881843_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881839_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881831_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881827_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881824_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881823_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881836_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881822_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881828_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881829_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KY881837_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
EU939637_PreS2_P-B      ccccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
EU939636_PreS2_P-B      tcccagagtcagggccctatacttccctgctggtggctccagttcaggga
KU964259_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964270_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964269_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964265_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964267_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964271_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964260_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964262_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964257_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964261_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964263_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964264_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964266_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964268_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ904357_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792689_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406253_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406245_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406249_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406244_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406246_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406248_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406252_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406254_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406247_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406250_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406251_PreS2_P-B      tcccagagtcaggaccctgtactttcctgctggtggctccagttcaggaa
KC793061_PreS2_P-B      tcccagagtcagggccctgtacgttcctgctggtggctccagttcaggaa
KF053180_PreS2_P-B      tcccagagtcagggccccgaaccttcctgctggtggctccagttcaggaa
KJ803773_PreS2_P-B      tcccagagtcagggccccgaaccttcctgctggtggctccagttcaggaa
KF053182_PreS2_P-B      tcccagagtcagggccctgaaccttcctgctggtggctccagttcaggaa
KJ803775_PreS2_P-B      tcccagagtcagggccctgaaccttcctgctggtggctccagttcaggaa
KY881808_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881787_PreS2_P-B      tcccagagtcggggccctgtactttcctgctggtggctccagttcaggaa
KY881794_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881799_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881791_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881785_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881800_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881797_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881786_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881783_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881795_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881781_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881784_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881850_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881793_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881790_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881789_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881788_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881782_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881780_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881798_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881801_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939669_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ899779_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964277_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964272_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964273_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964274_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964275_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964276_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964278_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964279_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964281_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964284_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964285_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964282_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964283_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964280_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964286_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406273_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KP406272_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KP406263_PreS2_P-B      tcccaaagtcagggccctgtacttccctgctggtggctccagttcaggaa
KP406257_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KP406275_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KP406262_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KP406276_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KP406279_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406271_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406269_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406260_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406266_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406258_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406264_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406268_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KP406265_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KP406280_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406274_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KP406255_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KP406270_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KP406278_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KC793096_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793036_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792699_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939670_PreS2_P-B      tcccagagtcagggccctgtacattcctgctggtggctccagttcaggaa
HM011477_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276795_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792718_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggcttcagttcaggaa
KC793041_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggag
KC793171_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792688_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792770_PreS2_P-B      tcccagagtcagggccctgtacagtcctgctggtggctccagttcaggaa
KP406179_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406190_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406212_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406216_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406194_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406182_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406176_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406177_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406178_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406180_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406181_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406183_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406184_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406185_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406203_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406188_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406195_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406200_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406217_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406186_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406191_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406193_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406196_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406198_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406201_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406202_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406204_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406205_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406206_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406207_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406209_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406211_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406213_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406215_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406218_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406187_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406189_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406192_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406197_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406199_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406208_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406210_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406214_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406219_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792761_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
HM011504_PreS2_P-B      tcccagagtcagggcyctgtactttcctgctggtggctccagttcaggaa
KC793104_PreS2_P-B      tcccagagtcagggccctataccttcctgctggtggctccagttcaggaa
KC774397_PreS2_P-B      tcccagagtcagggccctgtaccatcctgctggtggctccagttcagaaa
KC792791_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792768_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KM213035_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792842_PreS2_P-B      taccaaagtcagggccctgtaccttcctgctggtggctccagttcaggaa
AF461360_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KJ843165_PreS2_P-B      tccaagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792650_PreS2_P-B      tcccaragtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793177_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ787475_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC792887_PreS2_P-B      tcccagagtcagggccctgtatcttcctgctggtggctccagttcagaaa
KC792844_PreS2_P-B      ttccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341557_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagraa
KC792904_PreS2_P-B      tcccagagtcagggccctgtacrttcctgctggtggctccagttcaggaa
KX276784_PreS2_P-B      tcccagagtcagggctctatactttcctgctggtggctccagttcaggaa
KC792884_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792765_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792824_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792781_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793158_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793109_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793069_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
KC792958_PreS2_P-B      taccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792866_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
JX026879_PreS2_P-B      ccccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
HM011494_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ717842_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792789_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793175_PreS2_P-B      tcccagagtcagggccctgtrctttcctgctggtggctccagttcaggaa
KC792750_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341586_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ924647_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
HM011483_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793147_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939635_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774362_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX504532_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562259_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562236_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KU964258_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793048_PreS2_P-B      tccccgagtcagggccctgtactttcctgctggtggctccagttcagraa
KC793042_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792890_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
KC792930_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KU964118_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964115_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964112_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964114_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964116_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964119_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964121_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964108_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964109_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964110_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964122_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964111_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964113_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964120_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KM213032_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939671_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KF053174_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ803768_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939639_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KJ173341_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173342_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173385_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KC793055_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ562257_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562240_PreS2_P-B      tcccagagtcagggccctgtatcttcctgctggtggctccagttcaggaa
EU939673_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
KU964094_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964093_PreS2_P-B      tcccagagtcagggccctgaactttcctgctggtggctccagttcaggaa
KU964095_PreS2_P-B      tcccagagtcagggccctgaactttcctgctggtggctccagttcaggaa
KU964097_PreS2_P-B      tcccagagtcagggccctgaactttcctgctggtggctccagttcaggaa
KU964099_PreS2_P-B      tcccagagtcagggccctgaactttcctgctggtggctccagttcaggaa
KU964100_PreS2_P-B      tcccagagtcagggccctgaactttcctgctggtggctccagttcaggaa
KU964105_PreS2_P-B      tcccagagtcagggccctgaactttcctgctggtggctccagttcaggaa
KU964106_PreS2_P-B      tcccagagtcagggccctgaactttcctgctggtggctccagttcaggaa
KU964098_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964096_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964101_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964102_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964104_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964107_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792681_PreS2_P-B      tcccagagtcagggccctgtatcttcctgctggtggctccagttcaggaa
JQ040128_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY167093_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC774389_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774380_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774388_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774385_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
KC774381_PreS2_P-B      tccccgagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774379_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774391_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774390_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774386_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774387_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774383_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774378_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774363_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774382_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774384_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774392_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571339_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964137_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792668_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY596111_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571327_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KR152339_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
JQ341559_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY596104_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073833_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY167098_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792996_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792815_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagraa
FJ562303_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY217355_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY217356_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY217357_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY217358_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793130_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792835_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562296_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793157_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774413_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562219_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562234_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY596105_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793007_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MF674506_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377622_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964135_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964131_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964136_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964124_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964125_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964126_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964127_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964128_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964129_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964130_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964133_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964134_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964123_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964132_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY217361_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792686_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993711_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792773_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY167094_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793143_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ801524_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY596106_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU796066_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793179_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774374_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY596110_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY596112_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276776_PreS2_P-B      tccccgagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ027313_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcagraa
KX276794_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcagraa
KJ717801_PreS2_P-B      tcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
KX276783_PreS2_P-B      ycccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792929_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaarwa
KC793075_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993696_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ040157_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793189_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
KC792942_PreS2_P-B      tcccagagtcagrgcyctgtactttcctgctggtggctccagttcaggaa
KC792662_PreS2_P-B      tcccaaagtcagggmcctgtacyttcctgctggtggctccagttcaggaa
KX276797_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276787_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792983_PreS2_P-B      ycccagagtcagggccctgtacttycctgctggtggctccagttcmggaa
KC792870_PreS2_P-B      tcccagagtcagggccctayaccttcctgctggtggctccagttcaggaa
FJ386648_PreS2_P-B      ccccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792676_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
JN604130_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793011_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276786_PreS2_P-B      tcccagrgtcagggccctgtacyttcctgctggtggctccagttcaggaa
KX276774_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341595_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793188_PreS2_P-B      tcccagagtcagggccctggactttcctgctggtggctccagttcaggga
KC793185_PreS2_P-B      tyccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793134_PreS2_P-B      tcccacagtcggggccctgtaccttcctgctggtggctccagttcaggaa
KC792998_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC792811_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276792_PreS2_P-B      tcccagggtcagggccctgwactttcctgctggtggctccagttcaggaa
KC793034_PreS2_P-B      tcccagagtcagggcyctgtactttcctgctggtggctccagttcaggaa
JF436921_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793139_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccarttcaagra
KC793076_PreS2_P-B      tcccagagtcagggcmctryacttwcctgctggtggctccagttcaggaa
KC792769_PreS2_P-B      tcccagagtcagggccctrtaccttcctgctggtggctccrgttcaggaa
MG571352_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
AB073853_PreS2_P-B      tcccagagtaagggctctgtactttcctgctggtggctccagttcaggaa
KC793136_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792920_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792777_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792724_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
KC792675_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagraa
KC792881_PreS2_P-B      ccccagagtcagggcactgtaccttcctgctggtggctccagttcaggaa
KC793044_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggcttcagttcaggaa
KC792987_PreS2_P-B      ycccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792659_PreS2_P-B      ycccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793017_PreS2_P-B      ccccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793118_PreS2_P-B      tcccagagtcaggaccctgtachttcctgctggtggctccagttcaggaa
KC793028_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792966_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792843_PreS2_P-B      ycccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KX276800_PreS2_P-B      ycccagagtcagggccctrtactttcctgctggtggctccagttcaggaa
KC793128_PreS2_P-B      tcccagagtcagrgccytgtacttccctgctggtggctccagttcaagga
KC793159_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793060_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939678_PreS2_P-B      tcccagagtcagggccctgtatcttcctgctggtggctccagttcaggaa
KC792723_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
X97850_PreS2_P-B        ttccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
MG571351_PreS2_P-B      tcccagagtaagggccctgtactttcctgctggtggctccagttcaggaa
KJ717820_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ803808_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276806_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276798_PreS2_P-B      tcccasagtcagggccctgwactttcctgctggtggctccagttcaggaa
KC793145_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793038_PreS2_P-B      tcccagagtcagggcccagaatyttcctgctggtggctccagttcaggaa
KC792936_PreS2_P-B      tcccagagtcagagccctgtactttcctgctggtggctccagttcaggaa
EU939634_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276770_PreS2_P-B      tcccagaggcagggccgtggactttcctgctggtggctccagttcaggaa
KC792850_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792694_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793095_PreS2_P-B      tcccagagtcagggccctgtrccttcctgctggtggctccagttcaggaa
KC793009_PreS2_P-B      tcccagagtcagggccctgtaytttcctgctggtggctccagttcaggaa
KC792863_PreS2_P-B      tccsagrgtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276813_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792845_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
KC792804_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792786_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562260_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792712_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792651_PreS2_P-B      tcccagagtcagggctctgtacttccctgctggtggctccagttcaggac
DQ995804_PreS2_P-B      tcccagagtcagggccctgtacattcctgctggtggctccagttcaggaa
MG571338_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792986_PreS2_P-B      tcccagagtccgggccctgtactttcctgctggtggctccagttcaggaa
KC792878_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881792_PreS2_P-B      tcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
KC793080_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC793078_PreS2_P-B      tccaagagtcagagccctgtactttcctgctggtggctccagttcaggaa
KC793116_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792721_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792677_PreS2_P-B      ccccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792953_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276785_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KC793125_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC792991_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggra
KC792802_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793057_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792745_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcagraa
KC792743_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792764_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
HM011476_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793166_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793155_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792752_PreS2_P-B      tcccagagtcagrgccctgtactttcctgctggtggctccagttcaggag
KC792748_PreS2_P-B      tcccmgagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792727_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792705_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
GQ377644_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793049_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EF494381_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793087_PreS2_P-B      tcccagagtcagggcyctgtatcttcctgctggtggctccagttcaggaa
KC792848_PreS2_P-B      tcccagagtcaaggctctgtaccttcctgctggtggctccagttyaggaa
KC792897_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
JQ027325_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
AB900098_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggcttcagttcaggaa
KJ717836_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ803820_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793197_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
EU487256_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU660224_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276799_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793200_PreS2_P-B      tcccagagtcagggccctatayyttcctgctggtggctccagttcaggaa
KC793056_PreS2_P-B      tcccagagtcagagccctgtactttcctgctggtggctccagttcagaaa
KC792931_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KC793120_PreS2_P-B      tcmcagagtcagggcccwgtactttcctgctggtggctccagttcaggaa
KC793072_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793059_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttccggaa
KC793012_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC793054_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
KC792956_PreS2_P-B      tcccaragtcagggccctgtactttcctgctggtggctccagttcaggaa
HM011484_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ032342_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KJ717808_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ803797_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ717806_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ803795_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KF053194_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ803781_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ717805_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793043_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC792847_PreS2_P-B      gaccccagtcagggcctcacaccttcctgctggtggctccagttcaggaa
KC792744_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792652_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
HM011478_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU547563_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY163869_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
AY163870_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
MK818223_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792939_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792905_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792861_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC792860_PreS2_P-B      tcccagagtcagggccttgtacttccctgctggtggctccagttcaagga
JX429901_PreS2_P-B      tccaagagtcagggccctgtactttcctgctggtggctccagttcaggga
JQ027312_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagraa
KC792664_PreS2_P-B      tcccagagtcagggccctgtatcttcctgctggtggctccagttcaggaa
KC792900_PreS2_P-B      tcccagagtcagggccctgtatcttcctgctggtggctccagttcaggaa
KC793173_PreS2_P-B      tcccmgagtcagggccctgtacyttcctgctggtggctccagttcaggaa
KC792975_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792882_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792701_PreS2_P-B      tcccagagtcagagccctgtamkttcctgctggtggctccagttcaggaa
JQ341553_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU158262_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB555499_PreS2_P-B      gcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ717843_PreS2_P-B      tcccagagtcagagccctgtactttcctgctggtggctccagttcaggaa
KJ803825_PreS2_P-B      tcccagagtcagagccctgtactttcctgctggtggctccagttcaggaa
KC793182_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793151_PreS2_P-B      tcccagagtcagggccctgamctttcctgctggtggctccagttcaggaa
KC793148_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793088_PreS2_P-B      tcccmaagtcagggccctgwacwytactgctggtggctccagttcaggaa
KC793004_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792780_PreS2_P-B      tcccagagtcagagccctgtaytttcctgctggtggctccagttcaggaa
KC792760_PreS2_P-B      tcccagagtcagggccctgtacmytcctgctggtggctccagttcagraa
KC792758_PreS2_P-B      tcccagagtcagggccctgtacyttcctgytggtggctccagttcagraa
KC792733_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KC792918_PreS2_P-B      tcacacagtcaagggcctgaaccttcctgctggtggctccagttcaggaa
KC792810_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792726_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ032344_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
DQ995802_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY220697_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406161_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ717797_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793194_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792928_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792825_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ995801_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793090_PreS2_P-B      tcccagagtccgggccytgtacyttcctgctggtggctccagttcaggaa
KC793071_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793015_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793000_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792970_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggcttcagttcaggaa
KC792725_PreS2_P-B      tcccagagtcagggccctgtactytcctgctggtggctccagttcaggaa
JX026886_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341582_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
JQ341562_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
HM011482_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939661_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KJ717795_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ803789_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793190_PreS2_P-B      tcccaaagtcagggccctgtactttcctgttggtggctccagttcaggaa
KC793047_PreS2_P-B      tcccagagtcagggccctgtacytccctgctggtggctccagttcaggaa
KX276809_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793174_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793163_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792730_PreS2_P-B      tcccmgagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB302942_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB302943_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB302944_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB302945_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793124_PreS2_P-B      tcccagagtcagggccctgtacctttctgctggtggctccagttcaggaa
KC792988_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagraa
KC792822_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792696_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792671_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ787477_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793117_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC792924_PreS2_P-B      tcmcagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792851_PreS2_P-B      tcccagagtcagggccctgtacattcctgctggtggctccagttcaggaa
GQ924630_PreS2_P-B      tcccagagtcaggcacctgtactttcctgctggtggctccagttcaggaa
AB073857_PreS2_P-B      tcccagagtcagagctctgtactttcctgctggtggctccagttcaggaa
KP406162_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406163_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406165_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406167_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406172_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406171_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406173_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
MG571358_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792728_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792692_PreS2_P-B      tcmcagagtcagggccctgtaccttcctgctggtggctccaattcaggaa
HM153811_PreS2_P-B      tcccagagtcaggacactgtactttcctgctggtggctccagttcaggaa
KJ173383_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcagaaa
KJ173384_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KX276811_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KX276805_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793199_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793081_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC793008_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792990_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792925_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792778_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792660_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX504543_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ032358_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY167100_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
MF674422_PreS2_P-B      tcccagaatcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793121_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793053_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC792959_PreS2_P-B      tcccagaatcagggccctgtactttcctgctggtggctccagttcaggaa
KC792907_PreS2_P-B      tcccagagtcagagccctgtattttcctgctggtggctccagttcaggaa
KC792888_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792875_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792741_PreS2_P-B      tmccagagtcagggccctgtactttcctgctggtggctccagttcagraa
GQ924646_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KX276807_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276804_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793150_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793137_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792852_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
MF674426_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792943_PreS2_P-B      tcccagagtcagggccctgaacttccctgctggtggctccagttcagaaa
KC792871_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcmggaa
KM875426_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KM875427_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793180_PreS2_P-B      tcccagagtcagggycctgtactttcctgctggtggctccagttcaggaa
KC793126_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792954_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792901_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792782_PreS2_P-B      ycccagagtcagggccctrtactttcctgctggtggctccagttcaggaa
KC792665_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939633_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ995803_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
FJ899784_PreS2_P-B      ccccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ899787_PreS2_P-B      ccccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
EU939672_PreS2_P-B      ccccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ899786_PreS2_P-B      ccccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ899785_PreS2_P-B      ccccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
X98077_PreS2_P-B        tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793079_PreS2_P-B      tcccagagtcagggccctttactttcctgctggtggctccagttcaggaa
KC793014_PreS2_P-B      tcccagagtcagggccctgyactttcctgctggtggctccagttcaggaa
KC792684_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
FJ386669_PreS2_P-B      tcccagagtcagggccctgtactttcctgttggtggctccagttcaggaa
AB073824_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
MG571334_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcacgaa
KJ790200_PreS2_P-B      tcccagagtccgggccctgtaccttcctgctggtggctccagttcaggaa
KJ173378_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793098_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793030_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KC793006_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792977_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792963_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
KC792952_PreS2_P-B      tcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
KC792933_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
KC792885_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagraa
KC792839_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792821_PreS2_P-B      tcccagagtcagggccctgtacgttcctgctggtggctccagttcaggaa
KC792720_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792657_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ801474_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
JQ341594_PreS2_P-B      tcccagagtcagggctctgtacyttcctgctggtggctccagttcaggaa
JN604149_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386600_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
EU306699_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY206375_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
AF121251_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793146_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793132_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
KC793058_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793033_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793025_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792969_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792896_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagraa
KC792883_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792879_PreS2_P-B      tcccagagtcaggaccctgtactttcctgctggtggctccagttcaagaa
KC792648_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792678_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341576_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU357842_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964244_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
KU964251_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
KU964253_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
KU964254_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
KU964250_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
KU964252_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
KU964248_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KU964255_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KU964256_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KU964246_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
KU964247_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KU964249_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KU964394_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC793138_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
KC793027_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792945_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792898_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792877_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792783_PreS2_P-B      tcccagagtcagggcactgtaccttcctgctggtggctccagttcaggaa
KC792738_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
KC792697_PreS2_P-B      tcccagagtcagggccctataccttcctgctggtggctccagttcaggaa
AB073839_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
MG571333_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
MF674465_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792796_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KC792774_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ787476_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY766463_PreS2_P-B      tcccagagtcagggcactatactttcctgctggtggctccagttcaggaa
AY206391_PreS2_P-B      tcccagagtcagggccctgtaccctcctgctggtggctccagttcaggaa
MG571326_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571329_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406318_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406319_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406320_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406321_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406322_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406323_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406324_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406325_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406326_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406328_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406329_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406327_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406333_PreS2_P-B      tcccagagtcagggccctgtacattcctgctggtggctccagttcaggaa
KP406332_PreS2_P-B      tcccagagccagggccctgtactttcctgctggtggctccagttcaggaa
KP406330_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406334_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406331_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406335_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173373_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793021_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792767_PreS2_P-B      tcccaragtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341551_PreS2_P-B      tcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
FJ386680_PreS2_P-B      tcccagagtcagggccctatacttccctgctggtggctccagttcaggaa
EU882003_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964291_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964292_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964296_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964302_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964300_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964287_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964288_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964289_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964290_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964294_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964295_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964297_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964298_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964299_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964301_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964293_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793020_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792772_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
GQ377606_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU881997_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB555498_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571367_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571354_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571323_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276812_PreS2_P-B      tcccagagtcagggccctrtactttcctgctggtggctccagttcaggaa
KX276790_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276778_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793196_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793114_PreS2_P-B      tcccagagtcagggcmctgtaccttcctgctggtggctccagttcaggaa
KC793113_PreS2_P-B      tcccagagtaagggccctgtacyttcctgctggtggctccagttcaggaa
KC793067_PreS2_P-B      tcccagagtcaggggcctgtactttcctgctggtggctccagttcaggaa
KC793005_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792903_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC792894_PreS2_P-B      tcccagagtcagggccctrtactttcctgctggtggctccagttcaggaa
KC792719_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792666_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792661_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341606_PreS2_P-B      tcccagagtcagrgctctgtactttcctgctggtggctccagttcaggaa
JQ341552_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttccggaa
GQ377567_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377550_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939664_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
EU522072_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggga
EU487257_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EF494380_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
AB073830_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406239_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406237_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406236_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaagaa
KP406220_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406221_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406222_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406223_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406224_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406225_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406226_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406227_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406228_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406229_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406230_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406231_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406234_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406232_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406233_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406235_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406242_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406243_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406238_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406240_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KP406241_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KJ173371_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173372_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KM213036_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ717796_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793023_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792985_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792964_PreS2_P-B      tcccagagtcagggccctgwaccttcctgctggtggctccagttcaggaa
KC792892_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792814_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
JN604224_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
HM011473_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173368_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KF053163_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KJ803756_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793152_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793052_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792916_PreS2_P-B      tccaagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792698_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX504531_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
JQ027330_PreS2_P-B      tcccagagtcagggcccwgaactttcctgctggtggctccagttcaggaa
JQ027331_PreS2_P-B      tcccagagtcagggcccwgaactttcctgctggtggctccagttcaggaa
FJ032357_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939638_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY220698_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY206373_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB365445_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073836_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073832_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793063_PreS2_P-B      tcccagaatcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792849_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792813_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792809_PreS2_P-B      tccccgagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX429897_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386688_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
KJ717813_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttccggaa
KJ803801_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttccggaa
KC793193_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792967_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792703_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792702_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792649_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939677_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792832_PreS2_P-B      tcccaragtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792827_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792787_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792717_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661484_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386636_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagtttaggaa
MG571375_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571373_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
MG571341_PreS2_P-B      tcccagagtcagggccctgtacattcctgctggtggctccagttcaggaa
KX276788_PreS2_P-B      tcccagaatcagggccctgtactttcctgctggtggctccagttcaggaa
KU964153_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406277_PreS2_P-B      tcccagagtcagggccctgtacgttcctgctggtggctccagttcaggaa
KP148317_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793183_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793140_PreS2_P-B      tcccagagtccgggccctgtactttcctgctggtggctccagttcaggaa
KC793077_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792971_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KC792955_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792935_PreS2_P-B      tcccagagtcaggaccctgtactttcctgctggtggctccagttcaggaa
KC792913_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792855_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
JX507213_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341556_PreS2_P-B      tcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
FJ562311_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386642_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386610_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU305547_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccggttcaggaa
AY596103_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY220704_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
AB073837_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963946_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793186_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793115_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793111_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793099_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793022_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggga
KC792867_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792654_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX026881_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
HM011480_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562253_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ562224_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386658_PreS2_P-B      ccccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073841_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276810_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KU964245_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KM875420_PreS2_P-B      tcccagagtcagggccctctactttcctgctggtggctccagttcaggaa
KC793106_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792978_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792749_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ801494_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaagaa
FJ386634_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU919171_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
EU522067_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AF121248_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993698_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993699_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939679_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP406166_PreS2_P-B      tcccagagtcagggccctgaactttcctgctggtggctccagttcaggaa
KC793131_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793013_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792763_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY167101_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993710_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ717831_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ803817_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX504533_PreS2_P-B      tcccagagtcagggccctgtacattcctgctggtggctccagttcaggaa
AY220703_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
KC792917_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792948_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964166_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964154_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964158_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964159_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964160_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964156_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964157_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964161_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964163_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964165_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964168_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY881721_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881722_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881723_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881724_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881725_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881726_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881727_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881728_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881729_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881730_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881731_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881732_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881733_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881734_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881735_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881740_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881741_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881745_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881746_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881747_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881752_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881753_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881756_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881757_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881759_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881760_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881761_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881778_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KY881779_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KX276808_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276777_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ410502_PreS2_P-B      tcccagagtcagagccctgtactttcctgctggtggctccagttcaggaa
KJ173377_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793172_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793170_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793127_PreS2_P-B      wcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793086_PreS2_P-B      tcccagagtcagggacctgtactttcctgctggtggctccagttcaggaa
KC793045_PreS2_P-B      tcccagagtcagggcactgtaccttcctgctggtggctccagttcaggaa
KC793029_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793002_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttyaggaa
KC792980_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792974_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792960_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792949_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792910_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagtttaggaa
KC792889_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792841_PreS2_P-B      tcccaragtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792836_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792819_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaagaa
KC792754_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774412_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661480_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX429911_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ801485_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341600_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341598_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ281247_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ281243_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JN604127_PreS2_P-B      ccccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562289_PreS2_P-B      tcccagagtcagggccctgtaytttcctgctggtggctccagttcaggaa
FJ386683_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386615_PreS2_P-B      tcccagagtcagggccctgtactytcctgctggtggctccagttcaggaa
EU939665_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
EU882004_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU881998_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993705_PreS2_P-B      tcccagagtcagggacctgtactttcctgctggtggctccagttcaggaa
DQ975271_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY217362_PreS2_P-B      tcccagagtcagggccctgtacgttcctgctggtggctccagttcaggaa
AP011084_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaagaa
AF121247_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB287329_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571325_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173366_PreS2_P-B      tccccgagtcagggccctgtactttcctgctggtggctccagttcaggaa
KF053192_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ803763_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793031_PreS2_P-B      tcccagagtcaggaccctgtactttcctgctggtggctccagttcaggaa
KC792915_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ040138_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
HM011474_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AF121250_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB642094_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571346_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KY470962_PreS2_P-B      tcccagagtcaggcccctgtactttcctgctggtggctccagttcaggaa
KP148322_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173386_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KC793073_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792944_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KC792674_PreS2_P-B      tcccagagtcagggccctgtatcttcctgctggtggctccagttcaggaa
KC774415_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ801506_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
JQ341563_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY217359_PreS2_P-B      tcccagagtcggggccctgtattttcctgctggtggctccagttcaggaa
KM875421_PreS2_P-B      tcccagagtcagggccctctactttcctgctggtggctccagttcaggaa
KC793065_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792973_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792820_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagtttaggaa
KC774396_PreS2_P-B      tcccagagtcagggccctatattttcctgctggtggctccagttcaggaa
EU919172_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571361_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KJ173374_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793018_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377610_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073821_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562237_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173343_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173345_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU919175_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
EU919176_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
MG571350_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagraa
MF674503_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964164_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963948_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963955_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KR232337_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KP148357_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148324_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KM875418_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KM875416_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KM392084_PreS2_P-B      tcccagagtcagggcyctgtactttcctgctggtggctccagttcaggaa
KM392072_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtgcctccagttcaggaa
KF053189_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ803783_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793178_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793101_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792932_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792919_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792906_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792874_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774410_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KC774403_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774401_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774398_PreS2_P-B      tcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
KC774377_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
KC774368_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774367_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661474_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341570_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccaattcaggaa
JQ341569_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341568_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341564_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341549_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JN604146_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815779_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815722_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU434372_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377558_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562322_PreS2_P-B      ccccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562316_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ518812_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386676_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
FJ386655_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386582_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
EU796068_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
EU564826_PreS2_P-B      tcccagagtcagggccctgaactttcctgctggtggctccagttcaggaa
EU522074_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggga
EU439021_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
EU439020_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306677_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993709_PreS2_P-B      ccccaaagtcaaggccctgtactttcctgctggtggctccagttcaggaa
AY217360_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
AB246339_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB287328_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB205120_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073840_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173403_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173404_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MF674512_PreS2_P-B      tcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
KP148314_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP036970_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793198_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX429910_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttccggaa
JQ341573_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
GU815713_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ924648_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
GQ377582_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU919173_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148326_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX869998_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB246340_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939559_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC793064_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
JQ341550_PreS2_P-B      tcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
GU815780_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU305548_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ448624_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276803_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793144_PreS2_P-B      tcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
KC793091_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792934_PreS2_P-B      tcccagagtcagggacctgtactttcctgctggtggctccagttcaggaa
KC774416_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
KC774409_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774405_PreS2_P-B      tcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
KC774404_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774376_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510646_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341591_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ281177_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ281156_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ924634_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ448622_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AJ627225_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073831_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774406_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792899_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX276773_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AF279464_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815611_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815610_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815608_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815607_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815602_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815596_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815587_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815581_PreS2_P-B      ttccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815579_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815583_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815585_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815586_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815588_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815589_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815590_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815591_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815593_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815594_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815595_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815597_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815598_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815599_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815600_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815601_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815603_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815604_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815605_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815606_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815609_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815612_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815613_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815614_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815584_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ924644_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ924607_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341609_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MF674485_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU451682_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MF674480_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EF134945_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EF134946_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU158263_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ924631_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341579_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793165_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KF053171_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ803764_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792972_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792909_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792685_PreS2_P-B      tcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
KC792667_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC774417_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774408_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793082_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774375_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774372_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774371_PreS2_P-B      tcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774365_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510652_PreS2_P-B      tcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
JX661470_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792984_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
GU815733_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815729_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815720_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815718_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815712_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815716_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815717_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815719_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815724_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815725_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815739_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU882002_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173397_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173398_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ141619_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY596109_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ801514_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571356_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY167089_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ448620_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661481_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510641_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510647_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774366_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774373_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774395_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774407_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774411_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774419_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792731_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793062_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KX765856_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MK075117_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963980_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661475_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073826_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963976_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963977_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963978_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963986_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963987_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963979_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY293309_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU434373_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ040173_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963981_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963982_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963983_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963984_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963985_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963988_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963989_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963841_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963833_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963828_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963830_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963831_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963832_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963834_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963835_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963836_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963837_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963838_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963839_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963840_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963855_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963829_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792823_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815773_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggccccagttcaggaa
GU815776_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggccccagttcaggaa
GU815783_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815777_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815774_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815772_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815775_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815781_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815782_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964155_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964162_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964167_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ717830_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792864_PreS2_P-B      tcccagagtcagggcccygtactttcctgctggtggctccagttcaggaa
KC774400_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU939666_PreS2_P-B      cctcagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
DQ141615_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815710_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815709_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815699_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815701_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815702_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KF053159_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ803752_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ412092_PreS2_P-B      tcccagagtcagggtcctgtactttcctgctggtggctccagttcaggaa
JQ801479_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306678_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306681_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470960_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470961_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470956_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470954_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963962_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963963_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963951_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963949_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963816_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148365_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
KP148361_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148330_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KM392083_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173422_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173423_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173418_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173419_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173367_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173363_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173364_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173360_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
KC793168_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792994_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792858_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792854_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792714_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC774394_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510653_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510643_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661479_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661476_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661471_PreS2_P-B      tcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
JQ801512_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341593_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341578_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341565_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341558_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815778_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815770_PreS2_P-B      tcccagagtcagggccccgtactttcctgctggtggctccagttcaggaa
GU815747_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815748_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815735_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815728_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815711_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815657_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815639_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815634_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815620_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815621_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815617_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815622_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ924603_PreS2_P-B      tcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
GQ475340_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377641_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377638_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377625_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377561_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377519_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562231_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562222_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386654_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386584_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU570069_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU439023_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU439022_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EF473973_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ448628_PreS2_P-B      tccaagagtcagggccctgtactttcctgctggtggctccagttcaggaa
D00330_PreS2_P-B        tcccggagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY518556_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AF282918_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
X97851_PreS2_P-B        tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB471854_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073828_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993697_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815743_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815741_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815734_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815723_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815715_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815726_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815736_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815738_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815744_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815745_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815746_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815761_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815764_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815760_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815756_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815752_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB205119_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815749_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815750_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815751_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815753_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815754_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815757_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815759_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815762_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815765_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815766_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815767_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815768_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815769_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815771_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510650_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815755_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815727_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815721_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815730_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815731_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815732_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815737_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815740_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815742_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815706_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815707_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815680_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY596102_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815679_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815683_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815684_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815685_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815686_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815687_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815688_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815689_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815691_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815692_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815693_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815694_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815695_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815696_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815697_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815698_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815700_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815703_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815704_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815705_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815708_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510649_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC774399_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815681_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KY470953_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963970_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510654_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX429902_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377569_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377537_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792784_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792856_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306679_PreS2_P-B      ccccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU306680_PreS2_P-B      ccccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377566_PreS2_P-B      ccccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815651_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815653_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ141616_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ141617_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EF473975_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU964103_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148356_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AF100309_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571369_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571365_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571347_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MF674427_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963968_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963967_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963964_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963960_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963961_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963965_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963966_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963969_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963971_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963972_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963973_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963974_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963975_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963945_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963947_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963950_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963952_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963953_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963954_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963956_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963957_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963958_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KU963959_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148363_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148331_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148329_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggttccagttcaggaa
KP148328_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148321_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ410516_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173420_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173421_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173416_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173417_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173411_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173412_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173405_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173406_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173409_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173410_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148319_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148320_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148323_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148327_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148332_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148333_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148335_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148359_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148360_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148362_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148364_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KP148366_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173381_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttccggaa
KJ173382_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttccggaa
KJ173413_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttccggaa
KJ173414_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttccggaa
KJ173415_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttccggaa
KJ173369_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173365_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173359_PreS2_P-B      tcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
KC793102_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793085_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792912_PreS2_P-B      tcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
KC792798_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792795_PreS2_P-B      tcccagagtcagggccctgtacyttcctgctggtggctccagttcaggaa
KC792756_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510660_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510642_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510648_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX869999_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661477_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC492739_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX429908_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX429900_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX429899_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ801471_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ412090_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341575_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ040171_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ040170_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JN604122_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JF412801_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815678_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815670_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815663_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815658_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815656_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815650_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX507215_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815633_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815626_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815619_PreS2_P-B      tcccagagtcaggaccctgtactttcctgctggtggctccagttcaggaa
GU815618_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ924653_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ924608_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510659_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377643_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377639_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377612_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377587_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173387_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173388_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377568_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ787444_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386684_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386666_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU570070_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU570071_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993707_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993704_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993706_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ448627_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ448625_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AF121249_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU350409_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386668_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792828_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571368_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AF121244_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AF121243_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AF121245_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AF121246_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ924627_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510656_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB471855_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993703_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377547_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792895_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793105_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB195933_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AF479684_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073834_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AF100308_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AY167097_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ141620_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ448621_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ448623_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ448626_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
DQ993708_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
EU439018_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ924611_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815623_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815624_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815632_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815646_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815647_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815648_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815649_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815652_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815654_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815659_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815660_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815661_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815662_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815664_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815665_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815666_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815667_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815668_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815669_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815672_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815673_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815674_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815675_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815676_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815677_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JF899335_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JN406371_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ040125_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341574_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341583_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ688405_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ801507_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661472_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792747_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792993_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793167_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC793176_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173339_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173340_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173352_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173354_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173399_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173400_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173407_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ173408_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ410490_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KJ410517_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MF674450_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571340_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571371_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073822_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GQ377588_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
AB073827_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815616_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815635_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ562254_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815640_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815644_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815643_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815642_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815638_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815625_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815627_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815628_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815629_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815630_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815631_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815636_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815637_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815641_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
GU815645_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JN604124_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC792981_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KM875417_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571360_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
FJ386660_PreS2_P-B      tcccagagtcagggccctgtatyttcctgctggtggctccagttcaggaa
KY881796_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510657_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
MG571322_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX978431_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JX661473_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
JQ341584_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggkggctccagttcaggaa
DQ448619_PreS2_P-B      tcccagagtcagggccctctactttcctgctggtggctccagttcaggaa
GQ924605_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
KC510644_PreS2_P-B      tcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
                                                   ** ***         **      

AB048705_PreS2_P-B      cagtaaaccctgttccgaatactgtctctcacatctcatcaatcttcacg
KC793066_PreS2_P-B      cagtragccctgctcagaatactgtctctgccayatcgtcaatctyatcg
KP659249_PreS2_P-B      cagtaaaccctgctcagaatactgcatcttccatatcgtcaatcttatcg
AB287323_PreS2_P-B      cagtgaaccctgctcagagtactgcctctgccatatcgtcaaccttatcg
KP659239_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatattgtcaatcttaccg
KP659248_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
AB287325_PreS2_P-B      cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
AB287321_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
DQ463795_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
KP659238_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
DQ463791_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
DQ463797_PreS2_P-B      cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
JN792895_PreS2_P-B      cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
DQ463789_PreS2_P-B      cagtaaaccctgctcaaaatactgcctcttccatatcgtcaatcttatcg
JN792896_PreS2_P-B      cagtaaaccctgctcaaaatactgcctcttccatatcgtcaatcttatcg
JN792901_PreS2_P-B      cagtgaaccctgctcaaaatactgcctcttccatatcgtcaatcttatcg
JN792902_PreS2_P-B      cagtgaaccctgctcaaaatactgcctcttccatatcgtcaatcttatcg
AB287320_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
KP659244_PreS2_P-B      cagtgaaccctgttcagaatactgcctcttccatatcgtcaatcttatcg
DQ463799_PreS2_P-B      cagtaaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
DQ463802_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
KP659251_PreS2_P-B      cagtraaccctgctcagaayactgcctcttccatatcgtcaatcttatcg
KP659245_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
DQ463787_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
AB287316_PreS2_P-B      cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
AB287318_PreS2_P-B      cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
KP659219_PreS2_P-B      cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
JN792894_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
DQ463793_PreS2_P-B      cagtgaaccctgctcagattactgcctctcccatatcgtcaatcttaccg
DQ463801_PreS2_P-B      cagtgaaccctgctcagattactgcctctcccatatcgtcaatcttaccg
JN792893_PreS2_P-B      cagtgaaccctgctcagattactgcctctcccatatcgtcaatcttaccg
JN792897_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaatcttaccg
DQ463800_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
JN792898_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
DQ463798_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
JN792899_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
DQ463796_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
DQ463792_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
JN792900_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
DQ463788_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
DQ463790_PreS2_P-B      cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccg
KP659240_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
KP659250_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
KP659220_PreS2_P-B      cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
KP659253_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
KP659223_PreS2_P-B      cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
AB287322_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
AB287319_PreS2_P-B      cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttatcg
KP659255_PreS2_P-B      cagtgaaccctgctcaaaatactgcctctcccatatcgtcaatcttatcg
KP659254_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
DQ463794_PreS2_P-B      cagtgaaccctgctcaaaatactgcctcttccatatcgtcaatcttatcg
KP659224_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
KP659252_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
KP659234_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
KP659235_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
KP659246_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
KP659237_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
KP659247_PreS2_P-B      cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
AB287314_PreS2_P-B      cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
AB287315_PreS2_P-B      cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
AB287317_PreS2_P-B      cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcg
KX276962_PreS2_P-B      cagtaaaccctgttcagaacactgcctcggccatatcgtcaatcttatcg
HM011499_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KX276858_PreS2_P-B      cagtgaaccctgttcagaacactgcctytwccatatcgtcaatctyatcg
HM011469_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KX276822_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
HM011487_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaacctcatcg
KX276996_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KX276821_PreS2_P-B      cagtaaaccctgttcagaatactgcctctcccatatcgtcaatcttatcg
KJ717840_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KJ803824_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141626_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccacatcgtcaaccttctcg
KX276830_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaaccttatcg
KX276814_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KX276825_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KX276828_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatctcatcg
KX276970_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
GQ924617_PreS2_P-B      tagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcg
DQ141631_PreS2_P-B      cagtaaaccctgttcagaccactgcctctcccatatcgtcaatcttatcg
GQ924621_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KX765854_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KJ717798_PreS2_P-B      cagtcaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141642_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
LC349879_PreS2_P-B      cagtaaaccctgttcagaacactgcatccaccatatcgtcaatcttatcg
KX276829_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KJ717835_PreS2_P-B      cagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
KJ803819_PreS2_P-B      cagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
KF053191_PreS2_P-B      cagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcg
KJ803786_PreS2_P-B      cagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcg
DQ141635_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KX276818_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
HM011492_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB493833_PreS2_P-B      cagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcg
JQ341607_PreS2_P-B      cagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
KJ717807_PreS2_P-B      cagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcg
KJ803796_PreS2_P-B      cagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcg
JQ429081_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
HM011490_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141636_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141638_PreS2_P-B      cagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcg
KX276823_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
FJ023637_PreS2_P-B      cactgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KF053162_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KF053165_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KJ803755_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KJ803758_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
JQ341597_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
JQ341599_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141640_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
HQ700548_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141634_PreS2_P-B      cagtaaaccctgttcagaacactgcatccaccatatcgtcaatcttatcg
DQ141637_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
LC349870_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
D00331_PreS2_C-B        cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141624_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141625_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
LC349874_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KF053190_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KJ803784_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
GQ358136_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB033554_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB713529_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB713530_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
LC349872_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
LC349875_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
JQ429082_PreS2_P-B      cagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
DQ141633_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141630_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141627_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB033555_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
LC349873_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141628_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
LC349869_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB219430_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB493835_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AP011085_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141629_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141632_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141623_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KJ717792_PreS2_P-B      cagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
KJ803787_PreS2_P-B      cagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
EF473971_PreS2_P-B      cagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
DQ141622_PreS2_P-B      cagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
EF473972_PreS2_P-B      cagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
M54923_PreS2_P-B        cagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
GQ924641_PreS2_P-B      ctgtgatccctgttcagagcactgtctctcccatatcgtcaatcttatcg
KX276817_PreS2_P-B      cagtgaaccctgttcagagcactgcctcttccatatcgtcaatcttatcg
KX276827_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KX276819_PreS2_P-B      cagtgaaccctgttcagagcactgcctctgccatatcgtcaatctyatcg
GQ924660_PreS2_P-B      cagtgaaccctgttcagaatactgcctctcccatatcgtcaatcttattg
DQ141641_PreS2_P-B      tagtaaaccctgttcagaacactgcctcttccatatcgtcaatctcatcg
DQ141654_PreS2_P-B      cagtgaaccctgttcagaccactgcctctcccatatcgtcaatcttatcg
JQ027311_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatctyatcg
EU660230_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatctcatcg
EU660231_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatctcatcg
EU660232_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatctcatcg
EU660233_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatctcatcg
HM011467_PreS2_P-B      cagtgaaccctgttcagaatactgcctcttccatatcgtcaatcttatcg
GQ924645_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccacatcgtcaatcttatcg
DQ141643_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
JN604123_PreS2_P-B      cagtgaacactgttcacaacactgcctcttccatatcgtcaatcttatcg
HM011496_PreS2_P-B      cagcaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148457_PreS2_P-B      cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
KP148458_PreS2_P-B      cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
KP148460_PreS2_P-B      cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
KP148455_PreS2_P-B      cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
KP148453_PreS2_P-B      cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
KP148452_PreS2_P-B      cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
KP148456_PreS2_P-B      cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
KP148459_PreS2_P-B      cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
KP148461_PreS2_P-B      cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
JQ027334_PreS2_P-B      cagtgaaccctgttccgaacactgcctcttccatatcgtcaatcttatcg
JN604141_PreS2_P-B      cagtraaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB219429_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB219427_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AP011086_PreS2_P-B      cagtgaaccctgttcagaacactgcatcttccatatcgtcaatcttatcg
AP011087_PreS2_P-B      cagtgaaccctgttcagaacactgcatcttccatatcgtcaatcttatcg
AB241117_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB219426_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB219428_PreS2_C-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
GQ924624_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
GQ924640_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KY881955_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881952_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881944_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881957_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881953_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881949_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881950_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881945_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881947_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881951_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881956_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881958_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881948_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881946_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KY881954_PreS2_P-B      cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcg
KP148419_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148427_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148426_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatctcatcg
KP148437_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148438_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148420_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148407_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148433_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148406_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148440_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148435_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148424_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148410_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148432_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148418_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148439_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148430_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcattcttatcg
KP148429_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148414_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148425_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148421_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148416_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148411_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148409_PreS2_P-B      cagtgaaccctattcagaacactgcctcttccatatcgtcaatcttatcg
KP148405_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148413_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148415_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148423_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148373_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148377_PreS2_P-B      cagtgaaccctgttcagaacactacctcttccatatcgtcaatcttatcg
KP148391_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148387_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148398_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148380_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148376_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148374_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148371_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148367_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148401_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148400_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148402_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148394_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148384_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148383_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148379_PreS2_P-B      cagtgaaccctgttcagaacactgcctcctccatatcgtcaatcttatcg
KP148369_PreS2_P-B      cagtgaaccctgttcagaacactacctcttccatatcgtcaatcttatcg
KP148375_PreS2_P-B      cagtgaaccctgttcagaacactacctcttccatatcgtcaatcttatcg
KP148451_PreS2_P-B      cagtgaaccctgttcagaacactacctcttccatatcgtcaatcttatcg
KP148368_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148385_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148386_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148370_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148372_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148378_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148382_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148388_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148389_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148390_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148392_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148395_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148396_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148397_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148399_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KP148403_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
GQ924635_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatattgtcaatcttgtcg
EU330995_PreS2_P-B      cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcg
FJ023638_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
EU330989_PreS2_P-B      cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcg
EU330990_PreS2_P-B      cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcg
EU330994_PreS2_P-B      cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcg
EU330996_PreS2_P-B      cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcg
EU330997_PreS2_P-B      cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcg
EU330998_PreS2_P-B      cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcg
EU330999_PreS2_P-B      cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcg
EU330992_PreS2_P-B      cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcg
EU331000_PreS2_P-B      cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcg
EU331001_PreS2_P-B      cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcg
GQ924638_PreS2_P-B      cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
GQ924639_PreS2_P-B      cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcg
KX276820_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KX276815_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141646_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141651_PreS2_P-B      aagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
DQ141655_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaaccttatcg
GQ358144_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaaccttatcg
GQ358147_PreS2_P-B      cagtgaaccctgttcagaacattgcctcttccatatcgtcaaccttatcg
GQ358145_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaaccttatcg
GQ358146_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaaccttatcg
LC416037_PreS2_P-B      cagagaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AY800391_PreS2_P-B      ctgtgaaccctgttcagagcactgcctcttccaaatcgtcaatctcatcg
AY800392_PreS2_P-B      ctgtgaaccctgttcagagcactgcctcttccaaatcgtcaatctcatcg
GQ924656_PreS2_P-B      cagcgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB713528_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KC774418_PreS2_P-B      ctgtgaaccctgttcagagcactgcctcttccatatcgtcaatcttatcg
JQ027316_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
JQ341590_PreS2_P-B      cagtgaaccctgttccgaccactgcctcttccatatcgtcaatcttatcg
AP011094_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
JQ341554_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141639_PreS2_P-B      cagtaaaccctgctcagaacactgcctcttccatatcgtcaatcttatcg
AP011089_PreS2_P-B      cagtgaaccctgttcagagcactgcctcttccatatcgtcaatcttatcg
DQ141647_PreS2_P-B      aagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
AP011093_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatctcatcg
GQ358148_PreS2_P-B      cagtaaaccctgttcagaacactgcatcttccatatcgtcaatcttatcg
GQ358149_PreS2_P-B      cagtaaaccctgttcagaacactgcatcttccatatcgtcaatcttatcg
GQ358151_PreS2_P-B      cagtaaaccctgttcagaacactgcatcttccatatcgtcaatcttatcg
GQ358152_PreS2_P-B      cagtaaaccctgttcagaacactgcatcttccatatcgtcaatcttatcg
GQ358150_PreS2_P-B      cagtaaaccctgttcagaacactgcatcttccatatcgtcaatcttatcg
AP011096_PreS2_P-B      cagtaaaccctgctcagaacactgcctcttccatatcgtcaatcttatcg
AP011095_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AP011092_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
GQ358142_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
DQ141653_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
EF473977_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
GQ924651_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
GQ924654_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
GQ358140_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
AP011088_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
GQ358143_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
DQ141649_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
DQ141650_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
EF473976_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
GQ358139_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
DQ141648_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
HQ700549_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
GQ358137_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgacaatcttatcg
GQ358138_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
DQ141652_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
AP011091_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
AP011090_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
GQ358141_PreS2_P-B      cagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcg
AB713532_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KJ717841_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
LC349877_PreS2_P-B      cagtgagccctgttcagaacactgcctcttccatatcgtcaatcttatcg
GQ924625_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
LC349868_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
LC349878_PreS2_P-B      cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141644_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
GQ924637_PreS2_P-B      cagtgaaccctgttcagaacactgcctctcccatatcgtcaatcttatcg
AB713527_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB493827_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB713531_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
LC349871_PreS2_P-B      cagtgaaccctgttcagagcactgcctcttccatatcgtcaatcttatcg
GQ924628_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
AB976562_PreS2_P-B      ctgtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
DQ141645_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
KX276824_PreS2_P-B      cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcg
HM011466_PreS2_P-B      cagtgagccctgctcagaatactgtctcwgccayatcgtcaatcttatcg
KJ717829_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KJ803816_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
DQ993694_PreS2_P-B      ccgtgagccctgctcagactactgcctctgccatatcgtcaaccttctcg
DQ993687_PreS2_P-B      ccgtgagccctgctcakaakactgcctctgccatatcgkcaaccttctyg
JQ281161_PreS2_P-B      cagtgagccctgctcagaatactgcctcggccatatcatcaaccttctcg
MG826152_PreS2_P-B      cagtaagccctgctcagaatactgtatcggccatatcgtcaatcttatcg
JQ281221_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
DQ993684_PreS2_P-B      cagtgagtcctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281258_PreS2_P-B      cagtgagccctgctcagactactgcctctgccatatcgtcaaccttctcg
JQ281207_PreS2_P-B      cagtgagccctgctcagaatactgcctckgccatatcrtcaaccttctcg
JQ281239_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcrtcaacctyctcg
JQ281152_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JN604132_PreS2_P-B      cagtgagccctgctcagaatactgcctcggccatatcgtcaatcttctcg
JN604219_PreS2_P-B      cagtgagccctgctcagactactgcctttgccatatcgtcaaccttctcg
JQ281244_PreS2_P-B      cagtgagccctgctcakaatactgcctctgccatatcrtcaaccttctcg
JQ281248_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcrtcaaccttctcg
JQ281164_PreS2_P-B      yagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JN604234_PreS2_P-B      cagtgagccctgctcagaattctgcctctgccatatcgtcaaccttctca
JQ281137_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
AB117759_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
DQ993686_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707740_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707747_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707739_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707755_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707767_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707762_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707750_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707749_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707745_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707735_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707734_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707737_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707738_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707742_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707743_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707744_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707746_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707753_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707758_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707759_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707763_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707765_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707766_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707764_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674492_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281133_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
DQ993682_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
DQ993683_PreS2_P-B      tagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcg
AB073835_PreS2_P-B      tagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcg
DQ993680_PreS2_P-B      tagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcg
DQ993685_PreS2_P-B      tagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcg
DQ993681_PreS2_P-B      tagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcg
KY629635_PreS2_P-B      cagtgagccctgctcagaatactgtatcggccatatcgtcaatcttatcg
KJ173401_PreS2_P-B      cagtgagccctgctcagaatactgtatcggccatatcgtcaatcttatcg
KJ173402_PreS2_P-B      cagtgagccctgctcagaatactgtatcggccatatcgtcaatcttatcg
KY629636_PreS2_P-B      cagtgaaccctgctccgaatactgtatcggccatatcgtcaatcttatcg
KC774369_PreS2_P-B      cagtgagccctgctccgaatactgtatcggccatatcgtcaatcttatcg
KC774370_PreS2_P-B      cagtgagccctgctcagaatactgtatcggccatatcgtcaatcttatcg
MF674464_PreS2_P-B      cagtgagccctgctcagattactgcctctgccacatcgtcaaccttctcg
JQ281240_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcmaccttctcg
JQ281171_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281158_PreS2_P-B      tagtgagccctgctcagaayactgcctctgccatatcgtcaaccttctcg
JQ281131_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281252_PreS2_P-B      cagtgagccctgctcagaatactgcctcggccatatcgtcaaccttctcg
JQ281193_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707760_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707757_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707761_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707751_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcagccttctcg
JQ707754_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707736_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707748_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707752_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707756_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ707741_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674446_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281160_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281153_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281150_PreS2_P-B      cagtgagccctgctcagaatactgcmtcagccatatcgtcaaccttctcg
AB031267_PreS2_P-B      cagtgagccctgctcagaatactgcctctcccatatcatcaaccttctcg
MF674419_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ341604_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JQ281190_PreS2_P-B      cagtgagccctgctcagaatactgtctcggccatatcgtcaaccttctcg
MF674440_PreS2_P-B      ctgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ341605_PreS2_P-B      cagtgagccctgctcagattactgcctctgccatatcgtcaaccttctcg
JQ281241_PreS2_P-B      cagtgagccctgctcaraatactgcctctgccatatcatcaaccttctcg
JQ281170_PreS2_P-B      ccgtgagccctgctcagamtactgcctctgccatatcgtcaaccttcttg
JQ281157_PreS2_P-B      tagtgacccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674396_PreS2_P-B      cagtgagccctgctcagaatactgcctctcccatatcatcaaccttctcg
MF621878_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281236_PreS2_P-B      cagtgagccctgctcagaatactgcctcggccatatcgtcaaccttctcg
JQ281148_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccayatcgtcaaccttctcg
JQ281132_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttctcg
JQ281129_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaacctyctcg
JN604212_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
AY517489_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
AY517619_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281144_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281138_PreS2_P-B      ctgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281134_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
LT992442_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaatcttatcg
MF674479_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ341596_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ341585_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281255_PreS2_P-B      cagtgagccctgctcagaatactgcctcagccatatcatcaaccttctcg
JQ281238_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281196_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674439_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674473_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674389_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
KX765841_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281214_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
AB212626_PreS2_P-B      tagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674436_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674385_PreS2_P-B      cagtgagccctgctcagaatactgcctcagccacatcgtcaaccttctcg
AB212625_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674491_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674478_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281224_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281163_PreS2_P-B      cagtgagccctgctcagaacactgcctctgccatatcgtcaaccttctcg
MF674415_PreS2_P-B      cagtgagccctgctcagactactgcctctgccatatcgtcaaccttctcg
JQ341601_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaatcttctcg
JQ281253_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281229_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281151_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JN604221_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
AB231909_PreS2_P-B      cagtgagccctgctcagaataccgcctctgccatatcgtcaaccttctcg
AB205122_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674462_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674392_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JQ281154_PreS2_P-B      cagtragccctgctcagaatactgcctctgccatatcgtcaaccttctcg
AB368295_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674508_PreS2_P-B      tagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674456_PreS2_P-B      cagtaagccctgctcagaatcctgcctctgccatatcatcaaccttctcg
MF674432_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281242_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JN604138_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ341608_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281195_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674409_PreS2_P-B      tagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JQ281225_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JQ281218_PreS2_P-B      cagtgagccctgctcagaatactgcctctgycatatcgtcaaccttctcg
JQ281188_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatygtcaaccttctcg
JQ281167_PreS2_P-B      tagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JQ281141_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JN604143_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcatcaaccttctcg
FJ023636_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
AB115551_PreS2_P-B      cagtgagccctgctcaaaatactgcctctgccatatcgtcaaccttctcg
MF674416_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JN604244_PreS2_P-B      cagtgagccctgctccgaatactgcctctgccatatcgtcaaccttctcg
MF674434_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JQ341580_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
GQ924626_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674461_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcatcaaccttctcg
MF674460_PreS2_P-B      cagtgagccctgctcagaatactgcctctaccatatcatcaaccttctcg
MF674441_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281159_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JN604213_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281234_PreS2_P-B      cagtgagccctgctcagaatactgcctcggccatatcgtcaaccttctcg
AY033073_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674414_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281237_PreS2_P-B      cagtgagccctgctcagaatactgcctcwgccatatcgtcaaccttctcg
JQ281231_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281194_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281227_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281168_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674476_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674481_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674459_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674420_PreS2_P-B      tagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcr
JQ341589_PreS2_P-B      cagtgagccctgctcagaatactgcctckgccatatcgtcaaccttctcg
JQ281222_PreS2_P-B      cagtgagccctgctcagaatattgcctctgccatatcgtcaaccttctcg
JQ281165_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
AB100695_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674448_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
FJ023632_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
HQ700546_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674423_PreS2_P-B      tagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674495_PreS2_P-B      tagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674490_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281230_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcrtcaaccttctcg
JQ281149_PreS2_P-B      ccgtragccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674505_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674496_PreS2_P-B      cagtgagccctgctcagaatactgcctctcccatatcgtcaaccttctcg
MF674466_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674445_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674424_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674407_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674406_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674404_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaatcttctcg
MF674387_PreS2_P-B      tagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674382_PreS2_P-B      cagtgagccctgctcagaatactgcctcagccatatcgtcaaccttctcg
JQ281226_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281217_PreS2_P-B      cagtaagccctgctcagaatactgtctctgccatatcatcaaccttctcg
JQ281197_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281185_PreS2_P-B      tagtgagccctgctcagaatactgcctctgtcatatcatcaaccttctcg
JQ281180_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JN604223_PreS2_P-B      ctgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JN604119_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
FJ023634_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JQ281216_PreS2_P-B      cagtaagccctgctcagaatactgtctctgccatctcatcaaccttctcg
JQ281204_PreS2_P-B      cagtgagccctgctcagcatactgcctctgccatatcatcaaccttctcg
JQ281192_PreS2_P-B      cagtgagccctgctcagaatactgcctcggccatatcatcaaccttctcg
JQ281181_PreS2_P-B      tagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674401_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674482_PreS2_P-B      tagcgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674500_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674433_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JQ281220_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674513_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JQ281210_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JN604253_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JN604125_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JQ281200_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674393_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674394_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674395_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674413_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674452_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674510_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674507_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674443_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
AY033072_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281208_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281202_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281203_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674515_PreS2_P-B      cagtaagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674497_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674487_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674470_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674469_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674438_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674437_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674493_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674421_PreS2_P-B      cagtgagccctgctcagaatactgcctcttccatatcgtcaaccttctcg
JQ341603_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ341588_PreS2_P-B      cagtaagccctgctcaraatactgcctctgccatatcgtcaaccttctcg
JQ281257_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JQ281249_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281254_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281245_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281235_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
JQ281205_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281189_PreS2_P-B      tagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281166_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281143_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281140_PreS2_P-B      cggtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
FJ023635_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttcttg
FJ023633_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674447_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281256_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674511_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674477_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674455_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281213_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttctcg
MF674383_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttctcg
JQ281199_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281212_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281228_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674400_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674405_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674499_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674488_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281147_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281187_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281209_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281139_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281179_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674509_PreS2_P-B      cagtgagccctgctcagaattctgcctctgccatatcgtcaaccttctcg
MF674498_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674453_PreS2_P-B      ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674451_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcg
MF674410_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
KU234318_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674483_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281186_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281178_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281184_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281172_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281176_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674384_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674397_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
FJ349236_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JN604154_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JN604284_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281215_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281223_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281246_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
MF674431_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
JQ281211_PreS2_P-B      cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcg
KC792950_PreS2_P-B      cagtgarccctgytcagaatactgyctcagccatatcgtcaatctyatcg
KC792946_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccayatcgtcaakcttatcr
KC792840_PreS2_P-B      cagtgagccctgctcagaatactgtctcwgccatatcgtcaatcttatcg
KC792997_PreS2_P-B      cagtgagccctgctcagaatactgtatctgccatatcgtcaatctcatcg
MG571366_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792846_PreS2_P-B      cagtragccctgctcagamtactgtctctgccatatcgtcaatcttatcg
KC792859_PreS2_P-B      cagtgagccctgctcagaacactgtatcagccatatcgtcaatcttatcg
FJ386608_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatca
MG571353_PreS2_P-B      cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
MG571376_PreS2_P-B      cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KJ717837_PreS2_P-B      cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcg
KJ803821_PreS2_P-B      cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcg
KY417926_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
EU570075_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
EU579441_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
EU589335_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
FJ386656_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KX276802_PreS2_P-B      cagtragccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KX276791_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792663_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792992_PreS2_P-B      cagtgagccctgctcagaatactgyctctgccatatcgtcaatcttatcg
KC792937_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
MG571331_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792865_PreS2_P-B      cagtgagccctgctcagaatactgtctcwgccatatcgtcaatcttatcg
KC793181_PreS2_P-B      cagtgagccctgctcagaatactgtctcggtcatatcgtcaatcttatcg
KC793161_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccayatcgtcaatcttatcg
JQ341567_PreS2_P-B      cagtragccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792722_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KC792715_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
MG571321_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC793191_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttgtcg
KC792794_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KJ717817_PreS2_P-B      cagtaagccctgctcagaatactgtctctcccatatcgtcaatcttatcg
KJ803805_PreS2_P-B      cagtaagccctgctcagaatactgtctctcccatatcgtcaatcttatcg
KC793092_PreS2_P-B      cagtgagccctgctcagaatactgtctttgccatatcgtcaatcttatcg
MG571357_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
JQ281206_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctyatcg
KU964381_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccacatcgtcaaccttatcg
KU964382_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccacatcgtcaaccttatcg
KU964383_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccacatcgtcaaccttatcg
KU964384_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccacatcgtcaaccttatcg
KU964385_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccacatcgtcaaccttatcg
KU964388_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccacatcgtcaaccttatcg
KU964391_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccacatcgtcaaccttatcg
KU964393_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccacatcgtcaaccttatcg
KU964395_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccacatcgtcaaccttatcg
KU964397_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccacatcgtcaaccttatcg
MG372436_PreS2_P-B      cattgaaccctgctcagaatactgtctctgccatatcgtcaatcttatca
JQ801516_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792947_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792737_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttctcg
KC793083_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792709_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
AY217368_PreS2_P-B      cagtgagccctgctcagaatattgtctcggccatatcgtcaatcttatcg
KC793094_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
HM011475_PreS2_P-B      cagtgagccctgctcagaatactgtctcdgccatatcgtcaatcttrtcg
AY167102_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC793164_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792788_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KX276801_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KP406283_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KJ717818_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
FJ562312_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcg
JX870001_PreS2_P-B      cagtaagccctgttcagaatactgtctctgccatatcgtcaatcttgtcg
AB073823_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792785_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KU964146_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964138_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964140_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964142_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964144_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964145_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964147_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964148_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964150_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964151_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964152_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964139_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964141_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964143_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KU964149_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KX276779_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaycttatcg
KC792957_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
JQ040147_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
EU939675_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
EU564822_PreS2_P-B      cagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcg
AY206390_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcg
JQ341577_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
EU939676_PreS2_P-B      cagtgagccctgctccgaatactgtctctgccatatcgtcaatcttatcg
JQ341581_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctyatcg
MG571337_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KM213034_PreS2_P-B      cagtgagccctgctcagaatactgtctctcccatatcgtcaatctcatcg
JQ341592_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
HM011470_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KJ410500_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttgtcg
KC793160_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
JQ341572_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccacatcgtcaatcttatcg
KC792742_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792729_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcg
KC793001_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
JX504538_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
JN827419_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KY470834_PreS2_P-B      cagtgacccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KY470837_PreS2_P-B      cagtgacccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KY470841_PreS2_P-B      cagtgacccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KY470833_PreS2_P-B      cagtgacccctgctcagaatactgtctctgccgtatcgtcaatcttatcg
KY470832_PreS2_P-B      cagtgacccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KY470840_PreS2_P-B      cagtgacccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KY470835_PreS2_P-B      cagtgacccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KY470836_PreS2_P-B      cagtgacccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KY470839_PreS2_P-B      cagtgacccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KY470838_PreS2_P-B      cagtgacccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KY470830_PreS2_P-B      cagtgacccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC793016_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
EU796071_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
AY206383_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815574_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815577_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815573_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815554_PreS2_P-B      cagtgagccctgctcagaatactgtctctgctatatcgtcaatcttatcg
GU815561_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815569_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815571_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815578_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815570_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815565_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815567_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815576_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815560_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815557_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815550_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815549_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815548_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815558_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815562_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815563_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815572_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815575_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815551_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815552_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815553_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815555_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815556_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815559_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815564_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815566_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU815568_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
EU595031_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
FJ032349_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
FJ386675_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KT749820_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccacatcgtcaatctcatcg
EU796067_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttattg
KP406287_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KP406285_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KP406289_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KP406292_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KP406286_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KP406284_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KP406294_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KP406291_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KP406281_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KP406282_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KP406293_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KP406311_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406304_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406305_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406312_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406314_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406301_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406298_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406317_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406306_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406307_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406308_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406309_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406310_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406313_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406315_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406316_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406288_PreS2_P-B      cagtgagccctgctcagaatactgtcttagccatatcgtcaatctcatcg
KP406290_PreS2_P-B      cagtgagccctgctcagaatactgtcttagccatatcgtcaatctcatcg
KP406303_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406302_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406297_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406296_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406295_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406299_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
KP406300_PreS2_P-B      cagtgagccctgctcagaatactgtctcagccatatcgtcaatctcatcg
MG571370_PreS2_P-B      cagtgagccctgctcagaattctgtctcagccatatcgtcaatcttatcg
MG571348_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KX276793_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC793084_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792711_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
DQ993702_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
DQ141618_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
EF473974_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792982_PreS2_P-B      cagtgagccctgctcagaatactgtctcwgccatatcgtcaatctyatcg
KC792797_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792755_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
KC792736_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
AY800389_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
AB195934_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
AB195935_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
MG571372_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GU332695_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
DQ993700_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
DQ993701_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
MG571364_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
MG571328_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
MG571344_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC793070_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
JQ027315_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KX276781_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC793192_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792908_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GQ924606_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
AB073829_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GQ377629_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
EU306711_PreS2_P-B      ccgtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
FJ032352_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
FJ032353_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
FJ032354_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
GQ377525_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
FJ386682_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KP148334_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccacatcgtcaatcttatcg
KC793089_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792938_PreS2_P-B      cagtgagccctgctcagactactgtctctgccatatcgtcaatcttatcg
JN604311_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcg
EU139543_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KP148318_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC793122_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
FJ562321_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
AF282917_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
AB900110_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792735_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
EU939663_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
KC792766_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcg
FJ386681_PreS2_P-B      cagtgagccctgctcagaatactgtctctgccatatcgtcaatct