Dataset for nucleotide sequence C of genotype B

[Download (right click)] [Edit] [Sequences] [Repertoires]

4118 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

KP659255_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttc
KP659221_C_P-B      atggacattgacccgtataaagaatttggagcttctgaggagttactctc------tttt
KP659250_C_P-B      atggacattgacccgtataaagaatttggagctactgcggagttactctc------tttc
AB287317_C_P-B      atggacattgacacttataaagaatttggagctactgtggagttactctc------tttc
AB287318_C_P-B      atggacattgacccttataaagaatttggagcttctgcggagttactctc------tttc
KP659219_C_P-B      atggacattgacccttataaagaatttggagcttcttcggatttactctc------tttc
KP659240_C_P-B      atggacattgacccttataaagaatttggagcttctgyggagttactctc------tttt
AB287323_C_P-B      atggacattgacccgtataaagaatttggagctactgtggagttactctc------tttc
AB287324_C_P-B      atggacattgacccttataaagaatttggagcttctgcggagttactctc------tttc
AB287320_C_P-B      atggacattgacacttataaagaatttggagcttctgtggagttactctc------tttc
KP659248_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------ttty
AB287321_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttc
KP659244_C_P-B      atggacattgacccttataaagaatttggcgcttctgtcgagttactctc------tttc
AB287319_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttc
KP659224_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttc
DQ463799_C_P-B      atggacattgacccttataaagaatttggagcttctgtgaacttactctc------tttc
DQ463796_C_P-B      atggacatcgacccttataaagaatttggagcttctgtggagttactctc------tttc
DQ463795_C_P-B      atggacatcgacccttataaagaatttggagcttctgtggagttactctc------tttt
DQ463787_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttc
DQ463791_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttc
DQ463802_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttc
KP659252_C_P-B      atggacattgacccttataaagaatttggagcttctgcggagttactctc------tttt
JN792901_C_P-B      atggacattgacccttataaagaatttggagctactacggagttactctc------tttc
JN792902_C_P-B      atggacattgacccttataaagaatttggagctactacggagttactctc------tttt
KP659223_C_P-B      atggacattgacacttataaagaatttggagcttctgtggagttactctc------tttc
KP659254_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
KP659220_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttc
KP659251_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP659245_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttc
KP659239_C_P-B      atggacattgacccttataaagaatttggagctactgcggagttactctc------tttc
AB287325_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttc
KP659253_C_P-B      atggacattgacccttataaagaatttggagctactgtggarttactctc------tttc
DQ463793_C_P-B      atggacattgacccttataaagaatttggagcttctgcgcagttactctc------tttc
DQ463801_C_P-B      atggacattgacccttataaagaatttggagctactgcggagttactctc------tttc
JN792893_C_P-B      atggacattgacccttataaagaatttggagctactgcggagttactctc------tttc
JN792896_C_P-B      atggacattgacccttataaagaatttggcgctactgtggagttactctc------tttt
DQ463789_C_P-B      atggacatcgacccttataaagaatttggcgctactgtggagttactctc------tttt
DQ463797_C_P-B      atggacatcgacccttataaagaatttggcgctactgtggagttactctc------tttt
JN792895_C_P-B      atggacatcgacccttataaagaatttggcgctactgtggagttactctc------tttt
DQ463792_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
DQ463800_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttc
JN792898_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttc
JN792897_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttc
KP659249_C_P-B      atggacattgacccttataaagaatttggagcttctgcggagttactctc------tttt
JN792894_C_P-B      atggacattgacccttataaagaatttggagctactgcggagttactctc------tttc
AB287322_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
DQ463798_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
JN792899_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
DQ463790_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttc
JN792900_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
AB287316_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
DQ463794_C_P-B      atggacatcgacccttataaagaatttggagctactgcggagttactctc------tttc
KP659234_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttc
DQ463788_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
AB287314_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttc
AB287315_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttc
KP659235_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttc
KP659237_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttc
KP659246_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttc
KP659247_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttc
AB642093_C_P-B      atggacattgaccattataaagaatttggagcttctgtggagttactctc------tttt
AB300371_C_P-B      atggacatcgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB828708_C_P-B      atggacatcgacccttataaagaatttggagctactacggaattactctc------tttt
AB900097_C_P-B      atggacattgacccttataaagaatttggagcttctgttgagttactctc------tttt
AB073849_C_P-B      atggacatcgacccttataaagaatttggagcttctgtggaattactctc------tttt
AB900096_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB073853_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB931168_C_P-B      atggacatcgacccttataaagaatttggagctactggcgagttactctc------tttt
AB931169_C_P-B      atggacatcgacccttataaagaatttggagctactggcgagttactctc------tttt
AB302095_C_P-B      atggacatcgacccttataaagaatttggagctactgctgagttactctc------tttt
AB073858_C_P-B      atggacatcgacccttataaagaatttggagctactgcggagttactctc------tttt
AB073854_C_P-B      atggacatcgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB900102_C_P-B      atggacattgaccattataaagaatttggagcttctgtggagttactctc------tttt
AB900103_C_P-B      atggacatcgacccttataaagaatttggagcttctgcggagttactctc------tttt
MW887648_C_P-B      atggacatcgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB106884_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactttc------tttt
D50521_C_P-B        atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
D50522_C_P-B        atggacatcgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB073847_C_P-B      atggacattgacccgtataaagaatttggagcttctgctgagttactctc------tttt
AB900112_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
AB900106_C_P-B      atggacattgaccattataaagaatttggagcttctgtggagttactctc------tttt
AB014366_C_P-B      atggacatcgacccttataaagaatttggagctactgtggagttactctc------tttt
AB900108_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB900098_C_P-B      atggacattgacccttataaagaatttggagctactgycgagttavtctc------tttt
LC461174_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
LC461175_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB642101_C_P-B      atggacattgaccattataaagaatttggagcttctgtggagttactctc------tttt
AB362933_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------gttt
AB073855_C_P-B      atggacattgaccattataaagaatttggagcttctgtggagttactctc------tttt
AB900105_C_P-B      atggacattgacccatataaagaatttggagcttctgttgagttactctc------tttt
AB073838_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
AB073856_C_P-B      atggacattgatccttataaagaatttggagctactgtggagttactctc------tttt
AB073852_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttaatctc------tttt
D00329_C_P-B        atggacattgacccctataaagaatttggagctactgtggagttactctc------tttt
AB287327_C_P-B      atggacattgacccttataaagaatttggagcttctgcggagttactctc------tttt
AB900104_C_P-B      atggacatcgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB073857_C_P-B      atggacattgacccgtataaagaatttggagctactgtggagttactctc------tttt
AB900111_C_P-B      atggacattgacccttataaagaatttggagcttctgcggagttactctc------tttt
AB073851_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
AB010292_C_P-B      atggacatcgacccttataaagaatttggagctactactgagttactctc------tttt
LT992442_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
AB010290_C_P-B      atggacattgacccttataaagaatttggagcttctacggagttaatctc------tttt
AB010291_C_P-B      atggacattgacccttataaagaatttggagctactacggagttaatctc------tttt
AB073845_C_P-B      atggacattgacccttataaagaatttggagctactgtkgagttactctc------tttt
AB900107_C_P-B      atggacattgacccttataaagaatttggagctacttcggagttactctc------tttt
AB073850_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
AB300370_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
AB073842_C_P-B      atggacattgacacttataaagaatttggagctactgtggagttactctc------tttt
AB900095_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB287326_C_P-B      atggacatcgacccttataaagaatttggagctactgtggagttactctc------tttt
AB073844_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
D23678_C_P-B        atggacattgacccttataaagaatttggagcttctgcggagttactctc------tttt
AB073843_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
LC603638_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
MH932712_C_P-B      atggacattgacccttataaagaatttggagctactgcggagttactttc------tttt
AB246343_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
AB010289_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
D23679_C_P-B        atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
AB246341_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
AB205121_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
AB073846_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
AB073848_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------gttt
LC279268_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------gttt
LC279269_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------gttt
LC279270_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------gttt
LC279271_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------gttt
LC279272_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------gttt
LC279273_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------gttt
AB246342_C_P-B      atggacattgacccttataaagaatttggagctactgtggagttactctc------tttt
DQ993682_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
HM011499_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttamtctc------tttt
KX276858_C_P-B      atggacattgacccgtataaagaatttggagctwctgyggagttrmtctc------tttt
KX276819_C_P-B      atggacattgacccatataaagaatttggagcttctacggagttactctc------tttt
GQ924641_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MT645018_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------tttt
OK318668_C_P-B      atggacattgacccgtataaagaatttggagcttctgttgagttactctc------tttt
OK318659_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
OK318675_C_P-B      atggacatcgacccgtataaagaatttggagcttctttggagttactctc------tttt
OK318673_C_P-B      atggacattgacacctataaagaatttggagcttccgtggagttactctc------tttt
MG826152_C_P-B      atggacattgacccgtataaagaatttggagcttctgctgagttactctc------tttt
AY800391_C_P-B      atggacatcgacccgtataaagaatttggagcttctttggagttactctc------tttt
AY800392_C_P-B      atggacatcgacccgtataaagaatttggagcttctttggagttactctc------tttt
OK318670_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KX276829_C_P-B      atggacattgacmcgtataaagaatttggagcttctgtggagttactctc------tttt
OK318658_C_P-B      atggacattgacacctataaagaatttggcgcttctgtagagttactctc------tttt
HM011490_C_P-B      atggacattgacccgtataaagaatttggagcttctgttgagttactctc------tttt
OK318664_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KX276821_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924638_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
OK318671_C_P-B      atggacattgacccgtataaagaatttggagcctctgcggagttactctc------tttt
LC349868_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534634_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534709_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX765854_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924639_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB713531_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB713528_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
JQ027316_C_P-B      atggacattgacccgtataaagaatttggagcctctgcggagttactctc------tttt
LC349877_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276828_C_P-B      atggacattgacccgtataaagaatttggagcttctactgagttactctc------tttt
KU577070_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU577076_C_P-B      atggacattgacacgtataaagaattcggagcttctgtggagttactctc------tttt
KU577077_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ023633_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881956_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881955_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881945_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881949_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881951_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881958_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881957_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881948_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881946_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881947_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881950_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881952_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881953_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881944_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881954_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924625_C_P-B      atggacattgacccgtataaagaatttggagcgtctaccgagttactctc------tttt
AB713532_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
LC416037_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AB493833_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB713527_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY629635_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ023576_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KC774369_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttgctctc------tttt
KC774370_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173401_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173402_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774418_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY629636_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148373_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148392_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagtcactctc------tttt
KP148391_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148396_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148394_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148388_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148382_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactccc------tttt
KP148367_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148368_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148369_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148370_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148371_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148372_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148374_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148375_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148376_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148377_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148379_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148380_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148383_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148384_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148385_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148386_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148387_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148389_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148390_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148395_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148397_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148398_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148400_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148401_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148402_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148403_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148451_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148378_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148416_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148437_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148426_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148407_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148433_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148418_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148438_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148435_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148415_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148414_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148405_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148432_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------cttt
KP148410_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148424_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148429_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148440_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148425_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148423_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148421_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148420_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148413_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148406_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148411_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148419_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148427_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148430_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148439_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148409_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993707_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY033072_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY033073_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993706_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ023636_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX765841_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ023632_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675796_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675802_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675803_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
HQ700546_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675794_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675795_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675805_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675806_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675807_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675797_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675799_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675801_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675804_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB231909_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675798_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675800_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534699_C_P-B      atggacattgacccgtataaagaatttggagcttctacggagttactctc------tttt
MK534698_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU330996_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU330989_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU330990_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534702_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU330995_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534697_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU330992_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU330994_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU330998_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU330999_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU331000_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU331001_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU330997_C_P-B      atggacattgacccgtataaaggatttggagcttctgtggagttactctc------tttt
OK318661_C_P-B      atggacattgacccctataaagaatttggagcttctgtggagttactctc------tttt
GQ924617_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
OK318676_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276818_C_P-B      atggacattgacccctataaagaatttggagcttctgtggagttactctc------tttt
AB713529_C_P-B      atggacattgacccgggggaagaatttggagcttctgtggagttactctc------tttt
LC349879_C_P-B      atggacattgacccgtataaagaatttggagcttctgtcgagttactctc------tttt
OK318666_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KX276814_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
JQ429080_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
OK318662_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
OK318667_C_P-B      atggacatcgacccgtataaagaatttggagcttctcatgagttactctc------tttt
JQ341502_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
LC349875_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803755_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803758_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
LC349869_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
LC349874_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
HM011492_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
LC349872_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
AB713530_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB493835_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB033554_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
JQ429082_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
JQ429081_C_P-B      atggacattgacccgtataaagaatttggagcttctggagagttactctc------tttt
AB219430_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
HQ700548_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
M54923_C_P-B        atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EF473972_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM526759_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803787_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB033555_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
LC349873_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AP011085_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
D00331_C_C-B        atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ358136_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
HM011496_C_P-B      atggayatygacacstataaagaatttggagcytctgcggagttactctc------tttt
KU576069_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
KU576070_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
AB334303_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB355454_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB334302_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB334299_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB334300_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB334301_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB048705_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
KU679959_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AY269078_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AF324106_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AF324101_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AY269065_C_P-B      atggacattgacccttataaagaatttggagcttccgtggagttactctc------tttt
KU667763_C_P-B      atggacattgacccgtataaaggatttggagcttctgtggagttactctc------tttt
KU667836_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667813_C_P-B      atggacattgacccgtataaagaatttggagcttctgtgtagttactctc------tttt
KU667774_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667729_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667800_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667827_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU667752_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667788_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY353928_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668105_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttgctctc------tttt
KU576624_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576660_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576600_C_P-B      atggacattgacgcctataaagaatttggagcttctgtggagttactctc------tttt
KU576618_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667929_C_P-B      atggacattgaccactataaagaatttggagcttctgttgagttactctc------attt
KU576773_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576064_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU667896_C_P-B      atggacattgacccgtataaagaacttggagcttctgtggagttactctc------tttt
KU668173_C_P-B      atggacattgacccgtataaagaatctggagcttctgtggagttgctctc------tttt
KU667952_C_P-B      gtggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667407_C_P-B      atggacattgacccgtttaaagaatttggagcttctgtggagttactctc------tttt
KU667733_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668216_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667590_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667439_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668336_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667568_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668250_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668157_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668277_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576986_C_P-B      atggacattgacgcctataaagaatttggagcttctgtggagttgctctc------tttt
KU667420_C_P-B      atggacattgacccgtatgaagaatttggagcttctgtggagttactctc------tttt
KU668170_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactttc------tttt
KU668193_C_P-B      atggacattgacccgtataaagaatttggaacttctgtggagttactctc------tttt
KU668357_C_P-B      atggacattgaccagtataaagaatttggagcttctgtggagttactctc------tttt
KU668366_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------cttt
KU576606_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576597_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576598_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576988_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576989_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576609_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576501_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576500_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576496_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576507_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576016_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576020_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576015_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576018_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576495_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575966_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575971_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY269097_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------gttt
KU576638_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576639_C_P-B      atggacatggacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689423_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667874_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KU576132_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576087_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576100_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576086_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576085_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576157_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576084_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576153_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576090_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576096_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576088_C_P-B      atggacattgacccgtataaagaatttggagcttttgtggagttactctc------tttt
KU667516_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689404_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689503_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667577_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KF164967_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
KY689488_C_P-B      atggacattgacacctataaaccatttggagcttctgtggagttactctc------tttt
KU576691_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KU576522_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668008_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttaccctc------tttc
KU575938_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575941_C_P-B      atggacattgacgtgtataaagaatttggagcttctgtggagttactctc------tttt
KU667993_C_P-B      atggacattgacccgtataaagaatctggagcttctgtggagttactctc------tttc
KU575942_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KU575937_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575940_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667447_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881864_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------attt
KY689557_C_P-B      atggacattgacccgtataaagmatttggagcttctgtggagttactctc------tttt
KY689523_C_P-B      atggacattgaccygtataaagaatttggattttctgtggagttactctc------tttt
KU575921_C_P-B      atggacattgacgcctataaagaatttggagcttctgtggagttactctc------tttt
KU667605_C_P-B      atggacattgacgcctataaagaatttggagcttctgtggagttactctc------tttt
KU668324_C_P-B      atggacattgacgcctataaagaatttggagcttctgtggagttactctc------tttt
KY689445_C_P-B      atggacattgacccgtataaagaatttggagcttctggagagttactctc------tttt
KU668059_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576460_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KY689458_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576251_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576255_C_P-B      atggacattgactcgtataaagaatttggagcttctgtggagttactctc------tttt
KU576254_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576397_C_P-B      atggacattggctcgtataaagaatttggagcctctgtggagttactctc------tttt
KU576467_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttaccctc------tttt
KU668287_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576493_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU667777_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU667780_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MF568461_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU668274_C_P-B      atggacattgacccgtataaagaatttgaagcctctgtggagttactctc------ttct
KU668316_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576398_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU668337_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU668265_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576413_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576411_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576408_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576402_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576395_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU668297_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tctt
KU576406_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576470_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU668306_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU668256_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576499_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576466_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576407_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576399_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576386_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576400_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576401_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576412_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576419_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU667520_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576970_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576968_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576969_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KF165906_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689433_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689410_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
KY689505_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
KY689506_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
KY689507_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
KU576331_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576189_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX661482_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KY689448_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KY689534_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU576152_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576155_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576151_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576149_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576154_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576150_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KY353930_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803801_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576979_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MN689122_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MN689120_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MN689121_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MN689123_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576420_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575953_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575977_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689480_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689563_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689472_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689546_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689517_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689443_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534614_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576191_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttaatctc------tttt
AF335751_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576188_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341530_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668335_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576309_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576310_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY582137_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY269100_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173342_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KF165328_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173341_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667484_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttacactc------tttt
KU667457_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667515_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667445_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576980_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668344_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576975_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668345_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668323_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576978_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576982_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576983_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576984_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576985_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576981_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MN689118_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tgtt
KX276827_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ027311_C_P-B      atggacattgacccgtataaagaatttggagcttctgygmmrttactctc------tttt
AJ298864_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
OK318660_C_P-B      atggacatcgacccgtataaagaatttggagcttctgccgagttactctc------tttt
GQ924645_C_P-B      atggacattgacccatataaagaatttggagcttctacggagttactctc------tttt
FJ023620_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023617_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023618_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023573_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------ttta
FJ667207_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
JF775482_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
JF775483_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023630_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023629_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023628_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023627_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023613_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023610_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023608_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023605_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023607_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023609_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023611_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023612_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023614_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ023606_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
KJ803824_C_P-B      atggacattgacccgtataaagaatttggagcttctacggagttactctc------tttt
JQ341505_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924635_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
KU576380_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU576385_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU576379_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU576381_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU576383_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
MN689119_C_P-B      atggacattgacccgtataaagaatttggagcttctgcgcagttactctc------tttt
KJ803797_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341493_C_P-B      atggacattgacgcstataaagaatttggagcttctgtggagttactctc------tttt
JQ341515_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924637_C_P-B      atggacattgacatctataaagaatttggagcttctgtggagttactctc------tttt
MT426101_C_P-B      atggacattgacccgtataaagaatttggagcttcttcggagttactctc------tttt
AF324088_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MF674492_C_P-B      atggacattgacccgtataaagaatttggagcgtctatcgagttagtctc------tttt
KX276823_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
OK318674_C_P-B      atggaccttgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534659_C_P-B      atggacatcgacccttataaagaatttggagcctctgtggagttactctc------tttt
KX276825_C_P-B      atggacattgacccgtataaagaatttggagcttctgttgagttactctc------tttt
KM526755_C_P-B      atggacattgacctgtataaagaatttggagcttcagaggagttactctc------tttt
KJ803775_C_P-B      atggacattgacccgtataaagaatttggagcttctacggagttactctc------tttt
MF674478_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttagtctc------tttt
KM526756_C_P-B      atggacatcgacccttataaagaatttggagcttcagtggagttactctc------tttt
KJ803786_C_P-B      atggacattgacccgtataaggaatttggagcttctgtggagttactctc------tttt
KU577089_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU576283_C_P-B      atggacattgacacatataaagaatttggagcttctgtggagttactctc------tttt
KU576280_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU576287_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU576292_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU576289_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU576291_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU576290_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU577088_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU667671_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU667672_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
AB023682_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
OK318677_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689468_C_P-B      atggacatygacccatataaagaatttggagcttctgtggagttactctc------tttt
OK318657_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674439_C_P-B      atggacattgacccgtataaagaatttggagcttcttcgcagttactctc------tttt
KU576277_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576279_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttagtctc------tttt
GQ924656_C_P-B      atggacattgatccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276820_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
JQ027334_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341499_C_P-B      atggacattgacccgtataaagaatttggagcttctrcggagttactctc------tttt
OK318665_C_P-B      atggacattgacccgtataaagaatttggagcttctattgagttastctc------tttt
KU577107_C_P-B      atggacattgaccactataaagaatttggagcttccgtggagttactctc------tttt
AB023667_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689484_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689556_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689496_C_P-B      atggacatcgacacctataaagaatttggagcctctgtggagttactctc------tttt
KX276830_C_P-B      atggacattgacccgtataaagaatttggagcttctacagagttactctc------tttt
KM526757_C_P-B      atggacattgacccgtataaagaatttggagcttcagtggagttactctc------tttt
KX276815_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc------tttt
HM011469_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc------tttt
KX276822_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc------tttt
MF674436_C_P-B      atggacatcgacccgtataaagaatttggagcttctgttgagttaatctc------tttt
GQ924626_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276824_C_P-B      atggacatygacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689426_C_P-B      atggacatygacccgtataaagaatttggagcttccgtggagttactctc------tttt
KY689520_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
KY689451_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU576746_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534612_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AP011094_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KU576653_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576648_C_P-B      atggacattgacccgtataaagaatttggagcttctgttgagttactctc------tttt
KU576654_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576655_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534608_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924628_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341509_C_P-B      atggacattgacmcstataamgawtttggagcttctgtggagttactctc------tttt
OK318669_C_P-B      atggacattgacccgtataaagaatttggagcttctacggagttactctc------tttt
KC774419_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
LC349870_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KJ803819_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB219429_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534621_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KX276817_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ439518_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439519_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439521_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439517_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439520_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439533_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439546_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439542_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc------tttt
MZ439543_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc------tttt
MZ439545_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc------tttt
MZ439532_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439530_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439525_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439526_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439528_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439531_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439534_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439522_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc------tttt
MZ439549_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc------tttt
MZ439551_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc------tttt
MZ439523_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439524_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439527_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439529_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439537_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439535_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439536_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439550_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MZ439540_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc------tttt
MZ439548_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc------tttt
MZ439539_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc------tttt
MZ439538_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc------tttt
MZ439544_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc------tttt
MZ439541_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc------tttt
MZ439547_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttactctc------tttt
JQ341463_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY269110_C_P-B      atggacattgacccgtataaagaatttggagcctctgctgagttactctc------tttt
DQ993680_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ377158_C_P-B      atggacattgacccatataaagaatttggagcttccgtggagttactctc------tttt
MF674441_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB368295_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AF323467_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF324070_C_P-B      atggacattgacccgtataaagaatttggagcttgtgtggagttactctc------tttt
GQ358147_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaggtactctc------tttt
GQ358145_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaggtactctc------tttt
GQ358146_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaggtactctc------tttt
MF674464_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993687_C_P-B      atggacattgacccgtataaagaatttggatcttctgcggagttactctc------tttt
DQ993683_C_P-B      atggacattgacccgcatcaagaatttggatcttctgtggagttactctc------tttt
GU827630_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF324073_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggaattactctc------tttt
AB205122_C_P-B      atggacattgacccgtataaagaatttggagcttctacggagttactctc------tttt
MF621878_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KF167010_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
AB212625_C_P-B      atggacattgacacgtataaagaatttggagcttctgcggagttactctc------tttt
AB219427_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT757445_C_P-B      atggacattgaccactataaagaatttggcgcttctgtggagttactctc------tttt
MT757449_C_P-B      atggacattgaccactataaagaatttggcgcttctgtggagttactctc------tttt
MT757455_C_P-B      atggacattgaccactataaagaatttggcgcttctgtggagttactctc------tttt
MT757454_C_P-B      atggacattgaccactataaagaatttggcgcttctgtggagttactctc------tttt
MT757440_C_P-B      atggacattgaccactataaagaatttggcgcttctgtggagttactctc------tttt
MT757441_C_P-B      atggacattgaccactataaagaatttggcgcttctgtggagttactctc------tttt
MT757447_C_P-B      atggacattgaccactataaagaatttggcgcttctgtggagttactctc------tttt
MT757443_C_P-B      atggacattgaccactataaagaatttggcgcttctgtagagttactctc------tttt
MT757446_C_P-B      atggacattgaccactataaagaatttggcgcttctgtagagttactctc------tttt
MT757456_C_P-B      atggacattgaccactataaagaatttggcgcttctgtagagttactctc------tttt
MT757452_C_P-B      atggacattgaccactataaagaatttggcgcttctgtggagttactctc------tttt
MT757436_C_P-B      atggacattgaccactataaagaatttggcgcttctgtggagttactctc------tttt
MT757438_C_P-B      atggacattgaccactataaagaatttggcgcttctgtggagttactctc------tttt
MT757442_C_P-B      atggacattgaccactataaagaatttggcgcttctgtggagttactctc------tttt
MT757444_C_P-B      atggacattgaccactataaagaatttggcgcttctgtggagttactctc------tttt
MT757439_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
MT757448_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
MT757453_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
MT757457_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
MT757451_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
MT757437_C_P-B      atggacattgaccactataaagaatttggcgcttctgtggagttactctc------tttt
MT757450_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
GQ855526_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341500_C_P-B      atggacattgacccstataaagaatttggagcttctgtggagttactctc------tttt
HM011467_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
MK534661_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttaatctc------tttt
MF674407_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
OK318663_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674481_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB100695_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MN689117_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ361535_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
AB976562_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AP011086_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
AP011087_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
KY689564_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ358148_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
GQ358149_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
GQ358152_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
GQ358150_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
AP011096_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
GQ358151_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KM526758_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
AP011093_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
AB031267_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924640_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EF473977_C_P-B      atggacattgacccgtataaagaattcggagcttctgtggagttactctc------tttt
AF324066_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY269108_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674448_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674415_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
AB241116_C_P-B      atggacattgacccgtataaagaatttggagcttctacggagttactctc------tttt
AB241117_C_P-B      atggacattgacccgtataaagaatttggagcttctacggagttactctc------tttt
JQ341504_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534680_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
DQ993686_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
AB908303_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB908299_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB908300_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB908304_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
LC349878_C_P-B      atggacattgacccgtataaagaatttggagcttcagtggagttactctc------tttt
MT731878_C_P-B      atggacattgacccgtataaagaatttggagcttctacggagttactctc------tttt
MK534575_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
OK318672_C_P-B      atggacattgacccgtataaagaatttggagcttctggagagttactctc------tttt
OK318656_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674385_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM526749_C_P-B      atggacattgacccgtataaagaatttggagcatccgtggagttactctc------tttt
GQ358144_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
GQ358143_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ023637_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ023575_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EF473971_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY269091_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674505_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KM526754_C_P-B      atggacattgacccgtataaagaatttggagcttcagtggagttactctc------tttt
AY517620_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB219428_C_C-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT645001_C_P-B      atggacattgacccgtataaagaatttggagcttctggagagttactctc------tttt
MF674470_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674487_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB031268_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MF674496_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MK038469_C_P-B      acggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038465_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038459_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF323470_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038461_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038448_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC836853_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038462_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038460_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038458_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038457_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038454_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038450_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038449_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038439_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038435_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038431_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038452_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038432_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038433_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038437_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038440_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038445_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038446_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038447_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038451_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038453_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038456_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038463_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038467_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038468_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038470_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674459_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
JQ429079_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB493827_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB023663_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------ttat
JQ707762_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707750_C_P-B      atggacattgaccactataaagaattcggagcttctgtggagttactctc------tttt
JQ707734_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707735_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707737_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707738_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707739_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707740_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707743_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707744_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707745_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707746_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707747_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707749_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707753_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707755_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707758_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707759_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707763_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707764_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707765_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707766_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707767_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707742_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707741_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707760_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707751_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707736_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707748_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707752_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707756_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707757_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707761_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ707754_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
JQ341464_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993681_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagtaactctc------tttt
MF674447_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC836847_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC836865_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC836872_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674473_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM526747_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ023634_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttt
EU660230_C_P-B      atggacattgacccgtataaagaatttggagcctctgcggagttactctc------tttt
EU660231_C_P-B      atggacattgacccgtataaagaatttggagcctctgcggagttactctc------tttt
EU660232_C_P-B      atggacattgacccgtataaagaatttggagcctctgcggagttactctc------tttt
EU660233_C_P-B      atggacattgacccgtataaagaatttggagcctctgcggagttactctc------tttt
DQ993685_C_P-B      atggacattgacccgcataaagaatttggagcttctgtggagtaactctc------ttat
AM888201_C_P-B      atggacattgacccgtataaagaatttggaccttctgtggagttactttc------tttt
AB031264_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MF674515_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674406_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173297_C_P-B      atggacattgacccctataaagaatttggagcttctgtggagttactctc------tttt
GQ358139_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AP011089_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB355455_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534696_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674434_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341486_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674508_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674491_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MF674479_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674476_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674433_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674419_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
MF674392_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MF674389_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674382_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148459_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
KM526752_C_P-B      atggacattgacccgtataaagaatttggagcatccgtggagttactctc------tttt
KM526748_C_P-B      atggacattgacccgtataaagaatttggagcatccgtggagttactctc------tttt
KM526751_C_P-B      atggacattgacccgtataaagaatttggagcatccgtggagttactctc------tttt
FJ023638_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF324069_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB219426_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
AB117759_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KC836830_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC836843_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689477_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB023677_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC836841_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC836863_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC836864_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY269131_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------cttt
AF324067_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AB355453_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB073835_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674409_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MW310263_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534626_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674497_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM526750_C_P-B      atggacattgacccgtataaagaatttggagcatccgtggagttactctc------tttt
KP148458_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
KP148460_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
MF674396_C_P-B      atggacattgacccgtataaagaatttggagcttctctggagttactctc------tttt
KP148457_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148453_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148452_C_P-B      atggacactgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148455_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148456_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148461_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674509_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674445_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674443_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674420_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MF674414_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
LC349871_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
HQ700549_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924621_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
GQ358140_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
GQ358137_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993694_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY269093_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB212626_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
AB115551_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB031266_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AP011090_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ358138_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AP011095_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
MF674451_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674462_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
MF674498_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
MW310261_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MW310262_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674446_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MF674466_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MF674499_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MF674490_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674438_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674432_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674421_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674400_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU234318_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674483_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ358141_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ349236_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EF473976_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AP011091_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674455_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674437_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674493_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674477_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674469_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MF674405_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674404_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674383_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674511_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674410_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674513_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674424_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674416_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674460_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674397_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674387_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ023635_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674431_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674453_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674488_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674384_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674461_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
GQ924651_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924654_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674452_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ358142_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AP011088_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AP011092_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674510_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674507_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
MF674495_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674456_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
MF674423_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
MF674401_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674394_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB031261_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB031263_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674393_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674395_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674413_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674482_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674500_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ027312_C_P-B      atggacattgayccgtataaagaatttggagcttctgtggagttamtctc------tttt
KY881837_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK818222_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
HM011477_C_P-B      atggacattgacacgtataaagaatttggagcttctgtgragttactctc------tttt
KX276795_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KX276792_C_P-B      atggacattgacgtctataaagaatttggagcttcygtggagttactctc------tttt
KU576893_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576894_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576895_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576750_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576896_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggtgttactctc------tttt
KU576897_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576890_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576889_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576888_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576886_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576891_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576887_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576892_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576898_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU668036_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667988_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU668045_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU668004_C_P-B      atggacatcgacacgtacaaagaatttggagcttctgtggagttactctc------tttt
KX276798_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KX276775_C_P-B      atggacattgacccgtataaagaatttggcgcttctgcggaattartctc------tttt
KX276800_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttamtctc------tttt
HM011487_C_P-B      atggacattgacccgtataaagaatttggagctaccacggagttagtctc------tttt
MG571326_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571329_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576125_C_P-B      atggacattgacccgtataaagaatttggagcgtctgtggagttactctc------tttt
KU576126_C_P-B      atggacattgacccgtataaagaatttggagcgtctgtggagttactctc------tttt
KU576130_C_P-B      atggacattgacccgtataaagaatttggagcgtctgtggagttactctc------tttt
KU576131_C_P-B      atggacattgacccgtataaagaatttggagcgtctgtggagttactctc------tttt
KU576127_C_P-B      atggacattgacccgtataaagaatttggagcgtctgtggagttactctc------tttt
HM011478_C_P-B      atggacattgacccatataaagaatttggagcttctgyksagttactctc------tttt
KU964280_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964286_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964276_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964283_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964274_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964282_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964272_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctt------tttt
KU964273_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964275_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964278_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964279_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964281_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964284_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964277_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964285_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU939678_C_P-B      atggacatcgacccgtataaagaatttggagcttctacggagttactctc------tttt
KX276791_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562260_C_P-B      atggacatygacacstataaagaatttggagcttccgtggagttactctc------tttt
MT622522_C_P-B      atggacattgacgtgtataaagaatttggagcttccgtggagttactctc------tttt
EU547563_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU158263_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY206383_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM875420_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
FJ562311_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MG571357_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689490_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
KY689559_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
KY689560_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
KX276793_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
HM011476_C_P-B      atggacattgacccgtataaagaatttggagcttctattgagttactctc------tttt
FJ562312_C_P-B      atggacattgacgtctataaagaatttggagcttctgtggagttactctc------tttt
FJ032342_C_P-B      atggacatcgacccgtataaagaatttggagcctctgcggagttaatctc------tttt
AB073841_C_P-B      atggacattgacccgtataaagaatttggagcttctacggagttactctc------tttt
KY689406_C_P-B      atggacattgacccgtataaagaatttggagcttctactgagttactctc------tttt
HM011480_C_P-B      atggacattgacccctataaagaatttggagcttctgtggagttactctc------tttt
GQ924632_C_P-B      atggacattgacccctataaagaatttggagcttctgtgcagttactctc------tttt
KU577047_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU577046_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU577048_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341508_C_P-B      atggacattgacccgtataaagaatttggagcttctgttgagttactctc------ttty
AY269128_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341503_C_P-B      atggacattgacccgtataaagaatttggaggttctgtggagttactctc------tttt
EU522072_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU522073_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU522075_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ027325_C_P-B      atggacattgacccgtataaagaatttggagcttctgyggagttactctc------tttt
AB900110_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276801_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU939674_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
FJ899790_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
FJ899791_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KJ803789_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
X97850_C_P-B        atggacattgacccgtataaagaatttggagcttctgtggaattactctc------tttt
KX276806_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377644_C_P-B      atggacattgacccgtataaagaatttggagcttctgtcgagttactctc------tttt
DQ904357_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB073825_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ787475_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ787476_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY689417_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
EU939671_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KC774397_C_P-B      atggacattgatccttataaagaatttggagcttctattgagttactctc------tttt
JQ341480_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406163_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KP406164_C_P-B      atggacattgacccgtttaaagaatttggagcttctgtggagttactctc------tttt
KP406162_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406166_C_P-B      atggacattgacccgtttaaagaatttggagcttctgtggagttactctc------tttt
JQ801516_C_P-B      atggacattgacccgtataaagaatttggagcttctacggagttactctc------tttt
KP406176_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406177_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406178_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406179_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406180_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406181_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406182_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406183_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406185_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406184_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406197_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406219_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406190_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406191_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406193_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406196_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406201_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406202_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406204_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406205_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406206_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406207_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406209_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406211_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406212_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406213_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406215_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406218_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406186_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406187_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406189_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406192_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406194_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406198_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406199_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406203_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406208_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406210_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406214_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406216_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406188_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406195_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406200_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
KP406217_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
FJ562222_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AF282917_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964258_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggaattactctc------tttt
KU964270_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU964257_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU964259_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU964260_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU964261_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU964262_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU964263_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU964264_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU964265_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU964267_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU964268_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU964269_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU964271_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KU964266_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
KJ803768_C_P-B      atggacattgacgtgtataaagaatttggagcttctgtggagttactctc------tttt
EF494381_C_P-B      atggacattgacccgtataaagaatttggagctaccgtggagttactctc------tttt
KX276810_C_P-B      atggacattgacccgtataaagaatttggagcttctgtkgagttactctc------tttt
KU668070_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562259_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KY689419_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY220697_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggaattactctc------tttt
KU576924_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668361_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KU668360_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KU667413_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KU576923_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KU668322_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KU668354_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KU668371_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KU668343_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KU667603_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KU668334_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KU576305_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576303_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576300_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576307_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576306_C_P-B      atggacattgactcgtataaagaatttggagcttctgtggagttactctc------tttt
KU576299_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576308_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576288_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576304_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576295_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576302_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406277_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactcgc------tttt
KP406276_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactcgc------tttt
KP406275_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactcgc------tttt
KP406272_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactcgc------tttt
KP406263_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactcgc------tttt
KP406278_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactcgc------tttt
KP406274_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactcgc------tttt
KP406264_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactcgc------tttt
KP406255_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactcgc------tttt
KP406265_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactcgc------tttt
KP406268_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactcgc------tttt
KP406270_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactcgc------tttt
KP406279_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactcgc------tttt
KP406261_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667714_C_P-B      atggacattgacacctataaagaatttggagcttcagtggagttactctc------tttt
AB365445_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668138_C_P-B      atggacattgacacctataaagaattcggagcttctgtggagttactctc------tttt
KU668088_C_P-B      atggacattgacacctataaaggatttggagcttctgtggagttactctc------tttt
KU576344_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576340_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU668063_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU667719_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU667716_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU577092_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU667720_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU667717_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttacgctc------tttt
KU667715_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576341_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576345_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU667718_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU667721_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576343_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU667713_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU667712_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU668104_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU668130_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU668111_C_P-B      atggacattgacacctataaagaatttggagcttctgtggaattactctc------tttt
KU668074_C_P-B      atggacattgacacctataaagaatttggagcttctgtggaattactctc------tttt
KU668122_C_P-B      atggacattgacacctataaagaatttggagcttctgtggaattactctc------tttt
AY269109_C_P-B      atggacattgacccgtataaagaatttagagcttcagtggagttactctc------tttt
KU668081_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667680_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668019_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668060_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU939663_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KX276773_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173378_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU939639_C_P-B      atggacatcgacccgtataaagaatttggagcatctgcggagttactctc------tttt
GQ377610_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
EU919175_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU919176_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JF436921_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY596112_C_P-B      atggacattgacccgtataaagaatttggagcttctgctgagttactctc------tttt
FJ386681_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttt
KU576342_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576853_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
MK038158_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggggttactctc------tttt
MG571372_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576301_C_P-B      atggacattgacccgtataaagaatttggagcttttgtggagttactctc------tttt
KM213032_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
JX429901_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU939669_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ899779_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AY220703_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
AY220704_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KU576293_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU660224_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
EU882003_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU882004_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406173_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406165_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KP406167_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KP406171_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689476_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406331_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU487256_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY206375_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF324082_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB073837_C_P-B      atggacattgacccgtataaagaatttggagcttctggagagttactctc------tttt
MK038163_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX504532_C_P-B      atggacattgacccgtataaagaatttggagcttctttggagttactctc------tttt
FJ562253_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562231_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562224_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK534691_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KJ173298_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037505_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------cttt
KP406318_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KP406319_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KP406320_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KP406321_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KP406322_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KP406324_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KP406325_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KP406326_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KP406327_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KP406328_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KP406329_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KP406323_C_P-B      atggacattgacgcgtagaaagaatttggagcttctgtggagttactctc------tttt
MK040760_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KP406330_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KP406332_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KP406334_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KP406333_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KP406335_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040753_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040754_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040755_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040763_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040768_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KP406232_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406243_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406241_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406237_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406234_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406238_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406240_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406220_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406221_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406222_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406223_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406224_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406225_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406227_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406228_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406229_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406230_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406231_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406236_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406233_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406235_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406242_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ032349_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386675_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038141_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571350_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MG571334_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571327_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KM213036_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB642094_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562289_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576297_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377519_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM875416_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM875417_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM213034_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU881997_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU881998_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ040147_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK534673_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470834_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470837_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470841_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470832_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470840_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470833_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470830_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470835_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470836_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470839_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470838_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
HM011482_C_P-B      atggacattgacrydtataaagaatttggagcttctgtggagttactctc------tttt
HM011475_C_P-B      atggacatygacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ027313_C_P-B      atggacattgacccgtataaagaatttggmgcttcakyggagttactctc------tttt
KX276794_C_P-B      atggacattgacccgtataaagaatttggmgcttcakcggagttactctc------tttt
KX276779_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276789_C_P-B      atggacattgacccgtataaagaatttggagcttcttcggagttactctc------tttt
KX276797_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
HM011484_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KM875418_C_P-B      atggacattgacctgtataaagaatttggagcttctgtggagttactctc------tttt
KX276787_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ995804_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggaattgatctc------tttt
KU668369_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576713_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576702_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576707_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576710_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576709_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576820_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576708_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576700_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576701_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576705_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576706_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668309_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668332_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667987_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttgctctc------tttt
KU576718_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667997_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668003_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668359_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037633_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttt
MG571325_C_P-B      atggacattgacccgtataaagaatttggagctcctgtggaattaatctc------tttt
KX276807_C_P-B      atggacattgacccgtataaagaatttggagcytctgtggagttactctc------tttt
DQ993684_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341495_C_P-B      atggacattgacccgtataaagaatttggagcttctgyggagttactctc------tttt
KX276811_C_P-B      atggacatcgacmcctataaagaatttggagcttctgtggagttactctc------tttt
JQ341492_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc------tttt
JQ027330_C_P-B      atggacattgaccastataaagaatttggagcttctgtggagttactctc------attt
JQ027331_C_P-B      atggacattgaccastataaagaatttggagcttctgtggagttactctc------attt
MG571358_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttaatctc------tttt
JQ341498_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576418_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc------tttt
KU576416_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc------tttt
KU576415_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc------tttt
KU576414_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc------tttt
KU576417_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc------tttt
KU668150_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggggttactctc------tttt
KU668188_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668171_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668195_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276783_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
MG571375_C_P-B      atggacattggcccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576101_C_P-B      atggacattgacccgtataaacaatttggagcttctgtggaattactctc------tttt
KU576106_C_P-B      atggacattgacccgtataatgaatttggagcttctgcggagttactctc------tttt
KU576114_C_P-B      atggacattgacccgtataaacaatttggagcttctgtggacttactctc------tttt
KU576111_C_P-B      atggacattgacccgtataaacaatttggagcttctgtggacttactctc------tttt
KU576113_C_P-B      atggacattgacccgtataaacaatttgaagcttctgtggaattactctc------tttt
KU576108_C_P-B      atggacattgacccgtataaacaatttggagcttctgtggaattactctc------tttt
KU576109_C_P-B      atggacattgacccgtataaacaatttggagcttctgtggaattactctc------tttt
KU576112_C_P-B      atggacattgacccgtataaacaatttggagcttctgtggaattactctc------tttt
KU576105_C_P-B      atggacattgacccgtataaggaatttggagcttctgtggagttactctc------tttt
KU576107_C_P-B      atgaacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276790_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KY689402_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689501_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689502_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU939675_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276774_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689444_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc------tttt
HM011504_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341466_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924646_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG372436_C_P-B      atggacattgacccgtataaagaatttggagcttcagtggagttactctc------tttt
KX276799_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KX276778_C_P-B      atggayattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY269105_C_P-B      atggacattgacccgtataaagaatttggagcctctgcggagttactctc------tttt
AB073824_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttaatctc------tttt
FJ386608_C_P-B      atggacattgacccgtataaagaatttggagcttctgtagagttactctc------tttt
DQ995803_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY269102_C_P-B      atggacattgacccgtataaagaatttggagcgtctgttgagttactctc------tttt
MK037500_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaatgactctc------gttt
MK040734_C_P-B      atggacgttgacccgtataatgaatttggagcttctgtggaatgactctc------gttt
MK040736_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaatgactctc------gttt
MK037484_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaactactctc------gttt
MK037498_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaatgactctc------gttt
MK037491_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------gttt
MK037495_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------ggtt
MK037482_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactttc------gttt
MK037479_C_P-B      atggacattaacacctataaagaattcggagcttctgtggaattactctc------gttt
MK040735_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------gttt
MK037488_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------gttt
MK037485_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------gttt
MK037494_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------gttt
MK037490_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------gttt
MK037481_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------gttt
MK037489_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------gttt
MK040733_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------gttt
MK040738_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------gttt
MK037483_C_P-B      atggacattgacacctataaagaattcggagcttcggtggaattactctc------gttt
MK037492_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------gttt
MK037486_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------gttt
MK040737_C_P-B      atggacattgacacctataaagaattcggagcttctgtggaattactctc------gttt
MK037499_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaatgactctc------gttt
MG571333_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ801506_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341467_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
FJ562296_C_P-B      atggacatygacccgtataaagaatttggagcttctgyggagttactctc------kttt
AJ627225_C_P-B      atggacatcgacccgtataaagaatttggagcttctgcggagttactctc------tttt
AY167098_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY596105_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341476_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571339_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341469_C_P-B      atggacattgacccgtataaagaatttggagcttctattgagttactctc------tttt
JQ341479_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037885_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576950_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674422_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU667519_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667905_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667597_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667972_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667570_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576392_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667578_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576393_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ032353_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ032352_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ032354_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU939633_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU939634_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406172_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406175_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406170_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406168_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406169_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406174_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF461360_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803784_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341494_C_P-B      atggacattgacmcgtataaagaatttggagcttctgtggagttactctc------tttt
MK038203_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037880_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571361_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KU576051_C_P-B      atggacattgacacgtataaagcatttggagcttctgtggagttactctc------tttt
AY167101_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037877_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562257_C_P-B      atggacattgacccgtataaagaatttggagcctctgcggagttactctc------tttt
EU306679_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306680_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306677_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306678_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306681_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038314_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038195_C_P-B      atggacattgacccgtataaagaatttggagctcctgtggagttactctc------tttt
KP148332_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038326_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038325_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038309_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038296_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038204_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
MK038190_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038187_C_P-B      atggacattgacccgtataaagaatttggggcttctatggagttactctc------tttt
MK038180_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038177_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148366_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148364_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148329_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534732_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MK534611_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038328_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038327_C_P-B      atggacattgacccgtacaaagaatttggagcttctgtggagttactctc------tttt
MK038321_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038301_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038298_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038295_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038293_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038201_C_P-B      atggatattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038199_C_P-B      atggacattggcccgtataaagaatttggagcttctatggagttactctc------tttt
MK038197_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038194_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038192_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038189_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038188_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
MK038183_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038178_C_P-B      atggacattgacccgtataaagaatttggggcttctgtggagttactctc------tttt
MK038173_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038172_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
MK038182_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
MK038184_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
MK038171_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038168_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038174_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038179_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038181_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038185_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038186_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038191_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038193_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037553_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148363_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148356_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148335_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148333_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148326_C_P-B      atggacattgacccgtataaagaatttggggcttctgtggagttactctc------tttt
KP148321_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148317_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148322_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148325_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148361_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148314_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148323_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148334_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377641_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038292_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038294_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038300_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038302_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038315_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038317_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038322_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038330_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX661478_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148318_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148319_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148320_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148324_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148327_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148328_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148330_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148331_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148357_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148359_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148360_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148362_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148365_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534578_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534599_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534600_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534602_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173411_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaattactctc------tttt
KJ173412_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaattactctc------tttt
KC774362_C_P-B      atggacattgacccttataaagaatttggagcatctggggagttactctc------tttt
JQ341472_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341459_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924631_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341491_C_P-B      atggacattgacccgtataaagaatttggagcttctgyggagttactctc------tttt
JQ341485_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341473_C_P-B      atggacattgacmcgtataaagaattyggagcttctgtggagttactctc------tttt
JQ341462_C_P-B      atggacattgacccgtataaagaatttgragcttctgtggagttactctc------tttt
KU667560_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562236_C_P-B      atggacattgacccgtataaagaatttggagcttctacggagttactctc------tttt
FJ386676_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY800389_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341460_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341461_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY596103_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576389_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576390_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576391_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576394_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689491_C_P-B      atggacattgacccgtaggctgaatttggagcttctgcggagttactctc------tttt
MT426993_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562237_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341501_C_P-B      atggacattgacccgtataaagaatttggagctactgtggagttactctc------tttt
JQ341490_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341489_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341484_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377561_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU796071_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
AF233235_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
MK534676_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964108_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964111_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964113_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964115_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964120_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964119_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964109_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964110_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964112_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964114_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964116_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964118_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964121_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964122_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964117_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426959_C_P-B      atggacattgacccgtacaacgaatttggagcttctgtggagttactctc------tttt
JQ341483_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttt
KU576869_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576866_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576867_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576870_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576871_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576872_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576873_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576868_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562322_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341510_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341482_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427009_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427003_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427001_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426976_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964101_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
EU796067_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ144561_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ144598_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341470_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341465_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341496_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964096_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KU964098_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KU964100_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KU964102_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KU964105_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KU964107_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KU964104_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KC774406_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EF134945_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EF134946_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689479_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386642_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU139543_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB246340_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MK534708_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KC774394_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148344_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426969_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427006_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426999_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426997_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426994_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426980_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426979_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426975_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426974_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426972_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426970_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426964_C_P-B      atggacattgacccgtataaagaatctggagcttctgtggagttactctc------tttt
MT426961_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426990_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426960_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426962_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426957_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426955_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426951_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427002_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426945_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426939_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426988_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426938_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426929_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426918_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426915_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426914_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426911_C_P-B      atggacattgacccgtataaagaatttggagctgctgtggagttactctc------tttt
MT426910_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426984_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426906_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426916_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426931_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426947_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426950_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426967_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426981_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426996_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427010_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427011_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815760_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ518812_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377537_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426907_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426908_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426909_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426912_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426913_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426917_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426919_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426920_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426921_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426922_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426923_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426924_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426925_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426926_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426927_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426928_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426930_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426932_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426933_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426934_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426935_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426936_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426937_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426940_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426941_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426942_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426943_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426944_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426946_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426948_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426949_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426952_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426953_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426954_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426956_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426958_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426963_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426965_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426966_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426968_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426971_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426973_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426977_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426978_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426982_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426983_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426985_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426986_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426987_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426989_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426991_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426992_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426995_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426998_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427000_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427004_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427005_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427007_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427008_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427012_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427013_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427014_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427015_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT645005_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MK818225_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
EU564822_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU564824_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU564823_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK818223_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KJ410500_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276776_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AY206387_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KF166001_C_P-B      atggacatcgacccatataaagaatttggagcttctgcggagttactctc------tttt
GQ924630_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
HM011471_C_P-B      atggacatcgacccgtataaagaatttggagcgtctattgagttactctc------tttt
MG571336_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY596111_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276804_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
FJ562246_C_P-B      atggacattgacmcgtataaagaatttggagcttctgtggarttactctc------tttt
HM011466_C_P-B      atggacattgacacgtataaagaatttggagcctctgcggagttactctc------tttt
KJ803816_C_P-B      atggacattgacacgtataaagaatttggagcttctgcggagttactctc------tttt
KY881845_C_P-B      atggacattaacacgtataaagaatttagagcttctgtggagttactctc------tttt
KX276770_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
HM011474_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU939661_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KU576848_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576753_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------tttt
KU576237_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576703_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576626_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576641_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576632_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576765_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576856_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576854_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576843_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576693_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576692_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttg
KU576637_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576766_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576754_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576681_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576647_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576630_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576240_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576619_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576620_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576629_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576633_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576640_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576645_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576656_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576698_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576704_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576714_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576738_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576748_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576751_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576845_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576874_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576623_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276781_C_P-B      atggacattgacccrtataaagaatttggagcttctgtggagttactctc------tttt
KJ803825_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU579441_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
EU570075_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
FJ032344_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
EU589335_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
FJ386656_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KX276786_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactttc------tttt
KJ803805_C_P-B      atggacattgacccgtataaagaatttggagcttctatggacttaatctc------tttt
FJ386648_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------tttt
HM011494_C_P-B      atggacattgacacstataaagaatttggagcttctgtggagttactctc------tttt
EU939677_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------tttt
KX276813_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------tttt
HM011503_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
HM011470_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY167102_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
KY689414_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689500_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
JQ341474_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY689469_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY689516_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667858_C_P-B      atggacattgacccgtataaagaatctggagctcctgtggagttactctc------tttt
KJ803821_C_P-B      atggacattgacccgtataaagaatttggagcttctgctgagttactctc------tttt
EU487257_C_P-B      atggacattgacccgtataaagaatttggagcttctgtgccgttactctc------tttt
JQ341488_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689481_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341468_C_P-B      atggacattgaccygtataaagaatttggagcttctgtggagttactctc------tttt
X98077_C_P-B        atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803808_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
AF157021_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF157022_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX504533_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993698_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993710_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667659_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF157020_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341487_C_P-B      atggacattgacmcgtataaagaatttggagcttctgtggagttactctc------tttt
KX276809_C_P-B      atggacattgacccgtataaagaatttggagctactgtggagttactctc------tttt
KT749820_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MT645016_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803795_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803781_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803783_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY217362_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KX276788_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ995802_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
GQ377606_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AY163869_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY163870_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341471_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386660_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
AB555498_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ751766_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ751769_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803756_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576778_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM875426_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
FJ386658_C_P-B      atggacattgacccgtataaagaatttggagcttctgtagagttactctc------tttt
FJ023631_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668232_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KU668261_C_P-B      atggacattgacccgtataaagaatttagagcttctatggagttactctc------tttt
KU668241_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KU576921_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KU668270_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KU668252_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KU668222_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KU668342_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KU668353_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KU668333_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
AY217355_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AY217356_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU522074_C_P-B      atggacatcgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881853_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881869_C_P-B      atgggcattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881849_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881865_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU668258_C_P-B      atggacactgacccgtataaagaatttggagctcctgtggagttactccc------tttt
KJ790200_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KJ803752_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341475_C_P-B      atggacattgacmcgtataaagaatttggagcttctgtggagttactctc------tttt
MK037572_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040806_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
OK106254_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MF674465_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KJ173385_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406258_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KP406256_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KP406259_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KP406267_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571370_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KY689453_C_P-B      atggacattgacccgtataaagaatttggagcttctacggagttaatctc------tttt
MK037963_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037949_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037675_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037669_C_P-B      atggacattgactcgtataaagaatttggagcttccgtggagttactctc------tttt
MK037869_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037672_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037971_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037673_C_P-B      acggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037982_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037980_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037977_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037965_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037866_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037868_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037974_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037703_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037564_C_P-B      atggacattgacccgtataaagaatttggagcttccctggagttactctc------tttt
MK038428_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037867_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037563_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037569_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037951_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK038429_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037809_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037973_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037959_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037955_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037941_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037953_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037962_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037964_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037968_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037969_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037985_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037946_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037981_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037944_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037943_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037956_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagttactctc------tttt
MK037960_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037975_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037976_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037967_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037957_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037942_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037940_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037945_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037948_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037950_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037952_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK037972_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MG571321_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaattactctc------tttt
JX504531_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
JQ040138_C_P-B      atggacattgacctgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386669_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AB555499_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571340_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667956_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667551_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU882002_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
AY517488_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
AY167094_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB073830_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964123_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964124_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964128_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964129_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964131_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964134_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964136_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964137_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964127_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964132_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964125_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964126_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964130_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964133_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964135_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KC492739_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX429910_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924647_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY217361_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576938_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP036970_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AY217364_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
JQ040157_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
DQ144602_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
AF480349_C_P-B      atggacattgacccgtataaagaatttggagctactgtggagttactctc------tttt
AF480341_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF480364_C_P-B      atggacattgacccgtatatagaatttcgagcttctggggagttactctc------tttt
AF480353_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF480351_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
AF480343_C_P-B      atggacattgacctgtataaagaatttggagcttctatggagttactctc------tttt
AF480363_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
AF480352_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
AF480348_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
AF480360_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
AF480346_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
AF480359_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
AF480361_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF480358_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
AF480350_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF480340_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
AF480354_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
AF480347_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
AF480337_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
AF480344_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
AF480342_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF480356_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
AF480339_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF480355_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
AF480345_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
AF480338_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
AF480357_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
AF480362_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
MF674391_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MZ671237_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675786_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ755833_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667637_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667649_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576803_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576808_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040907_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK040901_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK037798_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK037799_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK037803_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK037796_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK037797_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK037808_C_P-B      ---gacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK037807_C_P-B      -----cattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK037806_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK037805_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK037801_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK037800_C_P-B      atggacattgacacgtataaagaatttggagcttccgtggagctactctc------tttt
MK037802_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK037804_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK040905_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK040906_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagctactctc------tttt
MK038313_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571363_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667739_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774405_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
JX504538_C_P-B      atggacactgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX026883_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX026881_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576807_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576809_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KX276777_C_P-B      atggacattgacmcgtataaagaatttggagcttctgtggagttactctc------tttt
KU668234_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------cttt
KJ173362_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU939559_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MT426104_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------cttt
KU576990_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576621_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576617_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576612_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576614_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU667507_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562316_C_P-B      atggacattgacacttataaagaatttggagcttctgtggagttactctc------tttt
EU919173_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
MK037910_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU577118_C_P-B      atggacattgacacctataaagaatttggatgttctgtggagttactctc------tttt
KT749851_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
JX507213_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
JX026886_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttaatctc------tttt
JQ040169_C_P-B      atggacattgacmcgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562234_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
KU964287_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964289_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964290_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964291_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964292_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964293_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964294_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964295_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964296_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964297_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964298_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964299_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964300_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964301_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964302_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964288_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040808_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagtcactctc------tttt
MG571373_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377525_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MT426103_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534576_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040831_C_P-B      atggacattgacccgtataaagaatttgaagcttctgtggagttactctc------tttt
MK037776_C_P-B      atggacattgacccgtataaagaatttggagctgctgtggagttactctc------tttt
MG571349_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674450_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY470960_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470961_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY417926_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963828_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963829_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963830_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963831_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963832_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963833_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963834_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963835_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963836_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963837_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963838_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963839_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963840_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963841_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963855_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576322_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803820_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
KJ173403_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173404_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774413_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377582_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377550_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562240_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU939664_C_P-B      atggacattgacacgtataaagaatttggagcttcgktggarttactctc------tttt
EU939637_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AB205120_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AB073822_C_P-B      atggacattgacacstataaagaatttggagcttctgtggagttactctc------tttt
JQ341477_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ040128_C_P-B      atggacattgacacgtataragaatttggagcttctgtggagttactctc------tttt
FJ518811_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386600_C_P-B      atggacattgacacgtataaagaaaatggagcttctgtggagttactctc------tttt
DQ144550_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF324089_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY689553_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
HM153811_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggaattactctc------tttt
KU668124_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668061_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576794_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576792_C_P-B      atggacattgacccgtataaagaatttggagctgctgtggagttactctc------tttt
KU576788_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576783_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576782_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576781_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576777_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576784_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576785_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576793_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668115_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668133_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668149_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576780_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037587_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctt------tttt
KU667574_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386636_C_P-B      atggacattgacmcstataaagaatttggagcttctgtggagttactctc------tttt
AF233237_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU305547_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF157023_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AF157025_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AF157024_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571324_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173339_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173340_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689551_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689538_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689508_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689513_C_P-B      atggacattgacccstataaagaatttggagcttctgtggagttactctc------tttt
KY689514_C_P-B      atggacattgacccstataaagaatttggagcttctgtggagttactctc------tttt
MK040834_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040812_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037528_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttc
MH663473_C_P-B      atggacattgatccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571371_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667686_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667555_C_P-B      atggacattgacccgtataaagaatttggggcttctgtggagttactctc------tttt
KU576186_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148582_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173368_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774404_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
KC774386_C_P-B      atggacattgacccttataaagaatttggagcatctgtggagttactctc------tttt
KC774372_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX869998_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX507210_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------ttta
JQ801471_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562254_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU522066_C_P-B      atggacatcgacacctataaagaatttggagcttctgtggagttactctc------tttt
EU306703_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306699_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY596106_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AY269120_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY269095_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ144564_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ144594_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815699_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815706_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815707_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815710_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815701_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963960_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963962_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963963_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963964_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963965_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963968_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963969_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963970_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963971_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963972_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963973_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963974_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963975_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963961_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963966_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963967_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038144_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667702_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386582_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037814_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668009_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ475340_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY217357_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
AY217358_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
FJ032357_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
FJ032358_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
MT645025_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881721_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881722_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881723_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881724_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881725_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881726_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881727_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881728_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881729_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881730_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881731_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881732_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881733_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881734_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881735_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881740_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881741_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881745_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881746_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881747_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881752_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881753_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881756_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881757_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881759_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881760_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881761_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881778_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881779_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173386_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
DQ448626_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881789_C_P-B      acggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AY596110_C_P-B      atggacattgacccgtataaagaatttggagcttctgttgagttactctc------tttt
KU667676_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576472_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
AB073823_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KC774380_C_P-B      atggacattgacccttataaagaatttggagcatctgtggagttactctc------tttt
KC774388_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
KY689511_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY689408_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037610_C_P-B      -tggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534711_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK534704_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534683_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534658_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK534627_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------gttt
MK052965_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040866_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040864_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040861_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagctactctc------tttt
MK040860_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040858_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040844_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040832_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
MK038248_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038245_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038230_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038226_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038218_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038217_C_P-B      atggacattggcccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038209_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037926_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037917_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037911_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037794_C_P-B      atggacattgacccgtataaagaatttggtgcttctgtggagttactctc------tttt
MK037789_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037775_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037599_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037596_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037525_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttt
MG826153_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MG571362_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674485_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668099_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactccc------tttt
MK040865_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactccc------tttt
KU667823_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667708_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576325_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KR152339_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148581_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148345_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM392084_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC836861_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774410_C_P-B      atggacattgacacgtataaagaatttggagcctctgtggagttactctc------tttt
KC774392_C_P-B      atggacattgacccttataaagaatttggagcatctgtggagttactctc------tttt
KC774382_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
KC774377_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KC774374_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
KC774368_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
JX661477_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX661476_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX661470_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX429899_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ801524_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815778_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815712_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815587_C_P-B      atggacattgacccgtatgaagaatttggagcttctgtggagttactctc------tttt
GQ924644_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
GQ924607_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ787444_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386684_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386666_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386610_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386584_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU939676_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU439020_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaggtactctc------tttt
EU306712_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaattactctc------tttt
EU306707_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306702_C_P-B      atggacattgacccgtataaggaatttggagcttctgtggagttactctc------tttt
DQ144591_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY766463_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF100308_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB073831_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040859_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510641_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510649_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510652_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306711_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF335738_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
MK037792_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037791_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037787_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037784_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaattactctc------tttt
MK037783_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037782_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037497_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037788_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037785_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037786_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037790_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037793_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037795_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ801507_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB471854_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB471855_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ040170_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534710_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534705_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MK534703_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MK534693_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534733_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534692_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF324078_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU305548_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX429902_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173375_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
KJ173376_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
GQ377639_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148342_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU439021_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881785_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AF461362_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
GQ377567_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU964093_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964095_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964097_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964099_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964103_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964106_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964094_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037761_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU939666_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037765_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
GU815739_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815705_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815709_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815700_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815696_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815695_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB205119_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815679_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815680_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815681_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815683_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815684_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815685_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815686_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815687_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815688_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815689_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815691_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815692_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815693_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815694_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815697_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815698_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815702_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815703_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815704_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815708_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815711_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815713_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815715_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815716_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815717_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815718_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815719_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815720_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815721_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815723_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815724_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815725_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815726_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815727_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815728_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815729_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815730_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815731_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815732_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815733_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815734_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815735_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815736_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815737_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815738_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815740_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815741_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815742_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815743_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815744_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815745_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815746_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815722_C_P-B      atgggcattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426859_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426860_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426861_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426862_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148341_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534571_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963987_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaattactctc------tttt
KC774395_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
GU434372_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU434373_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963976_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963977_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963978_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963979_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963980_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963981_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963982_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963983_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963984_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963985_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963986_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963988_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963989_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774408_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674480_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037820_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674503_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
AP011084_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815612_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815609_C_P-B      atggacattggcccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815605_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815599_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815589_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815579_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815581_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815583_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815584_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815585_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815586_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815588_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815590_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815591_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815593_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815594_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815595_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815596_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815597_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815598_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815601_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815602_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815603_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815604_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815606_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815607_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815608_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815610_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815611_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815613_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815614_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815600_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------cttt
MK037923_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037919_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037918_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037907_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037898_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037921_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037937_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667427_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668002_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576328_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576324_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576321_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576319_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576326_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576327_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576320_C_P-B      atggacattgacccgtataaagaatttggagctcctgtggagttactctc------tttt
KJ173382_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173413_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX978431_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX429897_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924634_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510644_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510648_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510656_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040863_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534694_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JN406371_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377542_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377569_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774398_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037930_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037901_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037914_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037830_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037818_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037816_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037823_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037828_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037834_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037817_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815747_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815748_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815777_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY293309_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ448625_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774409_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF335740_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF335741_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB073834_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571342_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689554_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY689413_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT645041_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426900_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426893_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426890_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426887_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426878_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426867_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426863_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426864_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426865_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426866_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426868_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426869_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426870_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426871_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426872_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426873_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426874_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426875_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426876_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426877_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426879_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426880_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426881_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426882_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426883_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426884_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426885_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426886_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426888_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426889_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426892_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426894_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426895_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426896_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426897_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426898_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426899_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426901_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426902_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426903_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426904_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426905_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534591_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttaatctc------tttt
MK534572_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040870_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040871_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040868_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040855_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040850_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040846_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040845_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040841_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038319_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038244_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038241_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038240_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038229_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038227_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038223_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038222_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038215_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038212_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038210_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038167_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038166_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037835_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037614_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037613_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037591_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037527_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttt
MK037526_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttt
MK037529_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttt
MK037530_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttt
MK037531_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttt
MK037532_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttt
MK037533_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttt
MK037534_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------gttt
KY470962_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470954_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470953_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963799_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963800_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963801_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963802_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963803_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963804_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963805_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963806_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963807_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963808_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963809_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963810_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963811_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963812_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963813_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668101_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668100_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667869_C_P-B      atggacattgacccgtataaagaatctggagcttctgtggagttactctc------tttt
KU667860_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU577121_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU577120_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU577117_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KR232337_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KP148579_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148348_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148336_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148338_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148339_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148343_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148347_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173416_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KJ173417_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KJ173409_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173410_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173405_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173406_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173397_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KJ173398_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KJ173389_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173390_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173356_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173355_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173352_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173354_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774416_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC836857_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC836874_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774401_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774390_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
KC774387_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
KC774383_C_P-B      atggacattgacacgtataaagaatttggagcatctgtggagttactctc------tttt
KC774389_C_P-B      atggacattgacacgtataaagaatttggagcatctgtggagttactctc------tttt
KC774381_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
KC774363_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
KC774378_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
KC774384_C_P-B      atggacattgacccgtataaagaatttggagcatctgtggagttactctc------tttt
KC510646_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510653_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510659_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510642_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510655_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX661484_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX661473_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JF412801_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815780_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815776_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815775_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815773_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815772_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815774_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815779_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815781_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815782_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815783_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815765_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815761_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815764_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815754_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815753_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815752_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815751_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815749_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815750_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815755_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815756_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815757_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815759_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815762_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815766_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815767_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815768_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815769_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815770_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815771_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377587_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377566_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377568_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386683_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386655_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ023569_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactatc------tttt
EU796068_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
JX661471_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
EU595031_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173357_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU439018_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU439022_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU439023_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306709_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306705_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306700_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306701_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306704_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306706_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306708_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306710_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993708_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ975271_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ448628_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ144599_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ144560_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ144597_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY596102_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY518556_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ448624_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148583_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK052962_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426891_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF324086_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571356_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB675676_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377629_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148340_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB300364_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX661483_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT645057_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT645058_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY269135_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------cttt
AB073826_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY269115_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ448620_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993696_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993709_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386668_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377558_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377588_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377638_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377643_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU357842_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JF775480_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JF775484_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JF899335_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ040173_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ688405_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX661472_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX661474_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX661475_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX661481_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510643_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510647_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510650_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510651_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510654_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510657_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510658_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC510660_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774366_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173351_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173353_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173361_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173367_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173381_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173387_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173388_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173407_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173408_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173414_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173415_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148346_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148349_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP148580_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU577111_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU577115_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667695_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668097_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668098_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674512_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571355_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037611_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037612_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037615_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038216_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038219_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038220_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038221_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038224_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038225_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038231_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038233_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038234_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038237_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038238_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038239_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038242_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038246_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040847_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040848_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040849_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040852_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040854_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040857_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040867_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040869_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040872_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040873_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534554_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534570_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534581_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534603_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668102_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276802_C_P-B      atggacattgacctgtataaagaatttggagcttctgtggagttactctc------tttt
KU964381_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964382_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964383_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964384_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964385_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964388_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964391_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964393_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964395_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964397_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964386_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964387_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964389_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964390_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964392_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964396_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276812_C_P-B      atggacatygacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674440_C_P-B      atggacattgacccgtataaagaatttggagcttctgtgccgttactctc------tttt
KX276796_C_P-B      atggacattgacccgtataaagaatttggagcttctgygsmgttactctc------tttt
AB073832_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803773_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276816_C_P-B      atggacatygacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ801494_C_P-B      atggacatcgacccgtataaagaatttggagcttctgctgagttactctc------tttt
KY689483_C_P-B      atggacattgacmcgtataaagaatttggagcttctgtggagttactctc------tttt
MT426102_C_P-B      atggacattgacccgtataaagaatttggagcttctgtagagttactctc------tttt
HM011473_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571351_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY167093_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ801474_C_P-B      atggacatcgacccgtataaagaatttggagcttctattgagttactctc------tttt
MG571353_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
MG571376_C_P-B      atggacattgaccactataaagaatttggagcttctgtggagttactctc------tttt
KX276785_C_P-B      atggacattgacccgtataaagaatttggagcttctggcgagttactctc------tttt
GQ924624_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276771_C_P-B      atggacattgacccgtataaagaatttggagcttctgcgcagttactctc------tttt
EU939635_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276808_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173373_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276784_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX276803_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU919171_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924605_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993704_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF282918_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
X97851_C_P-B        atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341497_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576180_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576338_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576165_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576173_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576185_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576636_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571367_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU939665_C_P-B      atggacattgacmcgtataaagaatttggagcttctgtggagttactctc------tttt
KX276805_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571360_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ995805_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EF473974_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB073821_C_P-B      atggacattgacccgtataaagaatttggagcttctggggagttactctc------tttt
EU158262_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB302945_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB302942_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB302944_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB302943_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM213035_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KY689555_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571368_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803796_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571338_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU939670_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
DQ448622_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ843165_C_P-B      atggacattgacccgtataaagaatttggagcttccatggagttactctc------tttt
EF473973_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
JQ341481_C_P-B      atggacattgacccgtataaagaattcggagcttctgtggagttactctc------tttt
MG571374_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571331_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ410490_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
FJ562262_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU919172_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
AY596109_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF335748_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386654_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037912_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037913_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037936_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037902_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037909_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774367_C_P-B      atggacattgatccttataaagaatttggagcttctatggagttactctc------tttt
DQ993705_C_P-B      atggccattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037595_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668093_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF121247_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037619_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576024_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803817_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774400_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
JX661480_C_P-B      atggacattgacccgtataaagaatttggagcttctatggagttactctc------tttt
GQ924611_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668027_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EF494380_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576940_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF479684_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF121248_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571348_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX870001_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF233234_C_P-B      atggacattgacgcgtataaagaatttggagcttctgtggagttactctc------tttt
AF233231_C_P-B      atggacattgacccgtataaagaatttggtgcttctgtggagttactctc------tttt
KU964158_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964154_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964168_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964153_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964159_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964160_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964167_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964156_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964157_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964161_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964162_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964163_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964166_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038139_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038143_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038142_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038135_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038131_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038133_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038134_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF335746_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF335754_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173374_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK075117_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY217359_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY217360_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306695_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306697_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306698_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU306696_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576939_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
MK038162_C_P-B      gtggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038159_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038151_C_P-B      atggacattgacccgtataaagaatttggagctcctgtggagttactctc------tttt
MK038149_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038129_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038132_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038165_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038160_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038155_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038147_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038146_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038145_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173399_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173400_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038137_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038153_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038157_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038161_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038164_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT111595_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038264_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038090_C_P-B      atggacattgacccgtataaagaatttggagcctctgcggagttactctc------tttt
MK037648_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571364_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964164_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668108_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU577003_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576022_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774396_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815572_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924606_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ995801_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
D00330_C_P-B        atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB246339_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB287328_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963842_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963843_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963844_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963845_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963846_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963847_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963848_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963849_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963850_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963851_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963852_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963853_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038120_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038117_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038116_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038101_C_P-B      atggacattgacccgtataaagaatttagagcctctgtggagtcactctc------tttt
MK038128_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038127_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038103_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038097_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038089_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038096_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038088_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038084_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038099_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038114_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038115_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038121_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038124_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038126_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038027_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963825_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963824_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963814_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963815_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963817_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963818_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963820_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963821_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963822_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963823_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963826_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963827_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963854_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963819_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040856_C_P-B      atggacattgacccgtataaggaatttggagcttctgtggagttactctc------tttt
MK038030_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037997_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037991_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386583_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038012_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038031_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038123_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038118_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038107_C_P-B      atggacattgacccgcataaagaatttggagcctctgtggagttactctc------tttt
MK038086_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038122_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038113_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038111_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038108_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038081_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038082_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038083_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038092_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038102_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038106_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038109_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038110_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038112_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038119_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK038093_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KC774412_C_P-B      atggacattgatccttataaagaatttggagcttctatggagttactctc------tttt
KC774407_C_P-B      atggacattgatccttataaagaatttggagcttctgtggagttactctc------gttt
KC774393_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF324085_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576040_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576053_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576054_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU577004_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576052_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576044_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576042_C_P-B      atggacattgacccgtatagagaatttggagcttctgtggagttactctc------tttt
KU576041_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576038_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576026_C_P-B      atggacattgacccgtatgaagaatttggagcttctgtggagttactctc------tttt
JX429900_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774411_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576039_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576045_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576043_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EF473975_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ410507_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ410516_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ410517_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040877_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ671236_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MW310264_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT426100_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038311_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttgctctc------tttt
MK037813_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037647_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037618_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037617_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MH061283_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571347_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571346_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571341_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571322_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KX765856_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963951_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668069_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU577081_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803764_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173369_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173370_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX869999_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ040125_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815678_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386634_C_P-B      atggacattgacccatataaagaatttggagcttctgtggagttactctc------tttt
EU570069_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993700_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993701_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993702_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ448619_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY220698_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY167097_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF121251_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF121249_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB073840_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB073833_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
DQ448623_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668116_C_P-B      atggacattggcccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668037_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668046_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668058_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774417_C_P-B      atggacattgatccttataaagaatttggagcttctgtggagttactctc------tttt
KC774402_C_P-B      atggacattgatccttataaagaatttggagcttctgtggagttactctc------tttt
KC774391_C_P-B      atggacattgatccttataaagaatttggagcatctgtggagttactctc------tttt
KC774373_C_P-B      atggacattgatccttataaagaatttggagcttctgtggagttactctc------tttt
KC774379_C_P-B      atggacattgatccttataaagaatttggagcatctgtggagttactctc------tttt
KC774385_C_P-B      atggacattgatccttataaagaatttggagcatctgtggagttactctc------tttt
GU815677_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815676_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815673_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815669_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815668_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815664_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815662_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815659_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815657_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815646_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815641_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815640_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactccc------tttt
GU815635_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815627_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggatttactctc------tttt
GU815616_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815617_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815618_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815620_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815621_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815622_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815623_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815624_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815625_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815626_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815628_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815629_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815630_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815631_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815632_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815633_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815634_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815636_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815637_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815638_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815642_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815643_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815644_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815645_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815647_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815648_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815649_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815650_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815651_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815652_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815653_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815654_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815656_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815658_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815660_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815661_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815663_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815665_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815666_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815667_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815670_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815672_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815674_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815675_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815619_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037644_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037643_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037639_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037638_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037627_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037624_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037637_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037640_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037641_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037649_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037650_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040876_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037621_C_P-B      atggacattgacccgtataaagaatttggagctcctgtggagttactctc------tttt
MK037622_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534601_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM359440_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173420_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173421_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ801512_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF121243_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF121244_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF121245_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF121246_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX507215_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993699_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571328_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815558_C_P-B      gtggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ448621_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ801514_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY167089_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038232_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ671238_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ671239_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MZ675785_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534707_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
MK037626_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571366_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674426_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964165_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU964155_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963956_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963949_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM392072_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KM392083_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038312_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173422_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173423_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173359_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173360_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX661479_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX429908_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ801479_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JQ040171_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JN827419_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815573_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815554_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815552_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815564_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815550_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815548_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815549_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815551_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815553_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815555_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815556_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815557_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815559_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815560_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815561_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815562_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815563_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815565_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815566_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815567_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815568_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815569_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815570_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815571_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815575_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815576_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU451682_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
GQ924627_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924610_C_P-B      atggacattgaccggtataaagaatttggagcttctgtggagttactctc------tttt
GQ924603_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ855532_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963945_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963946_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963947_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963948_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963950_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963952_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963953_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963954_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963955_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963957_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963958_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU963959_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ855522_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377625_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377547_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU570071_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU570070_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB195933_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924653_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571369_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB073828_C_P-B      atggacattgatccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993697_C_P-B      atggacattgatccgtataaagaatttggagcttctgtggagttactctc------tttt
AB073827_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB073829_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB195934_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB195935_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ448627_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU350409_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ377612_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924608_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774375_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774399_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774403_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173343_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173345_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173365_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173366_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173424_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173425_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ803763_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674427_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674449_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571344_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571365_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037556_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038320_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667549_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------cttt
KU668293_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------tttt
KU576749_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------tttt
KU667539_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------tttt
KU576628_C_P-B      atggacatggacacgtataaagaatttggagcttctttggagttaccctc------tttt
KU576145_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------tttt
KU576736_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------tttt
KU667528_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667517_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------tttt
KU668302_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------tttt
KU576146_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576148_C_P-B      atggacattgacacgtataaagaatttggagcttctttggagttactctc------tttt
HM011483_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MG571352_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttgctctc------tttt
MK040784_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040782_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttacactc------tttt
MK040789_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
EU564825_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU564826_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU939636_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KX276772_C_P-B      atggacattgacccgtataaagaatttggagcttctgyggagttactctc------tttt
MG571337_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667891_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667531_C_P-B      atggacattgacacgtataaagaatttgtagcttctgtggagttactctc------tttt
MF568491_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttc
KU667859_C_P-B      atggacattgacccgtacaaagaatttggagcttctgtggagttactctc------tttt
KU667840_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667936_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668367_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668308_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU667938_C_P-B      atggacattgacccgtaaaaagaacttggagcttctgtggagatactctc------tttt
KU667422_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576387_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667438_C_P-B      atggacattgacccgtataaagaatttgaggcttctgtggagttactctc------tttt
KU667569_C_P-B      atggacattgacccgtataaagaatttgaggcttctgtggagttactctc------tttt
KU667508_C_P-B      atggacattgacccgtataaagaatttgaggcttctgtggagttactctc------tttt
KU667493_C_P-B      atggacattgacccgtataaagaatttgaggcttctgtggagttactctc------tttt
KU667460_C_P-B      atggacattgacccgtataaagaatttgaggcttctgtggagttactctc------tttt
KU667469_C_P-B      atggacattgacccgtataaagaatttgaggcttctgtggagttactctc------tttt
KU667540_C_P-B      atggacattgacccgtataaagaatttgaggcttctgtggagttactctc------tttt
KU667412_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttattctc------tttt
KU668358_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668318_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KU668330_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF568485_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668132_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668169_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667448_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KU668289_C_P-B      atggacattgacccgtataaagaatttggaacttctgtggagttactctc------tttt
KU668076_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KU667879_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667700_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667619_C_P-B      atggacgttgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668103_C_P-B      atggacgttgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668299_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668307_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667980_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668300_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------cttt
KU667955_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667996_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668167_C_P-B      atggacattaacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667492_C_P-B      atggacattgacccgtattaagaatttggagcttctgtggagttactctc------tttt
KU667957_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggggttactctc------tttt
KU668305_C_P-B      gtggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667812_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaattactctc------tttt
KU667740_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF568475_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668012_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667506_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667968_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668304_C_P-B      acggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667640_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667586_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactccc------tttt
KU667455_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668165_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU668014_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667817_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667787_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667647_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667473_C_P-B      atggacattgacccgtataaagaatctggagcttctgtggagttactctc------tttt
KU667481_C_P-B      atggacattgacccgtataaagaatctggagcttctgtggagttactctc------tttt
KU667701_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------cttt
KU667794_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------cttt
KU667768_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534727_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MG571354_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667944_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tttt
KU667951_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tttt
KU576622_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tttt
KU668259_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tttt
KU668229_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tttt
KU668278_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tttt
KU668202_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tttt
KU668249_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tttt
KU668238_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tttt
KU576611_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tttt
KU576613_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tttt
KU576616_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tttt
MF568474_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tttt
KU668290_C_P-B      atggacattgacccgtataaagaatttggcgcttctgtggagttactctc------tctt
KX276782_C_P-B      atggacattgacccgtataaagaatttggagcttctgyggagttactctc------tttt
MK038341_C_P-B      atggacattgacccgtataaaaaatttggagcttctgtggagttactctc------tttt
GQ924648_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AB073836_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173371_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactctc------tttt
KJ173372_C_P-B      atggacattgacccgtataaagaatttggagcctctgtggagttactccc------tttt
KP406273_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406260_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406257_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406280_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406269_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406271_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406262_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406266_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ386688_C_P-B      atggacattgacccgtataaagaatttggagcttctacggagttactctc------tttt
FJ386615_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU575981_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggtgttactctc------tttt
KU575927_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575922_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575982_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575976_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575959_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576740_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575983_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575979_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AF100309_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575945_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575973_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575974_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575975_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575978_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575980_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575984_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU575928_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
JX026879_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctctttttttttt
JX429911_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc---ttttttt
EU939638_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggaattactctc------tttt
FJ787477_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406249_C_P-B      atggacattgacccgtataaagaatttggagcttctgccgagttactctc------tttt
KP406246_C_P-B      atggacattgacccgtataaagaatttggagcttctgccgagttactctc------tttt
KP406244_C_P-B      atggacattgacccgtataaagaatttggagcttctgccgagttactctc------tttt
KP406247_C_P-B      atggacattgacccgtataaagaatttggagcttctgccgagttactctc------tttt
KP406248_C_P-B      atggacattgacccgtataaagaatttggagcttctgccgagttactctc------tttt
KP406251_C_P-B      atggacattgacccgtataaagaatttggagcttctgccgagttactctc------tttt
KP406252_C_P-B      atggacattgacccgtataaagaatttggagcttctgccgagttactctc------tttt
KP406253_C_P-B      atggacattgacccgtataaagaatttggagcttctgccgagttactctc------tttt
KP406254_C_P-B      atggacattgacccgtataaagaatttggagcttctgccgagttactctc------tttt
KP406245_C_P-B      atggacattgacccgtataaagaatttggagcttctgccgagttactctc------tttt
KP406250_C_P-B      atggacattgacccgtataaagaatttggagcttctgccgagttactctc------tttt
KJ173347_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173348_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173384_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173383_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815639_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
AY596104_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774376_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562303_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038474_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173379_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
FJ562219_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173377_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173380_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038503_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagtcactctc------tttt
MK038156_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038505_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038502_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038494_C_P-B      atggacattgacccttataaagaatttggagcttctgtggagttactctc------tttt
MK038487_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038489_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038498_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038499_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038504_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038497_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038492_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038475_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038509_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038490_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038493_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040775_C_P-B      atggacattgacccgtgtaaagaatttggagcttctatggagttactctc------tttt
KU667581_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KP406282_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406290_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406291_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406283_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MK040739_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040745_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040750_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040744_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040747_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KC774415_C_P-B      atggacattgacacgtataaagaatttggcgcttctgtggagttactctc------tttt
AY167100_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MK040748_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040749_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040740_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040742_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815574_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815577_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
GU815578_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MF674506_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
MG571323_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY470956_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667796_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667784_C_P-B      atggacattgacccgtataaagaatttggagctcctgtggagttactctc------tttt
MK040809_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038485_C_P-B      atggacattgacccgtataaagaattaggagcttctgtggagttactctc------tttt
MK038347_C_P-B      atggacattgacacgtataaagaatttggggcttctgtggagttactctc------tttt
KU667591_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038339_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038356_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038353_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038331_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038342_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038368_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038334_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667612_C_P-B      atggacattgacccgtataaagaatttggagctcctgtggagttactctc------tttt
KU576804_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU576806_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037570_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038501_C_P-B      atggacattgacccgtataaagaatttggggcttctgtggagttactctc------tttt
MK038478_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038357_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
AB287329_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaattactctc------tttt
MK038359_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038350_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038332_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038348_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038354_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038355_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038360_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KC774371_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KC774365_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038345_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MT448621_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173363_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173364_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK534573_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EU522067_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagtgactctc------tttt
MK534629_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038479_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038473_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038491_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037925_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038480_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038481_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038486_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038488_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406311_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406303_C_P-B      atggacatcgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406299_C_P-B      atggacattgacccgtataaagaatttggagcttctgcggagttactctc------tttt
KP406292_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406307_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406308_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406309_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406310_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406313_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406315_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406316_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406317_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406304_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406302_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406301_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406297_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406305_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406306_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406312_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406314_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406288_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406298_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406296_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406300_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406294_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406281_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KP406284_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406286_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406289_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406293_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406285_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KP406287_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
MK038268_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993711_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038058_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038291_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038287_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038284_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactccc------tttt
MK038278_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038066_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038063_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggaattactctc------tttt
MK038060_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038037_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038281_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038258_C_P-B      atggacgttgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038080_C_P-B      atggacgttgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038079_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038076_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038075_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038074_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038073_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038072_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038071_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038070_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038068_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038057_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038056_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038055_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038054_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038047_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038046_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038045_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038043_C_P-B      atggacattgacccgtatagagaatttggagcttctgtggagttactctc------tttt
MK038044_C_P-B      atggacattgacccgtatagagaatttggagcttctgtggagttactctc------tttt
MK038035_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038036_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038038_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038039_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038040_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038041_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038048_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038049_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038050_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038051_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038052_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038053_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038059_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038061_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038062_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038064_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038067_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038077_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038078_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038042_C_P-B      acggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038261_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038247_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038283_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038251_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038280_C_P-B      atggacattgacccgtataaagaatttggagcttccgtggagttactctc------tttt
MK038279_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038274_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagctactctc------tttt
MK038272_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038269_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038266_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038277_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038255_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038250_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038256_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038265_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038267_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038285_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038289_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KU667546_C_P-B      atggacattgacccgcataaagaatttggagcttctgtggagttactctc------tttt
KU963816_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037509_C_P-B      atggacattgtcacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037516_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037511_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040774_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagtaactctc------tttt
MK037512_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037510_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040769_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040790_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037515_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037522_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427097_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427056_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037519_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427108_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttaatcgc------tttt
MT427072_C_P-B      atagacattgacccgtataaagaatttggagcttctgtggagttactctc------ttct
MT427079_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactatc------ttct
MT427109_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------ttct
MT427104_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tcct
MT427086_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427089_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427082_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427075_C_P-B      atggacattgaccggtataaagaatttggagcttctgtggagttactctc------tttt
MT427067_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427066_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427062_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427055_C_P-B      atggacattgacccgtataaagaatgtggagcttctgtggagttactctc------tttt
MT427042_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427037_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427036_C_P-B      atggacattgacccgcataaagaatttggagcttctgtggagttactctc------tttt
MT427026_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427018_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040778_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040770_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037521_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037518_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037517_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040776_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040777_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
DQ993703_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427016_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427017_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427019_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427020_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427021_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427022_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427023_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427024_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427025_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427027_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427028_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427029_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427030_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427031_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427032_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427033_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427034_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427035_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427038_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427039_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427040_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427041_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427043_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427044_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427045_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427046_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427047_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427048_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427049_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427050_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427051_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427052_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427053_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427054_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427057_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427058_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427059_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427060_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427061_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427063_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427064_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427065_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427068_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427069_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427070_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427071_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427073_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427074_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427077_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427078_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427080_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427081_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427083_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427084_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427085_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427087_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427088_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427090_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427091_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427092_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427093_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427094_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427095_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427096_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427099_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427102_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427103_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427105_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427106_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427107_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MT427098_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tctt
MT427100_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tctt
MT427076_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttc
MT427101_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttc
AY206391_C_P-B      atggacatcgacccgtataaagaatttggagcttctgtggagttactctc------tttt
EF494382_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667811_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667825_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576876_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667834_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667773_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667668_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667835_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
JQ027315_C_P-B      atggacattgacctgtataaagaatttggagcttctgtggagttactctc------tttt
AB073839_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggatttactctc------tttt
MK037558_C_P-B      atggacatcgacccttataaagaatttggagctactgtggagttactctc------gttt
MK037827_C_P-B      atggacatcgacccttataaagaatttggagctactgtggagttactctc------gttt
MK037824_C_P-B      atggacatcgacccttataaagaatttggagctactgtggagttactctc------gttt
MK037831_C_P-B      atggacatcgacccttataaagaatttggagctactgtggagttactctc------gttt
KJ410502_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
JQ027329_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
GQ924660_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KM875427_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KC492740_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggacttactctc------tttt
KU964152_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964138_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964139_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964140_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964142_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964144_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964145_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964147_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964148_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964150_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964151_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964141_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964143_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964146_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964149_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
JX504543_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667801_C_P-B      atggacattgacacctataaagagtttggagcttctgtggagttactctc------tttt
KU667730_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU667828_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------cttt
KU668243_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KY881861_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU667789_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
FJ899786_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactccc------tttt
FJ899787_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU939672_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ899784_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
FJ899785_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AY206390_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AY238972_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881792_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU939667_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
FJ386680_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
FJ562321_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881838_C_P-B      gtggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU939660_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576879_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576875_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU576877_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881783_C_P-B      atggacattgacaagtataaagaatttggagcttctgtggagttactctc------tttt
GQ377622_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU796066_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881833_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881826_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagtcactctc------tttt
KY881834_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881830_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881825_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037995_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881799_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881829_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038029_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038023_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038018_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038000_C_P-B      atggacattggcacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881823_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881794_C_P-B      atggacattgacacgtataaagaatttggagcctctgtggagttactctc------tttt
KY881827_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881828_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881831_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881820_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881839_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881841_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881836_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881843_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881821_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881824_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881835_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881822_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881798_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
KY881796_C_P-B      atggacaccgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038013_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038010_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038003_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038001_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037988_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037990_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038005_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038015_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038032_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037989_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038026_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK038016_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038011_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038002_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037999_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037994_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038006_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK038009_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881842_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881808_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881797_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881788_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881786_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881780_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881781_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881782_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881784_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881787_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881790_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881791_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881793_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881800_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881801_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881795_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY689494_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY689562_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964080_C_P-B      atggacattgacacgcataaagaatttggagcttctgtggagttactctc------tttt
KU964082_C_P-B      atggacattgacacgcataaagaatttggagcttctgtggagttactctc------tttt
KU964091_C_P-B      atggacattgacacctataaagaatttggagcttatgtggagttactctc------tttt
KU964084_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964088_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964087_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964089_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964090_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964092_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964085_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU964079_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU964081_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU964086_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU964083_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KY881844_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881863_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881902_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881903_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881905_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881912_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881862_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881856_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881854_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881846_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881867_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881909_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881908_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881904_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881911_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881899_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881898_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881894_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881897_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881901_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881893_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881859_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881857_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881851_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881848_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881847_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881852_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881855_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881858_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881860_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881866_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881868_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881895_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881896_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881900_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881906_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881907_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881910_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881913_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KY881914_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
AF121250_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU576046_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU964394_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU964244_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU964246_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU964251_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU964253_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU964254_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU964247_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU964249_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964245_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964255_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964256_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KU964248_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
DQ144600_C_P-B      atggacattggcacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144585_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144544_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144554_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
MK052964_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144596_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144593_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144587_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144581_C_P-B      atggacattgacacctacaaagaatttggagcttctgtggagttactctc------tttt
DQ144574_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144559_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144589_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144551_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144606_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144592_C_P-B      atggacattgacacctataaagaatttgaagcttctgtggagttactctc------tttt
DQ144584_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144582_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144579_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144576_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144570_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144569_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144565_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144590_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144556_C_P-B      atggacattgacacctataaagaatttgaagcttctgtggagttactctc------tttt
DQ144595_C_P-B      atggacattgacacctataaagaatttgaagcttctgtggagttactctc------tttt
DQ144548_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144558_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144575_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144543_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144546_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144552_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144555_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144557_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144567_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144578_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144583_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144586_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
DQ144545_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KU577113_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
EU939679_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
FJ592177_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
FJ751767_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KY881850_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
KJ173418_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
KJ173419_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
FJ386682_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
EU939673_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037605_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037585_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037600_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037603_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040843_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040839_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040837_C_P-B      atggacattgacacgcataaagaatttggagcttctgtggagttactctc------tttt
MK040836_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040815_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK040838_C_P-B      atggacattgacccgtataaagaatttggagcttctgtggagttactctc------tttt
MK037590_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037604_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037608_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt
MK037602_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK040835_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037593_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037589_C_P-B      atggacattgacacgtataaagaatttggagcttctgtggagttactctc------tttt
MK037592_C_P-B      atggacattgacacctataaagaatttggagcttctgtggagttactctc------tttt

KP659255_C_P-B      ttgccttctgacttctttccgtcggctcgagatctcctagacaccgctgctgccttgtat
KP659221_C_P-B      ttgccttctgacttctttccgtcggctcgagatctcctagacaccgcctctgctttgttt
KP659250_C_P-B      ttgcctcttgacttctttccgtcggctcgagatctcctagacacygccgctgctttgtat
AB287317_C_P-B      ttgcctgatgacttctttccgtcggtgcgagatctcctagacaccgccgctgctttgtat
AB287318_C_P-B      ttgcctaatgacttctttccgtcggttcgagatctcctagacaccgccgctgctttgtat
KP659219_C_P-B      ttgcctaatgacttctttccgtcggttcgagatctcctagacaccgccgctgctttgtat
KP659240_C_P-B      ttgcctgctgacttctttccgtcggttcgagatctcctagacaccgcctntgctttgtat
AB287323_C_P-B      ttgcctactgacttctatccgtcggttcgagatctcctagataccgcctctgctttgtat
AB287324_C_P-B      ttgccttctgacttctttccgtcggctcgagatctcctagataccgcctctgctttgttt
AB287320_C_P-B      ctgccttctgacttctttccgtcggttcgagatctcctagacaccgccactgctttgtat
KP659248_C_P-B      ttgcctgctgacttctttccgtcggttcgagatctcctagacaccgcctctgctttgtat
AB287321_C_P-B      ttgcctgctgacttctatccgtcggttcgagatctcctagataccgccgctgctttgtat
KP659244_C_P-B      ttgcctgctgacttctatccgtcggttcgagatctcctagacaccgcctctgctttgtac
AB287319_C_P-B      ttgccttctgacttctttccgtcggtgcgagatctcctagacaccgcctctgctctgtat
KP659224_C_P-B      ttgccttctgacttctttccgtcggtgcgagatctcctagacaccgcctctgctctgtat
DQ463799_C_P-B      ttgcctgctgacttctttccgtcggttcgggatctcctagacaccgcatctgctttgtat
DQ463796_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgccactgctttgttt
DQ463795_C_P-B      ttgcctgctgacttctttccgtcggttcgggatctcctagacaccgcctctgctttgttt
DQ463787_C_P-B      ttgcctgctgacttctttccgtcggttcgggatctcctagacaccgcctctgctttgtat
DQ463791_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgcatctgctttgtat
DQ463802_C_P-B      ttgcctgctgacttctttccgtcggttcgggatctcctagacaccgcctctgctttgtat
KP659252_C_P-B      ttgcctaatgacttytttccgtcggctcgagatctcctggacaccgcctctgctttgtat
JN792901_C_P-B      ttgccttctgacttctatccgtcggttcgagatctcctagacaccgccgctgctttgtat
JN792902_C_P-B      ttgccttctgacttctttccgtcggttcgagatctcctagacaccgccgctgctttgtat
KP659223_C_P-B      ttgcctcatgacttctacccgtcagttcgagatctcctggacaccgccactgctttgtat
KP659254_C_P-B      ttgccttctgacttctttccgtcggctcgagatctcctagacaccgcctctgctttgtat
KP659220_C_P-B      ttgccttctgacttcttcccgtcggttcgagatctcctagacaccgcctctgccttgtat
KP659251_C_P-B      ttgccttctgacttctttccgtcggttcgagatctccttgacaccgccgctgctctgtat
KP659245_C_P-B      ttgcctattgacttctatccgtcggttcgagatctcctagacaccgccgctgctttgtat
KP659239_C_P-B      ttgcctcttgacttctttccgtcggttcgggatctcctagacaccgccgctgctttgtat
AB287325_C_P-B      ttgcctactgacttctttccatcggttcgagatctcctagataccgcctctgcgttgtat
KP659253_C_P-B      ttgcctactgacttctttccgtcggttcgagatctcctagacaccgcctctgctttgtat
DQ463793_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgccactgctttgtat
DQ463801_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgccactgctttgtat
JN792893_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgccactgctttgtat
JN792896_C_P-B      ttgcctactgacttctttccgtcggttcgagatctcctagacaccgccgctgctttgttt
DQ463789_C_P-B      ttgcctactgacttctttccgtcggttcgagatctcctagacaccgccgctgctttgttt
DQ463797_C_P-B      ttgcctactgacttctttccgtcggttcgagatctcctagacaccgccgctgctttgttt
JN792895_C_P-B      ttgcctactgacttctttccgtcggttcgagatctcctagacaccgccgctgctttgttt
DQ463792_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgcctctgctctgtat
DQ463800_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgcctctgctctgtat
JN792898_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgcctctgctctgtat
JN792897_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgcctctgctctgtat
KP659249_C_P-B      ttgcctactgacttctttccgtcggttcgagatctcctagacaccgccgctgctttgttt
JN792894_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgccgctgcgttgtat
AB287322_C_P-B      ttgccttctgacttctttccgtcggttcgagatctcctagataccgcctctgctttgtat
DQ463798_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgcctctgctttgtat
JN792899_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgcctctgctttgtat
DQ463790_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgccactgctttgtat
JN792900_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgccactgctttgtat
AB287316_C_P-B      ttgccttctgacttctttccgtcggttcgagatctcctagacaccgcatctgctttgtat
DQ463794_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgccgctgctttgtat
KP659234_C_P-B      ttgccttctgacttctttccgtcggttcgagatctcctagacaccgccgctgctttgtat
DQ463788_C_P-B      ttgccttctgacttctttccgtcggttcgggatctcctagacaccgccgctgctttgtat
AB287314_C_P-B      ttgccttctgacttctttccgtcggttcgagatctcctagacaccgcagctgctttgtat
AB287315_C_P-B      ttgccttctgacttctttccgtcggttcgagatctcctagacaccgcagctgctttgtat
KP659235_C_P-B      ttgccttctgacttctttccgtcggttcgagatctcctagacaccgccgctgctttgtat
KP659237_C_P-B      ttgccttctgacttctttccgtcggttcgagatctcctagacaccgctgctgctttgtat
KP659246_C_P-B      ttgccttctgacttctttccgtcggttcgagatctcctagacaccgctgctgctttgtat
KP659247_C_P-B      ttgccttctgacttctttccgtcggttcgagatctcctagacaccgccgctgctttgtat
AB642093_C_P-B      ttgcctywkgacttctttccgtcggtgcgrgatctcctagatacygcykytgctctgtat
AB300371_C_P-B      ttgcctcctgacttctttccgaacatacgagacctcctagatactgctgctgctttgtat
AB828708_C_P-B      ttgcctattgacttctttccgtcggtgcgagatctcctagataccgctgctgctttgtat
AB900097_C_P-B      ttgcctgctgacttttttccttcggtgcgagacctcctagataccgctgctgctctgtat
AB073849_C_P-B      ttgcctcaagacttctttccgtcgattcgagacctcctagataccgctgctgcactgtat
AB900096_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagacaccgctgctgctctgtat
AB073853_C_P-B      ttgccttctgacttctttccgtcggtgcgagatctcctagataccgccgctgctctgttt
AB931168_C_P-B      ttgcctcgtgacttctttccgtcggcgcaagacctcctagataccgctgctgctctgtat
AB931169_C_P-B      ttgcctcgtgacttctttccgtcggcgcaagacctcctagataccgctgctgctctgtat
AB302095_C_P-B      ttgcctcctgacttctttccgtcggcgcgagacctcctcgataccactgctgctctgtat
AB073858_C_P-B      ttgcctgctgacttctatccgtcggtgcgagacctcctagataccgctactgctctatat
AB073854_C_P-B      ttgccttctgacttctttccgtcggtgcgggacctcctagataccgcttctgctctgtat
AB900102_C_P-B      ttgccttctgacttctatccgtcggtgcgggaccttctagacaccgctactgctctgtat
AB900103_C_P-B      ttgcctcatgacttctttccgtcggcgcgagacctcctagataccgctgctgctctgtac
MW887648_C_P-B      ttgcctcatgacttctttccgtcggygcgagacctcctagataccgctgctgctctgtat
AB106884_C_P-B      ttgcctcctgacttctttccgtcggcgagagacctcctagataccgccgctgctctgtat
D50521_C_P-B        ttgcctgctgacttctttccgtcggtgcatgacctcctagataccgcttctgctttgtat
D50522_C_P-B        ttgcctgctgacttctttccgtcggtgcatgacctcctagataccgcttctgctttgtat
AB073847_C_P-B      ttgccttctgacttctttccgtcgatacgagacctcctagataccactgctgctctgtat
AB900112_C_P-B      ttgcctcaagacttctatccgtcggtgcgagacctcctagataccgcttctgctctgtat
AB900106_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgcgactgctctgtat
AB014366_C_P-B      ttgccttctgacttctttccgtcggtgcgagatctcctagatactgctgctgctctgtat
AB900108_C_P-B      ttgcctgctgacttctttccgtcggtgcgagacctcctagataccgctactgctctgtat
AB900098_C_P-B      ttgccttctgacttctttccgtcggtgcgagatctcctagataccgctgctgctctgtat
LC461174_C_P-B      ttgcctcatgacttctttccgtcggtgcgagacctcttagataccgcttctgctctgtat
LC461175_C_P-B      ttgcctcatgacttctttccgtcggtgcgagacctcttagataccgcttctgctctgtat
AB642101_C_P-B      ttgcctcaggacttctatccgtcggtgcgggatctcctcgataccgctgctgctctctat
AB362933_C_P-B      ttgcctgctgacttttatccgtcggtgcgagacctcttagataccgctgctgctctgtat
AB073855_C_P-B      ttgccttctgacttctttccgtcggtgcgggacctcctagataccgctgctgctctgtat
AB900105_C_P-B      ttgcctgctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
AB073838_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgccctgtat
AB073856_C_P-B      ttgccttctgacttctttccgtcggtgcgggacctcctagacaccgctgctgctctgtat
AB073852_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgcgactgctctgtat
D00329_C_P-B        ttgccttctgacttctttccgtcggtgcgggacctcctagataccgtctctgctctgtat
AB287327_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
AB900104_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
AB073857_C_P-B      ttgcctactgacttctttccgtcggtgcgggacctcctagataccgctgctgctctgtat
AB900111_C_P-B      ttgccttctgacttctatccgtcggtgcgagatctcctagataccgccgctgctctgtat
AB073851_C_P-B      ttgccttctgacttctatccgtcggtgcgggacctcctagacaccgctgctgctctgtat
AB010292_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
LT992442_C_P-B      ttgccttctgacttctttccgtcggtgcgagatctcctagataccgccgctgctctgtat
AB010290_C_P-B      ttgcctgctgacttctttccgtcggtgcgagaccttctagataccgctgctgctctgtat
AB010291_C_P-B      ttgcctgctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
AB073845_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctactagataccgctgctgctctgtat
AB900107_C_P-B      ttgccttctgacttctttccgtcggtgcgagatcttctagataccgccgctgctctgtat
AB073850_C_P-B      ttgccttctgacttctttccgtcggtgcgagatctcctagataccgctgctgctctgtat
AB300370_C_P-B      ttgcctcaggacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
AB073842_C_P-B      ttgccttctgacttctttccgtcggtgcgagatctcctagataccgctgctgctctgtat
AB900095_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctccttgatactgctgctgctctgtat
AB287326_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
AB073844_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctmgataccgctgctgctctgtat
D23678_C_P-B        ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
AB073843_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
LC603638_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgcattgtat
MH932712_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagatactgcggctgctctgtat
AB246343_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
AB010289_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgccgctgctctgtat
D23679_C_P-B        ttgccttctgacttctttccttcggtgcgagacctcctagataccgctgctgctctgtat
AB246341_C_P-B      ttgccttctgacttctttccgtcggtgcgagatctcctagataccgctgctgctctgtat
AB205121_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgcggctgctctgtat
AB073846_C_P-B      ttgccttctgacttctttccgtcggtgcgggacctcctagataccgctgctgctctgtat
AB073848_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
LC279268_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
LC279269_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
LC279270_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
LC279271_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
LC279272_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
LC279273_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
AB246342_C_P-B      ttgccttctgacttctttccgtcggtgcgagacctcctagataccgctgctgctctgtat
DQ993682_C_P-B      ttgccttctgactaccttccttctattcgagatcttctcgacaccgcctctgctctgtat
HM011499_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
KX276858_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
KX276819_C_P-B      ttgccttctgacttctttcctaatgctcgagatcttctcgacaccgccaccgctctgtat
GQ924641_C_P-B      ttgcctactgacttctatccttctgttcgagatcttctcgacaccgcctccgctctgtat
MT645018_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
OK318668_C_P-B      ttgccttctgacttctttccctctattcgagatcttctcgacacyayctctgctytacat
OK318659_C_P-B      ttgccttctgacttttttccttctattcgagatcttctcgacaccgcctccgctctgtat
OK318675_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccaccgctgctctgtat
OK318673_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccgctgctctgtat
MG826152_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccaccgctgctctgtat
AY800391_C_P-B      ttaccttctgacttctttccttctattcgagaccttctcgacaccgccaatgctatgttt
AY800392_C_P-B      ttaccttctgacttctttccttctattcgagaccttctcgacaccgccaatgctatgttt
OK318670_C_P-B      ttgcctaatgacttctttccgaatattcgagatcttctcgataccgccgctgctctgttt
KX276829_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
OK318658_C_P-B      ttgcctgctgacttctttccttccattcgagatcttctcgacaccgccaatgctctctac
HM011490_C_P-B      ttgccttctgacttctttccttctatacgggatcttctcgacaccgcttctgctctgtat
OK318664_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KX276821_C_P-B      ttgccttctgacttctwtccttctattcgagatcttctcgacaccgcctctgctttgtwt
GQ924638_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctccgccctgttt
OK318671_C_P-B      ttgccttctgacttctttccttctattcgrgaycttctcgacaccgcctctgctatgtat
LC349868_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcttccgctttgtat
MK534634_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK534709_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KX765854_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctctat
GQ924639_C_P-B      ttgccttctgacttctttccttctattcgggatcttctcgacaccgcctccgccctgtat
AB713531_C_P-B      ttgcctgctgacttctttccttctattcgagatcttctcgacaccgcctccgctttgtat
AB713528_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
JQ027316_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
LC349877_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctccgctttgtat
KX276828_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KU577070_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KU577076_C_P-B      ttgccttctgacttctgtccttctattcgagatcttctcgacaccgcctctgctctgtat
KU577077_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
FJ023633_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KY881956_C_P-B      ttgccttctgacttctttccttctatccgagaccttctcgacaccgcctctgctctgcat
KY881955_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgcat
KY881945_C_P-B      ttgccttctgacttctttccttctattcgagaccttttcgacaccgcctctgctctgcat
KY881949_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgcat
KY881951_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgcat
KY881958_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgcat
KY881957_C_P-B      ttgccttctgacttctttccttctgttcgagaccttctcgacaccgccgctgctctgtat
KY881948_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgccgctgctctgtat
KY881946_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgccgctgctctgtat
KY881947_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgccgctgctctgtat
KY881950_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgccgctgctctgtat
KY881952_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgtctctgctctgcat
KY881953_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgtctctgctctgcat
KY881944_C_P-B      ttgccttctgacttctttccttctgttcgagaccttctcgacaccgccgctgctctgtat
KY881954_C_P-B      ttgccttctgacttctttccttctgttcgagaccttctcgacaccgccgctgctctgtat
GQ924625_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB713532_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
LC416037_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
AB493833_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctttgtat
AB713527_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KY629635_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
FJ023576_C_P-B      ttgccttctgacttttttccttctattcgagatcttctcgacaccgcctctgctctgtat
KC774369_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KC774370_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KJ173401_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KJ173402_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KC774418_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
KY629636_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
KP148373_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgcactgtat
KP148392_C_P-B      ttgccttctgacttctttcctcctattcgagatcttctcgacaccgcctctgctctgtat
KP148391_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148396_C_P-B      ttgccttctgacttctttccttctattcaagatcttctcgacaccgcctctgctctgtat
KP148394_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148388_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148382_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148367_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148368_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148369_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148370_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148371_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148372_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148374_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148375_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148376_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148377_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148379_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148380_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148383_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148384_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148385_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148386_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148387_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148389_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148390_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148395_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148397_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148398_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148400_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148401_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148402_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148403_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148451_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148378_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148416_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148437_C_P-B      ttgccctctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148426_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148407_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148433_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148418_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148438_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148435_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148415_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccgcctctgctctgtat
KP148414_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148405_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccgcctctgctctgtat
KP148432_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148410_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148424_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148429_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148440_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148425_C_P-B      ttgccttctgacttcttcccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148423_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148421_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcggcaccgcctctgctctgtat
KP148420_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148413_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148406_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148411_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148419_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148427_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148430_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148439_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148409_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
DQ993707_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AY033072_C_P-B      ttgccttccgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AY033073_C_P-B      ttgccttccgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
DQ993706_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
FJ023636_C_P-B      ttgcctgctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KX765841_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
FJ023632_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ675796_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ675802_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ675803_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
HQ700546_C_P-B      ttgccttctgatttctttcctaatattcgagatcttctcgacaccgcctctgctctgtat
MZ675794_C_P-B      ttgccttctgatttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ675795_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ675805_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ675806_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ675807_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ675797_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ675799_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ675801_C_P-B      ttgccttctgacttctttcctgctattcgagatcttctcgacaccgcctctgctctgtat
MZ675804_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB231909_C_P-B      ttgccttctgacttctttcctgctattcgagatcttctcgacaccgcctctgctctgtat
MZ675798_C_P-B      ttgccttctgacttctttcctgctattcgagatcttctcgacaccgcctctgctctgtat
MZ675800_C_P-B      ttgccttctgacttctttcctgctattcgagatcttctcgacaccgcctctgctctgtat
MK534699_C_P-B      ttgcctggcgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK534698_C_P-B      ttgccttctgacttttttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU330996_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgccctgtat
EU330989_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU330990_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK534702_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU330995_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacgccgcctctgctctgtat
MK534697_C_P-B      ttgccttctgacttctttccttccattcgagatcttctcgacaccgcctctgctctgtat
EU330992_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU330994_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU330998_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU330999_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU331000_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU331001_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU330997_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
OK318661_C_P-B      ttgccttctgacttctttccttccattcgagatcttctcgacaccgcccatgctttgcat
GQ924617_C_P-B      ttgccttctgacttctttccttctatacgggatcttctcgacaccgcttctgctctgtat
OK318676_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcckctgctctgtat
KX276818_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgtctctgctctgtat
AB713529_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacgccgcctctgctctgtat
LC349879_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctatgttt
OK318666_C_P-B      ttgccttctgacttctttccttccattcaagatcttcgcgacaccgcctctgctttgtat
KX276814_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
JQ429080_C_P-B      ttgcctkctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
OK318662_C_P-B      ttgccttctgacttctttccttccattcaagatcttcgcgacaccgcctctgctctgtat
OK318667_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
JQ341502_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
LC349875_C_P-B      ttgccttctgacttctttccttccattcgagatcttctcgacaccgcctctgctctgtac
KJ803755_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaatgctctgtat
KJ803758_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaatgctctgtat
LC349869_C_P-B      ttgccttctgacttctttccttccattcgagatcttctcgacaccgcctctgctctgtac
LC349874_C_P-B      ttgccttctgacttctttccttccattcgagatcttctcgacaccgcctctgctctgtac
HM011492_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
LC349872_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB713530_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB493835_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgatgccgcctctgctctgtat
AB033554_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
JQ429082_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
JQ429081_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctctat
AB219430_C_P-B      ttgccttctgacttctttccttccattcgagatcttctcgacaccgcctctgctctgtac
HQ700548_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctctat
M54923_C_P-B        ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EF473972_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KM526759_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KJ803787_C_P-B      ttgccttctgacttctttcctgctattcgagatcttctcgacaccgcctctgctctgtat
AB033555_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctcagctctgtat
LC349873_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctttat
AP011085_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
D00331_C_C-B        ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
GQ358136_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
HM011496_C_P-B      ttgccttctgacttctttcctaatattcgagatctwctcgacaccgccaatgctctgtat
KU576069_C_P-B      ttgccctctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctctat
KU576070_C_P-B      ttgccctctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctctat
AB334303_C_P-B      ttgccttctgatttctttccgtctattcgagatctcctcgacaccgcctcagcgttgtat
AB355454_C_P-B      ttgccttctgatttctttccgtctattcgagatctcctcgacaccgcctcagcgttgtat
AB334302_C_P-B      ttgccttctgatttctttccgtctattcgggacctccttgacaccgcctcagctttgtat
AB334299_C_P-B      ttgccttctgatttctttccgtctattcgagacctcctcgacaccgcctcagccttgtat
AB334300_C_P-B      ttgccttctgatttctttccgtctattcgagacctcctcgacaccgcctcagccttgtat
AB334301_C_P-B      ttgccttctgatttctttccgtctattcgagacctcctcgacaccgcctcagccttgtat
AB048705_C_P-B      ttgccttctgatttctttccatctattcgagatctcctcgacaccgcctccgccctgtat
KU679959_C_P-B      ttgccttctgatttctttccgtctattcgtgatctcctcgacaccgctgccgctctgtat
AY269078_C_P-B      ttgccttctgatttctttccgtccattcgagatctcctcgacaccgcctcagctctgtat
AF324106_C_P-B      ttgccttctgatttctttccgtctatacgagatctcctcgacaccgcctcagccctgtat
AF324101_C_P-B      ttgccttctgatttctttccgtctattcgagacctcctcgacaccgcctcagctctgtac
AY269065_C_P-B      ttgccttctgatttctttccgtctattcgagatctcctcgacaccgcctcagctttgtac
KU667763_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667836_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667813_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667774_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667729_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667800_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667827_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667752_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667788_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KY353928_C_P-B      ttgccttctgacttttttccgtctattcgggatctcctcgacaccgcctctgctttgtat
KU668105_C_P-B      ttgccttctgacttttttccttctattcgagagctcctcgacaccgcctcagctctgtat
KU576624_C_P-B      ttgccttctgacttttttccttctattcgagagctcctcgacaccgcctcagctctgtat
KU576660_C_P-B      ttgccttctgacttttttccttctattcgagagctcctcgacaccgcctcagctctgtat
KU576600_C_P-B      ttgccttctgacttttttccttctattcgggagctcctcgacaccgcctcagcactgtat
KU576618_C_P-B      ttgccttctgacttttttccttctattcgagagctcctcgacaccgcctcagctctgtat
KU667929_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccacagctctgtat
KU576773_C_P-B      ttgccttctgacttttttccgtctattcgagatctccttgacaccgccacagctctgtac
KU576064_C_P-B      ttgccttccgacttttttccgtctatccgagatctccttgacaccgccagtgctctgtat
KU667896_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctcagctctgtaa
KU668173_C_P-B      ttgtctcctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU667952_C_P-B      ttgtcttctgacttctttccttcgatacgagatctcctcgacaccgcctcagctctgtat
KU667407_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctcagctctgtat
KU667733_C_P-B      ttgccttctgacttctttccttcgattcgagacctccccgacaccgcctcagctctgtat
KU668216_C_P-B      ttgccttctgacttctttccttcgattcaagatctcctcgacaccgcctcagctctgtat
KU667590_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctcagctctgtat
KU667439_C_P-B      ttgtcttctgacttctttccttcgattcgagatctcctcgacaccgcctcagctctgtat
KU668336_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctcagctctgtat
KU667568_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctcagctctgtat
KU668250_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctcagctctgtat
KU668157_C_P-B      ttgcctactgacttctttccttccattcgagatcccctcgacaccgcctctgctctgtat
KU668277_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576986_C_P-B      tagccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU667420_C_P-B      ttgcctactgacttctttccttccattcgagatcccctcgacaccgcctctgctctgtat
KU668170_C_P-B      ttgcctactgacttctttccttccattcgagatcccctcgacaccgcctctgctctgtat
KU668193_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU668357_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU668366_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576606_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576597_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576598_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576988_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576989_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576609_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576501_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgcat
KU576500_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgttt
KU576496_C_P-B      ttgccttctgacctctttccttctattcgagatctcctcgacaccgcctcagctctgttt
KU576507_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgttt
KU576016_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtaa
KU576020_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576015_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576018_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576495_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctcagctctgtat
KU575966_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctcagctctgtat
KU575971_C_P-B      ttgccttctgacttctttccttctatgcgagatctcctcgacaccgcctcagctctgtat
AY269097_C_P-B      ttgccttctgatttctttccttctattcgtgatctcctcgacaccgcctctgctttgtat
KU576638_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576639_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KY689423_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgcctctgctctgtat
KU667874_C_P-B      ttgccttctgacttctttccttctatccgagatctccttgacaccgcctctgctctgtat
KU576132_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgcat
KU576087_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgcat
KU576100_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccacctcagctctgtat
KU576086_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576085_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576157_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtag
KU576084_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccacctcagctctgtat
KU576153_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576090_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccacagctctgtgt
KU576096_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576088_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU667516_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KY689404_C_P-B      ttgccttctgacttctttccttctattcgagatctcmtcgacaccgcctcagctctgtat
KY689503_C_P-B      ttgccttctgacttctttccttctattcgagatctcatcgacaccgcctcagctctgtat
KU667577_C_P-B      ttgtcttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KF164967_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccacagctctgtat
KY689488_C_P-B      ttgccgtctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
KU576691_C_P-B      ttgccttctgacttctttcctaatgttcgagatctcctcgacaccgcctctgctctgtat
KU576522_C_P-B      ttgccttctgacttcttcccttctgttcgagatctcctcgacaccgcctctgctctgtat
KU668008_C_P-B      ttgccttctgacttttttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU575938_C_P-B      ttgccttctgacttttttcctactattcgagatctcctcgacaccgcctctgctctgtat
KU575941_C_P-B      ttgccttctgacttttttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU667993_C_P-B      ttgccttctgacttttttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU575942_C_P-B      ttgccttctgacttttttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU575937_C_P-B      ttgccttctgacttttttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU575940_C_P-B      ttgccttctgacttttttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU667447_C_P-B      ttgccttctgacttttttccttccattcgagatctcctcgacaccgcctctgctctgtat
KY881864_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KY689557_C_P-B      ttgccgtctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgyat
KY689523_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU575921_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU667605_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU668324_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KY689445_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668059_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576460_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctcagctctgtat
KY689458_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctcagctttgtat
KU576251_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576255_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576254_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576397_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576467_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668287_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576493_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667777_C_P-B      tcgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667780_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF568461_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668274_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668316_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576398_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668337_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668265_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576413_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576411_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576408_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576402_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576395_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668297_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576406_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576470_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668306_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668256_C_P-B      ttgccttctgacttctttccctctattcgagatctcctcgacaccgcctctgctctgtat
KU576499_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
KU576466_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576407_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576399_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576386_C_P-B      ttgccttctgacttctttccttctattcgagatctccacgacaccgcctctgctctgtat
KU576400_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576401_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576412_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576419_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667520_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576970_C_P-B      ttgccttctgacttttttccttctattcgaggtctgctcgacaccgcctctgctctgtat
KU576968_C_P-B      ttgccttctgacttttttccttctattcgagatctgctcgacaccgcctctgctctgtat
KU576969_C_P-B      ttgccttctgacttttttccttctattcgagatctgctcgacaccgcctctgctctgtat
KF165906_C_P-B      ttgccttcggacttctttccttctattcgagatcttctcgacaccgcctcagctctgtat
KY689433_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgccgctgctctgtat
KY689410_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KY689505_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KY689506_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KY689507_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576331_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
KU576189_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacacagcctcagctctgtat
JX661482_C_P-B      ttgccttccgacttctttccttctattcgagatctactcgacaccgcctcagctctgtat
KY689448_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcaactgctatgtat
KY689534_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcaactgctatgtat
KU576152_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576155_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU576151_C_P-B      ttgccttccgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU576149_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU576154_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU576150_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KY353930_C_P-B      ttgccttctgacttctttccgtctgttcgggatctcctcgacaccgcctctgctctgtat
KJ803801_C_P-B      ttgccttctgacttctttccgtctattcgggatctcctcgacaccgcctctgctctgtat
KU576979_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
MN689122_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MN689120_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MN689121_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MN689123_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU576420_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575953_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU575977_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KY689480_C_P-B      ttgccttckgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KY689563_C_P-B      ttgccttckgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KY689472_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689546_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689517_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689443_C_P-B      ttgccttctgacttctttccttctattcgagatctccttgacaccgcctctgctctgtat
MK534614_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576191_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
AF335751_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576188_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
JQ341530_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctcagctctgtat
KU668335_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccccagctctgtat
KU576309_C_P-B      ttgccttctgacttctttccttctattcgaggtctcctcgacaccgcctcagctctgtat
KU576310_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
AY582137_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
AY269100_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173342_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KF165328_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KJ173341_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU667484_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU667457_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU667515_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU667445_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576980_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU668344_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576975_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU668345_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU668323_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcggcaccgcctcagctctgtat
KU576978_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576982_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576983_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576984_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576985_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
KU576981_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
MN689118_C_P-B      ccgccttatgacttctttccttctattcgagatcttctcgaaaacgcctctggaatgtat
KX276827_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccrccwctgctctgtat
JQ027311_C_P-B      ttgcctgctgacttctttccttctgttcacgaccttctcgacaccgccactgctctgtat
AJ298864_C_P-B      ttgccttctgacttctttccttccgtacgagatcttctagataccgcctctgctttgtat
OK318660_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccrctgctctgtat
GQ924645_C_P-B      ttgccttctgacttttttccttctattcgagatcttctcgacaccgcctctgctctgtat
FJ023620_C_P-B      ttgccttctgatttctttccatctattcgagaccttctcgacaccgcatcagccctgtat
FJ023617_C_P-B      ttgccttctgatttctttccatctattcgagaccttctcgacaccgcatcagccctgtat
FJ023618_C_P-B      ttgccttctgatttctttccatctattcgagaccttctcgacaccgcatcagccctgtat
FJ023573_C_P-B      ttgccttctgatttctttccatctattcgagaccttctcgacaccgcatcagctctgtat
FJ667207_C_P-B      ttgccttctgatttctttccatctattcgagaccttctcgacaccgcatcagctctgtat
JF775482_C_P-B      ttgccttctgatttctttccgtctattcgagaccttctcgacaccgcatcagctctgtat
JF775483_C_P-B      ttgccttctgatttctttccgtctattcgagaccttctcgacaccgcatcagctctgtat
FJ023630_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
FJ023629_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
FJ023628_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
FJ023627_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
FJ023613_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
FJ023610_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
FJ023608_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
FJ023605_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
FJ023607_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
FJ023609_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
FJ023611_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
FJ023612_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
FJ023614_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
FJ023606_C_P-B      ttgccttctgatttctttccatctatacgagaccttctcgacaccgcatcagctctgtat
KJ803824_C_P-B      ttgccttctgacttccttccttctattcgagatcttctcgacaccgcctctgctctgttt
JQ341505_C_P-B      ttgccttctgacttctttccttctrttcgagatctcctcgacaccgcctctgctctgtat
GQ924635_C_P-B      ttgcctactgacttctttccttctgttcgagatctgctcgacaccgcctctgctctgtac
KU576380_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU576385_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU576379_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU576381_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctatat
KU576383_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctatat
MN689119_C_P-B      ttgcctcaggacttctttccttctatgcgagatcttctcgacaccgcctctgctctgtat
KJ803797_C_P-B      ttgccttctgacttctttccgtctattcgggaccttctcgacaccgcctctgctctgtgt
JQ341493_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtac
JQ341515_C_P-B      ttgccttctgacttctttccttcwattcgtgatctcctcgacaccgcctctgctctgtat
GQ924637_C_P-B      ttgccttctgacttctttccttctgttcgagatcttcttgacaccgcctccgctctgtat
MT426101_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgttt
AF324088_C_P-B      ttgccttctgacttctttccttctgttcgagaccttctcgacaccgcctctgctctgtat
MF674492_C_P-B      ttgcctggtgacttcttcccttctattcgagatcttctcgacaccgcctctgctctgtat
KX276823_C_P-B      ttgccttctgacttytttccttctattcgagatcttctcgacaccgccwctgctctgtat
OK318674_C_P-B      ttgccttctgacttctttccttctattcgagagcttctcgacaccgcctccgctctgtat
MK534659_C_P-B      ttgccttctgacttctttccttttattcgagatcttctcgacaccgcctctgctctgtat
KX276825_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KM526755_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
KJ803775_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgttt
MF674478_C_P-B      ttgcctaatgacttctttccttctgttcgggatctcctcgacaccgcctctgctctgtat
KM526756_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KJ803786_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KU577089_C_P-B      ttgccttctgacttctttccttcggttcgagatctcctcgacaccgcctctgctctgtgt
KU576283_C_P-B      ttgccttctgacttttttccttcgattcgagatctcctcgacaccgccgctgctctgtat
KU576280_C_P-B      ttgccttctgacgtctttccttcgattcgagatctcctcgacaccgccgctgctctgtat
KU576287_C_P-B      ttgccttctgacgtctttccttcgattcgagatctcctcgacaccgccgctgctctgtat
KU576292_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgccgctgctctgtat
KU576289_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgccgctgctctgtat
KU576291_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgccgctgctctgtat
KU576290_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgccgctgctctgtat
KU577088_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgccgctgctctgtat
KU667671_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgccgctgctctgtat
KU667672_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgccgctgctctgtat
AB023682_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccatttctgctctgtat
OK318677_C_P-B      ttgcctgctgacttctttccttctattcgagatcttctcgacaccgccaatgctctgtat
KY689468_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctatat
OK318657_C_P-B      ttgccttctgacttctttccttccattcgagatcttctcgacactacatctgctctgtat
MF674439_C_P-B      ttgccttctgacttttttccttctgttcgagatcttctcgacaccgcctctgctctgtat
KU576277_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctcagctctgtat
KU576279_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctcagctctgtat
GQ924656_C_P-B      ttgccttctgacttctttccgtctgtccgagatcttctcgacaccgcctctgctctgtat
KX276820_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctccgctctgyat
JQ027334_C_P-B      ttgccttctgacttctttccttctgttcgagaccttctcgacaccgcctcagctctgtac
JQ341499_C_P-B      ttgccttctgacttctatccttctattcgagatctcctcgacaccgcctctgctctgtat
OK318665_C_P-B      ttgccttctgacttctttcctyctgttcgtgatcttctcgacaccgcctctgctctgtat
KU577107_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgccttgtat
AB023667_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KY689484_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgccactgctctgtat
KY689556_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgccactgctctgtat
KY689496_C_P-B      ttgccttctgacttctttccttctatccgggatctcctcgacaccgcctctgctctgtat
KX276830_C_P-B      ttgccttctgacttttttccttctatacgggatcttctcgacaccgcttctgctctgtat
KM526757_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctttgttt
KX276815_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
HM011469_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
KX276822_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
MF674436_C_P-B      ttgccttctgacttctttcctaatattcgagatcttctcgacaccgcctctgctctgtat
GQ924626_C_P-B      ttgcctgatgacttctttccttctgttcgagatcttcttgacactgcttctgctctgtat
KX276824_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctccgctctgtat
KY689426_C_P-B      ttgccttctgacttctttccatctattcgagatctcctcgacaccgcctctgctctctat
KY689520_C_P-B      ttgccttctgacttctttccatctattcgagatctcctcgacaccgccdctgctctctat
KY689451_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctcagctctatat
KU576746_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534612_C_P-B      ttgcctactgacttctttccttccattcgagatcttctcgacaccgcgtctgctctgtat
AP011094_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctttgtat
KU576653_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctctgctctgtat
KU576648_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctctgctctgtat
KU576654_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctctgctctgtat
KU576655_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctctgctctgtat
MK534608_C_P-B      ttgcctactgacttctttccttccattcgagatcttctcgacaccgcctctgctctgtat
GQ924628_C_P-B      ttgccttctgacttctttcctactattcgagatcttctcgacaccgcctctgctctgtat
JQ341509_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
OK318669_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KC774419_C_P-B      ttgccttctgacttctttccttctattcaagacctcctcgacaccgcctctgctctgtat
LC349870_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KJ803819_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB219429_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK534621_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctctat
KX276817_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctccgctctgtat
MZ439518_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439519_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439521_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439517_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439520_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439533_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439546_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439542_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439543_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439545_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439532_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439530_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439525_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439526_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439528_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439531_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439534_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439522_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439549_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439551_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439523_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439524_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439527_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439529_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439537_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439535_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439536_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439550_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439540_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439548_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439539_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439538_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439544_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439541_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MZ439547_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
JQ341463_C_P-B      ttgccttccgacttctttccttctrttcragatctcctcgacaccgcctctgcgctgtat
AY269110_C_P-B      ttgccttctgacttctttcctaatattcgagatcttctcgacaccgcctcagctctgtat
DQ993680_C_P-B      ttgccttctgacttctttccttctattcgagatcttcttgacaccgcctctgctctgtat
DQ377158_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674441_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AB368295_C_P-B      ttgccttctgatttctttccttctattcgagatcttctcgacaccgccgctgctctgtat
AF323467_C_P-B      ttgccttctgacttctttccttctattcgagagcttatcgacaccgcctctgctctgtat
AF324070_C_P-B      ttgccttatgacttctttccttctattcgagagcttatcgacaccgcctctgctatgtat
GQ358147_C_P-B      ttgccttctgactcctttccttctattcgagatcttctcgacaccgcctctgctctgtat
GQ358145_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
GQ358146_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674464_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccgctgctttgtat
DQ993687_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctttgtat
DQ993683_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
GU827630_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacactgcctctgctctgtat
AF324073_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
AB205122_C_P-B      ttaccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF621878_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
KF167010_C_P-B      ttgcctcctgacttctttccttctgttcgagaccttctcgacaccgcctctgcactgtat
AB212625_C_P-B      ttgccttctgacttctttcctactattcgagatcttctcgacaccgccactgctctgtat
AB219427_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MT757445_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757449_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757455_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757454_C_P-B      ttgcctcctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757440_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757441_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757447_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757443_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757446_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757456_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757452_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcggcaccgccactgctctgtat
MT757436_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757438_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757442_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757444_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757439_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757448_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757453_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757457_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757451_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MT757437_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccgcctctgctctgtat
MT757450_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccgccactgctctgtat
GQ855526_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
JQ341500_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgyat
HM011467_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MK534661_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctctat
MF674407_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
OK318663_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674481_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtac
AB100695_C_P-B      ttgccttctgacttctttccttctgttcgagagcttctcgacaccgcctctgctctgtat
MN689117_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
DQ361535_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB976562_C_P-B      ttgccttctgacttctttcctgctgttcgagatcttctcgacaccgcctctgctctgtat
AP011086_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
AP011087_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
KY689564_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ358148_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcatctgctttgtat
GQ358149_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctttgtat
GQ358152_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctcagctttgtat
GQ358150_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctttgtat
AP011096_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctttgtat
GQ358151_C_P-B      ttgccttctgacttctttccttccattcgagaccttctcgacaccgcctctgctttgtat
KM526758_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctttgtat
AP011093_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctttgtat
AB031267_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcttctgctctgtat
GQ924640_C_P-B      ttgccttctgacttctttccttctattcgggatctgctcgacaccgcctctgctctgtat
EF473977_C_P-B      ttgccttctgacttctttccttctattcgtgatcttctcgacaccgcctctgctctgtat
AF324066_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccgccgctgctctgtat
AY269108_C_P-B      ttgcctgctgacttctttccttctattcgagagcttctcgacaccgcctctgctcagtat
MF674448_C_P-B      ttgcctgctgacttctttccttctattcgagagcttctcgacaccgcctctgctctgtat
MF674415_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgttt
AB241116_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB241117_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
JQ341504_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK534680_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacactgcctctgctctgtat
DQ993686_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
AB908303_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
AB908299_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
AB908300_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
AB908304_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
LC349878_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MT731878_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK534575_C_P-B      ttgccttctgacttctttccttctattcgtgatctcctcgacaccgcctctgctctatat
OK318672_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctccgctctgtat
OK318656_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674385_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KM526749_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
GQ358144_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
GQ358143_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctcagctctgtat
FJ023637_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtac
FJ023575_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgataccgcctctgctctgtac
EF473971_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AY269091_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
MF674505_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KM526754_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AY517620_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccgcctctgctctgaat
AB219428_C_C-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MT645001_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674470_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674487_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB031268_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcttctgctctgtat
MF674496_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK038469_C_P-B      ttgccttctgacttcttcccttctattcgaaatctcctcgacaccgcctctgctctgtat
MK038465_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038459_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
AF323470_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcttctgctctgtat
MK038461_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038448_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
KC836853_C_P-B      ttgccttctgacttcttyccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038462_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038460_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038458_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038457_C_P-B      ttgccttctgacttcttcccctctattcgagatctcctcgacaccgcctctgctctgtat
MK038454_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038450_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038449_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038439_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacactgcctctgctctgtat
MK038435_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038431_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038452_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038432_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038433_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038437_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038440_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038445_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038446_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038447_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038451_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038453_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038456_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038463_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038467_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038468_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038470_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674459_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
JQ429079_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccgcctctgctctgtat
AB493827_C_P-B      ttgccttctgacttctttccttctgttcganatcttctcaaccccgttttggttttgtat
AB023663_C_P-B      ttgacttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ707762_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacacagccaccgctctgtat
JQ707750_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707734_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707735_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707737_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707738_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707739_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707740_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707743_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707744_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707745_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707746_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707747_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707749_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707753_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707755_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707758_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707759_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707763_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707764_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707765_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707766_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707767_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707742_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707741_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacagcgccaccgctctgtat
JQ707760_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707751_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707736_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707748_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707752_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707756_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707757_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707761_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ707754_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccaccgctctgtat
JQ341464_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
DQ993681_C_P-B      ttgcctactgactactttccttctattcgagatcttctcgacaccgcctctgctctgcat
MF674447_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC836847_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC836865_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC836872_C_P-B      ttgccttctgacttctttccttctattcgagatctcatcgacaccgcctctgctctgtat
MF674473_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KM526747_C_P-B      ttgccttctgacttctttccttccattcgagatctgctcgacaccgcctctgctctgtat
FJ023634_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctttgtat
EU660230_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
EU660231_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
EU660232_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
EU660233_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
DQ993685_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AM888201_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB031264_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674515_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctttgtat
MF674406_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccgcctctgctctgtat
KJ173297_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ358139_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacacagcctctgctctgtat
AP011089_C_P-B      ttgccttctgatttcttcccgtctattcgagatcttctcgacaccgcctctgctttgtat
AB355455_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK534696_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674434_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
JQ341486_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgactccgcctctgctctgtat
MF674508_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674491_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674479_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674476_C_P-B      ttgccctctgacttttttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674433_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674419_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674392_C_P-B      ttgccttcggacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674389_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MF674382_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148459_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
KM526752_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KM526748_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KM526751_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
FJ023638_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AF324069_C_P-B      ctgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB219426_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB117759_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC836830_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KC836843_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KY689477_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB023677_C_P-B      tggccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC836841_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC836863_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC836864_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY269131_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF324067_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB355453_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccgcctctgctctgtat
AB073835_C_P-B      ttgcctgctgacttctttccttctgttcgagatcttctcgacaccgcctctgctctgtat
MF674409_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccgcctctgctctgtat
MW310263_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MK534626_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctctat
MF674497_C_P-B      ttgccttctgactttttcccttctattcgagatcttctcgacaccgcctctgctctgtat
KM526750_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgcactgtat
KP148458_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
KP148460_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgtat
MF674396_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148457_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148453_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148452_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148455_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148456_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148461_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674509_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674445_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674443_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674420_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674414_C_P-B      ttkccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
LC349871_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctccgctctgtat
HQ700549_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
GQ924621_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
GQ358140_C_P-B      ttgccttctgacttctttccttccattcgagatcttctcgacaccgcctctgctctgtat
GQ358137_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacacagcctctgctctgtat
DQ993694_C_P-B      ttgccttccgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AY269093_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB212626_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB115551_C_P-B      ttgccctctgacttttttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB031266_C_P-B      ttgccttctgacttctttccttctatacgagatctcctcgacaccgcctctgctctgtat
AP011090_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacacagcctctgctctgtat
GQ358138_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacacagcctctgctctgtat
AP011095_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctttgtat
MF674451_C_P-B      ttaccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctttgtat
MF674462_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674498_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MW310261_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MW310262_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MF674446_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674466_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674499_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674490_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674438_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674432_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674421_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674400_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU234318_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctttgtat
MF674483_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctttgtat
GQ358141_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
FJ349236_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EF473976_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacacagcctctgctctgtat
AP011091_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctatat
MF674455_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674437_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674493_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674477_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674469_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674405_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674404_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674383_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674511_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674410_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674513_C_P-B      ttgccttctgatttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674424_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674416_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674460_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674397_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674387_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
FJ023635_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674431_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674453_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674488_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674384_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctccgctctgtat
MF674461_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
GQ924651_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
GQ924654_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674452_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
GQ358142_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AP011088_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AP011092_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674510_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674507_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674495_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674456_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674423_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674401_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674394_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AB031261_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB031263_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674393_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674395_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674413_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674482_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MF674500_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
JQ027312_C_P-B      ttgcctactgacttctttcctartgttcgagatcttctcgacaccgcctctgctctatat
KY881837_C_P-B      ttgccttctgacttctttccttctattcgtgatctactcgacaccgcctctgctctgtat
MK818222_C_P-B      ttgccttctgacttctttcctamtatycgwgatctcctcgacaccgcctmtgctctgtwt
HM011477_C_P-B      ttgccttctgacttctttccttctgwtsragatctcctcgacaccgcctctgctctgtat
KX276795_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KX276792_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacacyayytctgctctgcat
KU576893_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576894_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576895_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576750_C_P-B      ttgccttctgacttctttccttccattcgagacctcctcgacaccgcctctgctctgtat
KU576896_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576897_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576890_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576889_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576888_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576886_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576891_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576887_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576892_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU576898_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU668036_C_P-B      ttgccttctgacttctttccttccattcgagacctcctcgacactgcctctgctctgtat
KU667988_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU668045_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU668004_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KX276798_C_P-B      ttgccttctgacttctttcctamtattcgagatctcctcgacaccgcmwctgctmtgtat
KX276775_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KX276800_C_P-B      ttgcctkctgacttctttccgtctattcgggatctcctcgacaccgccactgctctgtat
HM011487_C_P-B      ttgccttctgatttctttccttctattcgagatcttcttgacaccgcctctgctctctat
MG571326_C_P-B      ttgccttctgacttctttcctaatattcgtgatctgctcgacaccgcctctgctctatat
MG571329_C_P-B      ttgccttctgacttctttcctaatattcgtgatctgctcgacaccgcctctgctctatat
KU576125_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576126_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576130_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576131_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576127_C_P-B      ttgccttctgacttttttccttctactcgagatctcctcgacaccgcctctgctctgtat
HM011478_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgckctgtat
KU964280_C_P-B      ttgccttctgacttctttccttctatgcgagatctcctcgacaccgccgctgctctgtat
KU964286_C_P-B      ttgccttctgacttctttccttctatgcgagatctcctcgacaccgcctctgctctgtat
KU964276_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964283_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964274_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964282_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964272_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964273_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964275_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964278_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964279_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964281_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964284_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964277_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964285_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU939678_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KX276791_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562260_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgccaatgctctgtat
MT622522_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgccactgctctgtat
EU547563_C_P-B      ttgccttccgacttttttccttctattcgagatctcctcgacaccgccactgctctgtat
EU158263_C_P-B      ttgccgtctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY206383_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcagctgctctgtat
KM875420_C_P-B      ttgccttctgacttctttccttctatccgagatctcctcgacaccgcctctgctctgtat
FJ562311_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MG571357_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgcctctgctctgtat
KY689490_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689559_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689560_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KX276793_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
HM011476_C_P-B      ttgccttctgacttctttccttctattcgagatctccttgacaccgcctctgctctgtat
FJ562312_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgccgctgctttgtat
FJ032342_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
AB073841_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KY689406_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgccactgctctgtat
HM011480_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
GQ924632_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU577047_C_P-B      ttgcctaatgacttctttcctaatatgcgagatctcctcgacaccgccactgctctgtat
KU577046_C_P-B      ttgcctaatgacttctttcctaatatgcgagatctcctcgataccgccactgctctgtat
KU577048_C_P-B      ttgcctaatgacttctttcctaatatgcgagatctcctcgacaccgccactgctctgtat
JQ341508_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY269128_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
JQ341503_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgcctctgctctatat
EU522072_C_P-B      ttgccttctgacttctttccttctattcgtgatctcctcgacaccgcctctgctctgtat
EU522073_C_P-B      ttgccttctgacttctttcctactattcgtgatctcctcgacaccgcctctgctctgtat
EU522075_C_P-B      ttgccttctgacttctttcctactattcgtgatctcctcgacaccgcctctgctctgtat
JQ027325_C_P-B      ttgccttctgacttttttccttccattcgagatctcctcgacaccgccactgctttgtat
AB900110_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccgcagctctgtat
KX276801_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU939674_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ899790_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ899791_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ803789_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
X97850_C_P-B        ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KX276806_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgayacmgccgctgctctgtat
GQ377644_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ904357_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
AB073825_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
FJ787475_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctttgtat
FJ787476_C_P-B      ttgccttctgacttctttccttctatttgagatctcctcgacaccgccactgctttgtat
KY689417_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU939671_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KC774397_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgttt
JQ341480_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406163_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406164_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406162_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406166_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ801516_C_P-B      ttgccttctgacttctttccttctattcgtgatctcctcgacaccgcctctgctctgtat
KP406176_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406177_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406178_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406179_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406180_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406181_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406182_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406183_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406185_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406184_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406197_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406219_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406190_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406191_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406193_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406196_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406201_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406202_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406204_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406205_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406206_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406207_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406209_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406211_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406212_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406213_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406215_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406218_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406186_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406187_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406189_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406192_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406194_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406198_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406199_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406203_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406208_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406210_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406214_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406216_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406188_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406195_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406200_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406217_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562222_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
AF282917_C_P-B      ttgcctactgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964258_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU964270_C_P-B      ttgccttctgacttctttccttctattcaagatctcctcgacaccgccactgctctgtat
KU964257_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU964259_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU964260_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU964261_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU964262_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU964263_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU964264_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU964265_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU964267_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU964268_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU964269_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU964271_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU964266_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KJ803768_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EF494381_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KX276810_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668070_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
FJ562259_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689419_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
AY220697_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU576924_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668361_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668360_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667413_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576923_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668322_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668354_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668371_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668343_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667603_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668334_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576305_C_P-B      ttgccttctgacttctttccttctattcgagatctccttgacaccgcctctgctctgtat
KU576303_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576300_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576307_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576306_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576299_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576308_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576288_C_P-B      ttgccttctgacttctttcctcctattcgagatctcctcgacaccgcctctgctctgtat
KU576304_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576295_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576302_C_P-B      ttgccttctgacttctttccttctactcgagatctcctcgacaccgcctctgctctgtat
KP406277_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406276_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406275_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406272_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406263_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406278_C_P-B      ttgccttctgacttctttccttctattcgtgatctcctcgacaccgccaccgctctgtat
KP406274_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406264_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406255_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406265_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406268_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406270_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406279_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406261_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KU667714_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
AB365445_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668138_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668088_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KU576344_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576340_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668063_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667719_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KU667716_C_P-B      ttgcctactgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU577092_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667720_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667717_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667715_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576341_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576345_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667718_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667721_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576343_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667713_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667712_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgttctgtat
KU668104_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668130_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668111_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KU668074_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KU668122_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY269109_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668081_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KU667680_C_P-B      ttgccttctgacctctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KU668019_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KU668060_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
EU939663_C_P-B      ttgccttctgacttttttccttctattcgagatcttctcgacaccgccactgctctgtat
KX276773_C_P-B      ttgccgtctgacttctttccttctgttcgagatctcctcgacaccgcctytgctctgtat
KJ173378_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU939639_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377610_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
EU919175_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgcctctgctctgtat
EU919176_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgcctctgctctgtat
JF436921_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY596112_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386681_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576342_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576853_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038158_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571372_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576301_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KM213032_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX429901_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
EU939669_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
FJ899779_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
AY220703_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AY220704_C_P-B      ttaccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KU576293_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU660224_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU882003_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU882004_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406173_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406165_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406167_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406171_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689476_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgcctctgctctgtat
KP406331_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU487256_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY206375_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
AF324082_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
AB073837_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038163_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX504532_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562253_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctcagctctgtat
FJ562231_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacacagcctctgctctgtat
FJ562224_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534691_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KJ173298_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037505_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
KP406318_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406319_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406320_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406321_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406322_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406324_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406325_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406326_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406327_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406328_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406329_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406323_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040760_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
KP406330_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406332_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406334_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406333_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406335_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040753_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK040754_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK040755_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK040763_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK040768_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
KP406232_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406243_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406241_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406237_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406234_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KP406238_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KP406240_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KP406220_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406221_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406222_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406223_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406224_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406225_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406227_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406228_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406229_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406230_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406231_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406236_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406233_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406235_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KP406242_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
FJ032349_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgccctgtat
FJ386675_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038141_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgactccgcctctgctctgtat
MG571350_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgcctctgctctgtat
MG571334_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571327_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KM213036_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB642094_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
FJ562289_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576297_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377519_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KM875416_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KM875417_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KM213034_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU881997_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU881998_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ040147_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534673_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KY470834_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY470837_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY470841_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY470832_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY470840_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY470833_C_P-B      ttgccttctgacttctttccttctattcgagatctccttgacaccgcctctgctctgtat
KY470830_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY470835_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY470836_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY470839_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY470838_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
HM011482_C_P-B      ttgcctmmwgacttctwtccywmtgttcgagatctcctcgacaccgcctctgctctgtat
HM011475_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccwctgctttgtat
JQ027313_C_P-B      ttgcctsmtgayttctttccttcgaytcgagatctcmtcgacaccgcctctgctctgtay
KX276794_C_P-B      ttgcctmwtgacttctttccttcgattcgagatctcctcgacaccgcctctgctctgtat
KX276779_C_P-B      ttgcctkctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtwt
KX276789_C_P-B      ttgccttctgacttctttcctactattcgagatctactcgacaccgcctctgctctgtat
KX276797_C_P-B      ttgccgtctgacttctttccttctattcgagatctkctcgacaccgccwctgctctgtat
HM011484_C_P-B      ttgcctgctgacttctttccttctgttcgagatctcctcgacaccgccnctgctctgtat
KM875418_C_P-B      ttgcctactgacttttttcctaatattcgagatctgctcgacaccgccactgctctgtat
KX276787_C_P-B      ttgcctgrwgacttctttccttctgttcgmgatctcctcgacaccgcywctgctctgtat
DQ995804_C_P-B      ttgcctgctgacttctttccttctgttcgagatctccttgacaccgcctctgctctgtat
KU668369_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgccactgctctgtat
KU576713_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgccaatgctctgtat
KU576702_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgccaatgcgctgtat
KU576707_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgccaatgcgctgtat
KU576710_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgccaatgcgctgtat
KU576709_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgccaatgcgctgtat
KU576820_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgccaatgcgctgtat
KU576708_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgccaatgcgctgtat
KU576700_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgccaatgcgctgtat
KU576701_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgccaatgcgctgtat
KU576705_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgccaatgcgctgtat
KU576706_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgccaatgcgctgtat
KU668309_C_P-B      ttaccctctgacttctttccttctattcggaatctcctcgacaccgccaatgctctgtat
KU668332_C_P-B      ttaccttctgacttctttccttctattcgggatctcctcgacaccgccaatgctctgtat
KU667987_C_P-B      ttaccttctgacttctttccttctattcgggatctcctcgacaccgccaatgctctgtat
KU576718_C_P-B      ttaccttctgacttctttccttctattcgggatctcctcgacaccgccaatgctctgtat
KU667997_C_P-B      ttaccttctgacttctttccttctattcgggatctcctcgacaccgccaatgctctgtat
KU668003_C_P-B      ttaccttctgacttctttccttctattcggaatctcctcgacaccgccaatgctctgtat
KU668359_C_P-B      ttaccttctgacttctttccttctattcgggatctcctcgacaccgccaatgctctgtat
MK037633_C_P-B      ttgccttctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MG571325_C_P-B      ttgcctkctgacttctttccttctgctcgagatctymtcgacaccgcctctgctctgtat
KX276807_C_P-B      ttgcctgctgacttctttccttctattcgagagcttctcgacaccgcctctgctctgtat
DQ993684_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341495_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgcctctgctctrtat
KX276811_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341492_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ027330_C_P-B      ttgccgtctgacttctttccttctrttcgagatctcctcgayaccgcctctgctctgtat
JQ027331_C_P-B      ttgccgtctgacttctttccttctrttcgagatctcctcgayaccgcctctgctctgtat
MG571358_C_P-B      ttgcctcatgacttctttccttctataagagatctcctcgacaccgcctctgctctgtat
JQ341498_C_P-B      ttgccttctgacttctttcctwmtsttcgagatctcctcgacactgcctctgctctgtat
KU576418_C_P-B      ttgccttctgatttctttccttctgttcgagatctcctcgacaccgccgctgctctgtat
KU576416_C_P-B      ttgccttctgatttctttccttctgttcgagatctcctcgacaccgccgctgctctgtat
KU576415_C_P-B      ttgccttctgatttctttccctctgttcgagatctcctcgacaccgccgctgctctgtat
KU576414_C_P-B      ttgccttctgatttctttccttctgttcgagatctcctcgacaccgccgctgctctgtat
KU576417_C_P-B      ttgccttctgatttctttccttctgttcgagatctcctcgacaccgccgctgctctgtat
KU668150_C_P-B      ttgcctactgacttctttccttcggttcgagatctcctcgacaccgccgctgctctgttt
KU668188_C_P-B      ttgcctactgacttctttccttcggttcgagatctcctcgacaccgccgctgctctgttt
KU668171_C_P-B      ttgcctactgacttctttccttcggttcgagatctcctcgacaccgccgctgctctgttt
KU668195_C_P-B      ttgcctactgacttctttccttcggttcgagatctcctcgacaccgccgctgctctgttt
KX276783_C_P-B      ttgcctactgacttctwtccttctgttcgagatctcctcgacaccgccactgctctgtac
MG571375_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576101_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576106_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576114_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576111_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576113_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576108_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576109_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576112_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgttt
KU576105_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576107_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KX276790_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689402_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgttt
KY689501_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgttt
KY689502_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgttt
EU939675_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccgctgctctgtat
KX276774_C_P-B      ttgcctkctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689444_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
HM011504_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341466_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctatgtat
GQ924646_C_P-B      ttgccttccgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MG372436_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccgctgctctgtat
KX276799_C_P-B      ttgcctwctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KX276778_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY269105_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB073824_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386608_C_P-B      ttgccttctgacttctttccttccatacgagatctcctcgacaccgcctctgctctgttt
DQ995803_C_P-B      ttgccttctgactcctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY269102_C_P-B      ttgccttctgacttctttccttctgctcgagatctcctcgacaccgcctctgctctgtat
MK037500_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040734_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040736_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037484_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037498_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037491_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037495_C_P-B      ttgccttctgacctttttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037482_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037479_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040735_C_P-B      ttgccttctgacttctttccttctattcgaaatctcctcgacaccgcctctgctcagtat
MK037488_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037485_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtac
MK037494_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037490_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037481_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037489_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040733_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040738_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037483_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037492_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctccgtat
MK037486_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040737_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037499_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571333_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
JQ801506_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcttctgctctgtat
JQ341467_C_P-B      ttgccttctgacttctttccttcaattcgagatctcctcgacaccgcatctgctctgyat
FJ562296_C_P-B      ttgccttctgacttctttccttctrttcgagatctcctcgacaccgcctctgctctgtat
AJ627225_C_P-B      ttgccgtctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY167098_C_P-B      ttgccttctgacttttttccttccattcgagagcttctcgacaccgcctctgctctgtat
AY596105_C_P-B      ttgccttctgacttttttccttccattcgagagcttctcgacaccgcctctgctctgtat
JQ341476_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571339_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341469_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341479_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037885_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgcat
KU576950_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctcagctctgtat
MF674422_C_P-B      ttgccttctgatttctttccttctgttcgagatctcctcgacaccgccgctgctctgtat
KU667519_C_P-B      ttgccttctgacttctttccttctactcaagatctcctcgacaccgcctctgctctgtat
KU667905_C_P-B      tcgccttctgacttctttccttctactcaagatctcctcgacaccgcccctgctctgtat
KU667597_C_P-B      ttgccttctgacttctttccttctactcaagatctcctcgacaccgcctctgctctgtat
KU667972_C_P-B      ttgccttctgacttctttccttctactcaagatctcctcgacaccgcctctgctctgtat
KU667570_C_P-B      ttgccttctgacttctttccttctactcaagatctcctcgacaccgcctctgctctgtat
KU576392_C_P-B      ttgccttctgacttctttccttctactcaagatctcctcgacaccgcctctgctctgtat
KU667578_C_P-B      ttgccttctgacttctttccttctactcaagatctcctcgacaccgcctctgctctgtat
KU576393_C_P-B      ttgccttctgacttctttccttctactcaagatctcctcggcaccgcctctgctctgtat
FJ032353_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
FJ032352_C_P-B      ttgccttctgacttccttccttctattcgagatctcctcgacaccgcctccgctctgtat
FJ032354_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
EU939633_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU939634_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP406172_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406175_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406170_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406168_C_P-B      ttgccttctgacttctttccttctactcgagatctcctcgacaccgcctctgctctgtat
KP406169_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406174_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF461360_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ803784_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
JQ341494_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgataccgcctctgctctgtat
MK038203_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037880_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MG571361_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576051_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY167101_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037877_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
FJ562257_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306679_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU306680_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU306677_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgataccgcctctgctctgtat
EU306678_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU306681_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK038314_C_P-B      ttgccttctgacttctttccttctattcgagatctccacgacaccgcctctgctctgtat
MK038195_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148332_C_P-B      ttgccttctgacttctttccttctattcgagatctcatcgacaccgcctctgctctgtat
MK038326_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038325_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038309_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038296_C_P-B      ttgccttctgacttctttccttctattcgagatctccttgacaccgcctctgctctgtat
MK038204_C_P-B      ttgccttctgacttctttccttctattcgaaatctcctcgacaccgcctctgctctgtat
MK038190_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038187_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK038180_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038177_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148366_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP148364_C_P-B      ttgccttctgacttctttccttctattcgagctctcctcgacaccgcctctgctctgtat
KP148329_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534732_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534611_C_P-B      ttgccttccgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038328_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038327_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038321_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038301_C_P-B      ttgccttctgacttctttcctcctattcgagatctcctcgacaccgcctctgctctgtat
MK038298_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038295_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038293_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038201_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038199_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038197_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038194_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038192_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038189_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038188_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038183_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038178_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038173_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038172_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038182_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038184_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038171_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038168_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038174_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038179_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038181_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038185_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038186_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038191_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038193_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037553_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148363_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KP148356_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148335_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148333_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148326_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148321_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148317_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148322_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148325_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148361_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148314_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148323_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148334_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377641_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038292_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038294_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038300_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038302_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038315_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038317_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038322_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038330_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX661478_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148318_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148319_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148320_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148324_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148327_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148328_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148330_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148331_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148357_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148359_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148360_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148362_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148365_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534578_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534599_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534600_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534602_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173411_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KJ173412_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KC774362_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctttat
JQ341472_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341459_C_P-B      ttgccttctgacttctttccttctattcgagatctccttgacaccgcctctgctctgtat
GQ924631_C_P-B      ttgccgtctgacttctttccttctattcgagatctcctcgataccgcctctgctctgtat
JQ341491_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341485_C_P-B      ttgccgtctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341473_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341462_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667560_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562236_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386676_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AY800389_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341460_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
JQ341461_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
AY596103_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccgctgctctgtat
KU576389_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KU576390_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KU576391_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576394_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689491_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426993_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562237_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgctgctgctctgtat
JQ341501_C_P-B      ttgcctactgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341490_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341489_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341484_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377561_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU796071_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
AF233235_C_P-B      ttgccttccgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534676_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964108_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964111_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964113_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964115_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964120_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964119_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964109_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964110_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964112_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964114_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964116_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964118_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964121_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964122_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964117_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MT426959_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341483_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576869_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576866_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576867_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576870_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576871_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576872_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576873_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576868_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562322_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
JQ341510_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341482_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427009_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427003_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427001_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426976_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964101_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
EU796067_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
DQ144561_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ144598_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341470_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341465_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341496_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964096_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU964098_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU964100_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU964102_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU964105_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU964107_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU964104_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KC774406_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EF134945_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EF134946_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689479_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386642_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU139543_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB246340_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534708_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774394_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148344_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426969_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427006_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426999_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426997_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426994_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426980_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426979_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426975_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
MT426974_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426972_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426970_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426964_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426961_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426990_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426960_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426962_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426957_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426955_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgaat
MT426951_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427002_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426945_C_P-B      ttgccttctaacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426939_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426988_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426938_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtgt
MT426929_C_P-B      ttgccttctgacttctttccttctattcgagatctcatcgacaccgcctctgctctgtat
MT426918_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426915_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426914_C_P-B      ttgccttctgacttctttccttctactcgagatctcctcgacaccgcctctgctctgtat
MT426911_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426910_C_P-B      ttgccttctgacttctttcctgctattcgagatctcctcgacaccgcctctgctctgtat
MT426984_C_P-B      ttgccttctgacttctttcctgctattcgagatctcctcgacaccgcctctgctctgtat
MT426906_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426916_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426931_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426947_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426950_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426967_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426981_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426996_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427010_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427011_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815760_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ518812_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377537_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426907_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426908_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426909_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426912_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426913_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426917_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426919_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426920_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426921_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426922_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426923_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426924_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426925_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426926_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426927_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426928_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426930_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426932_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426933_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426934_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426935_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426936_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426937_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426940_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426941_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426942_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426943_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426944_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426946_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426948_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426949_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426952_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426953_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426954_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426956_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426958_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426963_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426965_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426966_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426968_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426971_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426973_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426977_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426978_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426982_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426983_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426985_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426986_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426987_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426989_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426991_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426992_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426995_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426998_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427000_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427004_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427005_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427007_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427008_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427012_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427013_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427014_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT427015_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT645005_C_P-B      ttgccttctgacttttttccttctgttcgagatctccttgacaccgccactgctctgtat
MK818225_C_P-B      ttrccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
EU564822_C_P-B      ttgcctgctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
EU564824_C_P-B      ttgcctgctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
EU564823_C_P-B      ttgcctgctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK818223_C_P-B      ttgcctgctgacttctttccttctgttcgagatctcctcgacaccgcckctgctctgtat
KJ410500_C_P-B      ttgcctcaagacttctttccttctgttcgagatctcctcgacaccgcttctgctctgtat
KX276776_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgcat
AY206387_C_P-B      ttgcctgctgacttctttccttctattcgggatctgctcgacaccgcctctgctctctat
KF166001_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
GQ924630_C_P-B      ttgcctgttgacttctatccttctattcgagatctcctcgacaccgcctcagctttgtat
HM011471_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MG571336_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgataccgcctctgctctgtat
AY596111_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KX276804_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562246_C_P-B      ttgccttcygacttytttccttctattcgagatctcctcgacaccgccactgctctgtat
HM011466_C_P-B      ttgccttctgacttctatccttctattcgagatctcctcgacaccgccactgctctgtat
KJ803816_C_P-B      ttgccttctgacttctatccttctattcgagatctcctcgacaccgccactgctctgtat
KY881845_C_P-B      ttgccttctgacttctttccttctattcgaaatctcctcgacaccgcctctgctctgtat
KX276770_C_P-B      ttaccgtctgacttctttccttctattcgagatctcctcgataccgcctctgctctgtat
HM011474_C_P-B      ttgccttctgayttctttccttccgttcgagatctcctcgacaccgcctctgctctgtat
EU939661_C_P-B      ttgcctactgacttctttccttctattcgagatctcctcgacaccgcaactgctctgtat
KU576848_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576753_C_P-B      ttgcctggcgacttctatccttctattcgagatctcctcgataccgcctctgctctgtat
KU576237_C_P-B      ttgcctactgatttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KU576703_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576626_C_P-B      ttgcctactgacttctttccttctattcgcgatcccctcgacaccgcctctgctctgtat
KU576641_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576632_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576765_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576856_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576854_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576843_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576693_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576692_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576637_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacgccgcctctgctctgtat
KU576766_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576754_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576681_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576647_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcaacaccgcctctgctctgtat
KU576630_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576240_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576619_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576620_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576629_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576633_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576640_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576645_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576656_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576698_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576704_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576714_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576738_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576748_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576751_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576845_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576874_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KU576623_C_P-B      ttgcctactgacttctttccttctattcgcgatctcctcgacaccgcctctgctctgtat
KX276781_C_P-B      ttgcctcatgacttctttccttctattcgagatctactcgacaccgcctctgctctgcag
KJ803825_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU579441_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgttt
EU570075_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgttt
FJ032344_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgttt
EU589335_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctatgttt
FJ386656_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctatgttt
KX276786_C_P-B      ttgccttctgacttctttccatctattcgagatctyctcgacaccgcctctgctctatat
KJ803805_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcttctgctctgtat
FJ386648_C_P-B      ttgccttctgacttctttccttctatacgagatctcctcgacaccgccgctgctctgtat
HM011494_C_P-B      ttgccttckgacttctttccttctrttcgagatctcctcgacaccgccwctgctctgtat
EU939677_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KX276813_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
HM011503_C_P-B      ttgccttctgacttttttccttctattcgagatctgctcgacaccgccactgctctgtat
HM011470_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctatat
AY167102_C_P-B      ttgccttctgacttctttcctaatgttcgagatctcctcgacaccgcctctgctctgtat
KY689414_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689500_C_P-B      ttgccttccgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341474_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacactgcctctgctctgtat
KY689469_C_P-B      ttgcctaatgacttctttcctaacatacgagatctcctcgacaccgccgctgctctgcat
KY689516_C_P-B      ttgcctaatgacttctttcctaacatacgagatctcctcgacaccgccgctgctctgcat
KU667858_C_P-B      ttgccttctgacttctctccttcgattcgagatctcctcgacaccgcctcagctctgtat
KJ803821_C_P-B      ttgcctcatgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU487257_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
JQ341488_C_P-B      ttgccttctgacttctttccttctrttcgagatctcctcgacaccgcctctgctctgtat
KY689481_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
JQ341468_C_P-B      ttgccttctgacttctttccktctrttcgagatctmctcgacaccgcctctgctctgtat
X98077_C_P-B        ttgccttctgacttctttcctgctgttcgagatctcctcgacaccgcctctgctctgtat
KJ803808_C_P-B      ttgccgtctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF157021_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF157022_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX504533_C_P-B      ttgccttctgacttctttccttccgttcgagatctcctcgacaccgcctctgctctgtat
DQ993698_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
DQ993710_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
KU667659_C_P-B      ttgtcttccgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF157020_C_P-B      ttgccttctgacttctttccttctattagagatctcctcgacaccgcctctgctctgtat
JQ341487_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KX276809_C_P-B      ttgcctaacgacttctttccttctatgcgagatctcctcgacaccgcctctgctctgtat
KT749820_C_P-B      ttgccttctgacttctatccttctattcgagatctcctcgacaccgccactgctctgtat
MT645016_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KJ803795_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KJ803781_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KJ803783_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AY217362_C_P-B      ttgccttctgatttttttccttccattcgagatctcctcgacaccgccactgctctgtat
KX276788_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
DQ995802_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377606_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgcat
AY163869_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
AY163870_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
JQ341471_C_P-B      ttgccttctgacttctttccttctattcgagayctcctcgacaccgcctctgctctgtat
FJ386660_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AB555498_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ751766_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgccactgctctgtat
FJ751769_C_P-B      ttaccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ803756_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576778_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KM875426_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacactgcatctgctctgcat
FJ386658_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ023631_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668232_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668261_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668241_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576921_C_P-B      ttgcctgctgacttctctccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668270_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668252_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668222_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668342_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668353_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668333_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY217355_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgccctgtat
AY217356_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
EU522074_C_P-B      ttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtat
KY881853_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctcagtat
KY881869_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881849_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881865_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668258_C_P-B      ttgtcttctgacttctttccttctattcgagatatcctcgacaccgcctctgctctgtat
KJ790200_C_P-B      ttgccttctgacttctttccgtctattcgagatctactcgacaccgccactgctctgtat
KJ803752_C_P-B      ctgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
JQ341475_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctctgctctgtat
MK037572_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgcat
MK040806_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgcat
OK106254_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctttgctctgcat
MF674465_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KJ173385_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KP406258_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406256_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406259_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
KP406267_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaccgctctgtat
MG571370_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KY689453_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctttgctctgtat
MK037963_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037949_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037675_C_P-B      ttgccctctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037669_C_P-B      ttgccctctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037869_C_P-B      ttgccctctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037672_C_P-B      ttgccctctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037971_C_P-B      ttgccctctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037673_C_P-B      ttgccctctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037982_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgataccgcctctgctctgtat
MK037980_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037977_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037965_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037866_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037868_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037974_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037703_C_P-B      ttgccttctgtcttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037564_C_P-B      ttgccttctgtcttctttccttctatttgagatctcctcgacaccgcctctgctctgtat
MK038428_C_P-B      ttgccttctgtcttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037867_C_P-B      ttgccttctgtcttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037563_C_P-B      ttgccttctgtcttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037569_C_P-B      ttgccttctgtcttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037951_C_P-B      ttgccttctgtcttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038429_C_P-B      ttgccttctgtcttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037809_C_P-B      ttgccttctgtcttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037973_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037959_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037955_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037941_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037953_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037962_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037964_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037968_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037969_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037985_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037946_C_P-B      ttgccttctgacttctttccttctattcgagatctcttcgacaccgcctctgctctgtat
MK037981_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK037944_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK037943_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK037956_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK037960_C_P-B      tcgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037975_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037976_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037967_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037957_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037942_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037940_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037945_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037948_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037950_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037952_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037972_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571321_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX504531_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ040138_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgctwctgctctgtat
FJ386669_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgcat
AB555499_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571340_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667956_C_P-B      ctgccttctgacttctttccttcgattcgagatctcctcgacaccgcctcagctctgtat
KU667551_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU882002_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AY517488_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY167094_C_P-B      ttgccttctgacttctttccttctattcgagatctcntcgacaccgcctctgctctgtat
AB073830_C_P-B      ctgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964123_C_P-B      ttgccttctgacttctttccttctgttcgagatctactcgacaccgcctctgccctgtat
KU964124_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgccctgtat
KU964128_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgccctgtat
KU964129_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgccctgtat
KU964131_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgccctgtat
KU964134_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgccctgtat
KU964136_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgccctgtat
KU964137_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgccctgtat
KU964127_C_P-B      ttgccttctgacttttttccttctattcgagatctactcgacaccgcctctgccctgtat
KU964132_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgccctgtat
KU964125_C_P-B      ttgccttctaacttctttccttctattcgagatctactcgacaccgcctctgccctgtat
KU964126_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgccctgtat
KU964130_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgccctgtat
KU964133_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgccctgtat
KU964135_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgccctgtat
KC492739_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX429910_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcttctgctctgcat
GQ924647_C_P-B      ttgccttctgatttctttcctgctattcgagatctcctcgacaccgcctctgctctgtat
AY217361_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccgctgctctgtat
KU576938_C_P-B      ttgccttctgacttctttccttccgttcgagatctgctcgacaccgcctctgctctgtat
KP036970_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
AY217364_C_P-B      ttgccttctgacttctttccttctattcgagatctcctggacaccgccactgctctgtat
JQ040157_C_P-B      ttgccttctgayttctttccttctattcgagatctcctcgacaccgmcwctgctctgtat
DQ144602_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480349_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480341_C_P-B      ttgccttctgacttctttccttctattcgagatttcatcgacaccgcctctgctctgtat
AF480364_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480353_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480351_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480343_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480363_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480352_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480348_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480360_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480346_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480359_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480361_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480358_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480350_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480340_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480354_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480347_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480337_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AF480344_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AF480342_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AF480356_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AF480339_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480355_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480345_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480338_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480357_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF480362_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674391_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
MZ671237_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MZ675786_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
FJ755833_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667637_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
KU667649_C_P-B      ttgcctcctgacttccttccttctattcgagatctcctcgacaccgcctctgctctgcat
KU576803_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576808_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040907_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
MK040901_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037798_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctttgtat
MK037799_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctttgtat
MK037803_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037796_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037797_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037808_C_P-B      ttgccttctgactctttcctttctattcgagatctcctcgacaccgcctctgctctgtat
MK037807_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037806_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037805_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037801_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037800_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037802_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037804_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040905_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040906_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038313_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacgccgcctctgctctatat
MG571363_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
KU667739_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgataccgcctctgctctgtat
KC774405_C_P-B      ttgccttctgacttctttccttccatccgagatctcctcgacaccgccactgctctgtat
JX504538_C_P-B      ttaccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
JX026883_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
JX026881_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576807_C_P-B      ttgcctcctgatttctttccttctattcgagatctcctcgacaccgtctctgctctgcat
KU576809_C_P-B      ttgcctcctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
KX276777_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668234_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173362_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctatat
EU939559_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426104_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KU576990_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtag
KU576621_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcttctgctctgcat
KU576617_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcttctgctctgcat
KU576612_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcttctgctctgcat
KU576614_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcttctgctctgcat
KU667507_C_P-B      ttgccttctgacttctttcctagtattcgagatctcctcgacaccgcctctgctctgtat
FJ562316_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU919173_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037910_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KU577118_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
KT749851_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctttgctctgtat
JX507213_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgyat
JX026886_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ040169_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgcgttgcat
FJ562234_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964287_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964289_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964290_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964291_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964292_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964293_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964294_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964295_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964296_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964297_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964298_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964299_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964300_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964301_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964302_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
KU964288_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgccaatgctctgtat
MK040808_C_P-B      ttgccttctgacctttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571373_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377525_C_P-B      ttgccttctgacttttttccttctattcgagatcttctcgacaccgcctctgctctccat
MT426103_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534576_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040831_C_P-B      ttgccttctgacttctttccttctatttgagatctcctcgacaccgcctctgctctgtat
MK037776_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571349_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674450_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KY470960_C_P-B      ttgcctcctgacttcttcccttccattcgagatctcctcgacaccgcctctactctgtat
KY470961_C_P-B      ttgcctcctgacttcttcccttccattcgagatctcctcgacaccgcctctactctgtat
KY417926_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963828_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963829_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963830_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963831_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963832_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963833_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963834_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963835_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963836_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963837_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963838_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963839_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963840_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963841_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU963855_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KU576322_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ803820_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173403_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173404_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774413_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377582_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgctactgctctgtat
GQ377550_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562240_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgcat
EU939664_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU939637_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB205120_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AB073822_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgcat
JQ341477_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ040128_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgcgctgtat
FJ518811_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcttctgctctgcat
FJ386600_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
DQ144550_C_P-B      ttgccttctgacttctctccttctattcgagatctcctcgacaccgcctctgctctgtat
AF324089_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgccactgctctgtat
KY689553_C_P-B      ttgccttctgacttctttcctgctattcgagatctcctcgacaccgcctctgctctgtat
HM153811_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KU668124_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668061_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576794_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576792_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576788_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576783_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576782_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576781_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576777_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576784_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576785_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576793_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668115_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668133_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668149_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576780_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037587_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667574_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
FJ386636_C_P-B      ttgccttctgatttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
AF233237_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcttctgctctgtat
EU305547_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
AF157023_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF157025_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF157024_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571324_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173339_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173340_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689551_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689538_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689508_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689513_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689514_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040834_C_P-B      ttgccttcagacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040812_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037528_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MH663473_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571371_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU667686_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667555_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576186_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KP148582_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173368_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774404_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774386_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KC774372_C_P-B      ttgccttctgacttctttccttctattcgagatctccttgacaccgcctctgctctgtat
JX869998_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX507210_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ801471_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562254_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU522066_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306703_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
EU306699_C_P-B      ttgccttctgacttctttccttctattcgagatttcctcgacaccgcctctgctctgtat
AY596106_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY269120_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY269095_C_P-B      ttgccttctgacttctctccttctattcgagatctcctcgacaccgcctctgctctatat
DQ144564_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ144594_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815699_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815706_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815707_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815710_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815701_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963960_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963962_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963963_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963964_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963965_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963968_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963969_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963970_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963971_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963972_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963973_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963974_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963975_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963961_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963966_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963967_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038144_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667702_C_P-B      ctgccttctgacttctttccttctattcgagatctcctcgacacctcctccgctctgtat
FJ386582_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK037814_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668009_C_P-B      ttgccttctgacttcttccctaatattcgagatctcctcgacaccgcctctgctctgtat
GQ475340_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AY217357_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgcgttgtat
AY217358_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgcgttgtat
FJ032357_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ032358_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT645025_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881721_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881722_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881723_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881724_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881725_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881726_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881727_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881728_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881729_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881730_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881731_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881732_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881733_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881734_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881735_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881740_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881741_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881745_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881746_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881747_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881752_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881753_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881756_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881757_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881759_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881760_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881761_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881778_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881779_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173386_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ448626_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881789_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
AY596110_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667676_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KU576472_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB073823_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774380_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KC774388_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KY689511_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689408_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037610_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534711_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534704_C_P-B      ttgccttctgacttttttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK534683_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK534658_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534627_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK052965_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040866_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040864_C_P-B      ttgccttccgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040861_C_P-B      ttggcttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040860_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040858_C_P-B      ttgccttctgacttctttccttctattcgagatctccccgacaccgcctctgctctgtat
MK040844_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040832_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038248_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK038245_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK038230_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038226_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038218_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038217_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038209_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037926_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037917_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037911_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037794_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037789_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037775_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
MK037599_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037596_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037525_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG826153_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571362_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
MF674485_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668099_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040865_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667823_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667708_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576325_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KR152339_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148581_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148345_C_P-B      ttgccttctgacatctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KM392084_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC836861_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774410_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774392_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774382_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774377_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgccttgtat
KC774374_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774368_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX661477_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
JX661476_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX661470_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX429899_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
JQ801524_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815778_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815712_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815587_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ924644_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ924607_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ787444_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386684_C_P-B      ttgccttccgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386666_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386610_C_P-B      ttgccttctgacttctttccttctnttcgagatctcctcgacaccgcctctgctctgtat
FJ386584_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgcgctgtat
EU939676_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgcat
EU439020_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306712_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccacctctgctctgtat
EU306707_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306702_C_P-B      ctgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ144591_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY766463_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgcctctgctctgtat
AF100308_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB073831_C_P-B      ttgccttctgacttctttccttctattcgagatctcatcgacaccgcctctgctctgtat
MK040859_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510641_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
KC510649_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
KC510652_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
EU306711_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF335738_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgcactgcat
MK037792_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037791_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037787_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037784_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037783_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037782_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037497_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037788_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037785_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037786_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037790_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037793_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037795_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ801507_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
AB471854_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
AB471855_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
JQ040170_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK534710_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK534705_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK534703_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK534693_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK534733_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK534692_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
AF324078_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
EU305548_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
JX429902_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KJ173375_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173376_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377639_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148342_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU439021_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY881785_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF461362_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
GQ377567_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964093_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU964095_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU964097_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU964099_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU964103_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU964106_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU964094_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037761_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU939666_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037765_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815739_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815705_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815709_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815700_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815696_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815695_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB205119_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815679_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815680_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815681_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815683_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815684_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815685_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815686_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815687_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815688_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815689_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815691_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815692_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815693_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815694_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815697_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815698_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815702_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815703_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815704_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815708_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815711_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815713_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815715_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815716_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815717_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815718_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815719_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815720_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815721_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815723_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815724_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815725_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815726_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815727_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815728_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815729_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815730_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815731_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815732_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815733_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815734_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815735_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815736_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815737_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815738_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815740_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815741_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815742_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815743_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815744_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815745_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815746_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815722_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426859_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426860_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426861_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426862_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KP148341_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534571_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963987_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774395_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU434372_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU434373_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963976_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963977_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963978_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963979_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963980_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963981_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963982_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963983_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963984_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963985_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963986_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963988_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963989_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774408_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
MF674480_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
MK037820_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674503_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AP011084_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815612_C_P-B      ttgccttctgacttctttccttctattcgagatcccctcgacaccgcctctgctctgtat
GU815609_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815605_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815599_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815589_C_P-B      ttgccttctgacttctttccttctatttgagatctcctcgacaccgcctctgctctgtat
GU815579_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815581_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815583_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815584_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815585_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815586_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815588_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815590_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815591_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815593_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815594_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815595_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815596_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815597_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815598_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815601_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815602_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815603_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815604_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815606_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815607_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815608_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815610_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815611_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815613_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815614_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815600_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037923_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037919_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037918_C_P-B      ttgccttctgacttccttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037907_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037898_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037921_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037937_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KU667427_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668002_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576328_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576324_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576321_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576319_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576326_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576327_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576320_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173382_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KJ173413_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
JX978431_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX429897_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcccctgctctgtat
GQ924634_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510644_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510648_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510656_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040863_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534694_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JN406371_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377542_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
GQ377569_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774398_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037930_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037901_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037914_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037830_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037818_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037816_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037823_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037828_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037834_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037817_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
GU815747_C_P-B      ttgccttctgacttctttccttctattcgagatctcatcgacaccgcctctgctctgtat
GU815748_C_P-B      ttgccttctgacttctttccttctattcgagatctcatcgacaccgcctctgctctgtat
GU815777_C_P-B      ttgccttctgacttctttccttctattcgagatctcatcgacaccgcctctgctctgtat
AY293309_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ448625_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774409_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF335740_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgcactgtat
AF335741_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgcactgtat
AB073834_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571342_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689554_C_P-B      ttgccttctgacttctttccttctatttgagatctcctcgacaccgcctctgctctgtat
KY689413_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT645041_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426900_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426893_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426890_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426887_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcatctgctctgtat
MT426878_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426867_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaccgcatctgctctgtat
MT426863_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426864_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426865_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426866_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426868_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426869_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426870_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426871_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426872_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426873_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426874_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426875_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426876_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426877_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426879_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426880_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426881_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426882_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426883_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426884_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426885_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426886_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426888_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426889_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426892_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426894_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426895_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426896_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426897_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426898_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426899_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426901_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426902_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426903_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426904_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426905_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MK534591_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534572_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040870_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040871_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040868_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040855_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040850_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040846_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040845_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040841_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038319_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038244_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038241_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038240_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038229_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038227_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038223_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038222_C_P-B      ttgccttctgacttctttccttctatccgagatctcctcgacaccgcctctgctctgtat
MK038215_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038212_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038210_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038167_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038166_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037835_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037614_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037613_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037591_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037527_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037526_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037529_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037530_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037531_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037532_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037533_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037534_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY470962_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY470954_C_P-B      ttgccttctgacttctttccttctattcgaggtctcctcgacaccgcctctgctctgtat
KY470953_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963799_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963800_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963801_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963802_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963803_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963804_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963805_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963806_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963807_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963808_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963809_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963810_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963811_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963812_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU963813_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KU668101_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668100_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667869_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667860_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU577121_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU577120_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgccctgtat
KU577117_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KR232337_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148579_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacgccgcctctgctctgtat
KP148348_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148336_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148338_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148339_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148343_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148347_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173416_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173417_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173409_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173410_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173405_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173406_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173397_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173398_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173389_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173390_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173356_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173355_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173352_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173354_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774416_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC836857_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC836874_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774401_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774390_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774387_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774383_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774389_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774381_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774363_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774378_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774384_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510646_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510653_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510659_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510642_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510655_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX661484_C_P-B      ttaccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX661473_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JF412801_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815780_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815776_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815775_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815773_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815772_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815774_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815779_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815781_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815782_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815783_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815765_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815761_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815764_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815754_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815753_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815752_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815751_C_P-B      ttgccttctgacttctttccttctattcgaggtctcctcgacaccgcctctgctctgtat
GU815749_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815750_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815755_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815756_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815757_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815759_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815762_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815766_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815767_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815768_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815769_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815770_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815771_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377587_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377566_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377568_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386683_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386655_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ023569_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU796068_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX661471_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU595031_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcttctgctctgtat
KJ173357_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcttctgctctgtat
EU439018_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU439022_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU439023_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306709_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306705_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306700_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306701_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306704_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306706_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306708_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306710_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ993708_C_P-B      ttgccttctgacttctttccttctattccagatctcctcgacaccgcctctgctctgtat
DQ975271_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ448628_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ144599_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ144560_C_P-B      ttgccttctgacttctttccttctattcaagatctcctcgacaccgcctctgctctgtat
DQ144597_C_P-B      ttgccttctgacttctttccttctattcaagatctcctcgacaccgcctctgctctgtat
AY596102_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY518556_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
DQ448624_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
KP148583_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MK052962_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MT426891_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
AF324086_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571356_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB675676_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
GQ377629_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KP148340_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
AB300364_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX661483_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT645057_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT645058_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY269135_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB073826_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY269115_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ448620_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ993696_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ993709_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386668_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377558_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377588_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377638_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377643_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU357842_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JF775480_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JF775484_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JF899335_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ040173_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ688405_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX661472_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX661474_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX661475_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX661481_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510643_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510647_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510650_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510651_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510654_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510657_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510658_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC510660_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774366_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173351_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173353_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173361_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173367_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173381_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173387_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173388_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173407_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173408_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173414_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173415_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148346_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148349_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP148580_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU577111_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU577115_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667695_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668097_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668098_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674512_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571355_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037611_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037612_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037615_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038216_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038219_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038220_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038221_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038224_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038225_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038231_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038233_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038234_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038237_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038238_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038239_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038242_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038246_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040847_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040848_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040849_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040852_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040854_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040857_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040867_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040869_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040872_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040873_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534554_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534570_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534581_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534603_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668102_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KX276802_C_P-B      ttgcctactgacttctttccttctgttcgagatctgctcgacaccgccyatgctctgtat
KU964381_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964382_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964383_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964384_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964385_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964388_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964391_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964393_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964395_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964397_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964386_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964387_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964389_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964390_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964392_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KU964396_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacactgcttctgctctgtat
KX276812_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcchctgctctgtat
MF674440_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KX276796_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB073832_C_P-B      ttgcctactgacttctttcctkctgtacgagatctgctcgacaccgcctctgctctgtat
KJ803773_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcccttgctctgtat
KX276816_C_P-B      ttgccttctgacttctttccttctattcgagatctyctcgacaccgcctctgctctgtat
JQ801494_C_P-B      ttgccttctgacttttttccttctattcgagatctccttgacaccatctccgctctgcat
KY689483_C_P-B      ttgccttcggacttctttccttctrttcgagatctcctcgacaccgccactgctctgtat
MT426102_C_P-B      ttgccttctgacttctttccttctattcgggatctcctcgacaacgcctctgctctgtat
HM011473_C_P-B      ttgcctymtgacttctntccttctgttcgagatctcctcgacaccgcctctgctctgtat
MG571351_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY167093_C_P-B      ttgccttctgacttctttccctctgttcgagatctcctcgacaccgccgctgctctgtat
JQ801474_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctttgtat
MG571353_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgcat
MG571376_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgccactgctctgcat
KX276785_C_P-B      ttgccgtctgacttctttccttctattcgagatctcctcgacaccgcttctgctctgtat
GQ924624_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgcat
KX276771_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU939635_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KX276808_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcckctgctmtgtat
KJ173373_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KX276784_C_P-B      ttgccgtctgacttctttccttctgttcgagatctcctcgacaccgcttctgctctgtat
KX276803_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU919171_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ924605_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ993704_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
AF282918_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
X97851_C_P-B        ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ341497_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576180_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctttgtat
KU576338_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctctgctttgtat
KU576165_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctctgctttgtat
KU576173_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctctgctttgtat
KU576185_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU576636_C_P-B      ttgccttctgacttctttccttcgattcgagatctcctcgacaccgcctctgctttgtat
MG571367_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgcctctgctctgtat
EU939665_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KX276805_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacacckcttctgctctgtat
MG571360_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ995805_C_P-B      ttgccttctgacttctttccgtctattcgagatcccctcgacaccgcctctgctttgtat
EF473974_C_P-B      ttgccttctgacttctttccttctattcgagatctcctccacaccgcctctgctttgaat
AB073821_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU158262_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB302945_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB302942_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB302944_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB302943_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KM213035_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY689555_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571368_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ803796_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MG571338_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacacatcatctgctctgtat
EU939670_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ448622_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctttat
KJ843165_C_P-B      ttgccttctgacttctttccttctattcaagatctactcgacaccgcctctgctctgtat
EF473973_C_P-B      ttgccttctgactcctttccttctattcgagatctcctcgacaccgcctctgctttgtat
JQ341481_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MG571374_C_P-B      ttgccttctgacttctttccttctattagagatctsctcgacaccgcctctgctctgtat
MG571331_C_P-B      ttgccttctgacttctttccctctattcgagatctcctcgacaccgcctccgctttgcat
KJ410490_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ562262_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
EU919172_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY596109_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
AF335748_C_P-B      ttgcctgctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
FJ386654_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037912_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037913_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctacat
MK037936_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037902_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
MK037909_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KC774367_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ993705_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK037595_C_P-B      ttgccttctgacttctttccttctatttgagatctcctcgacaccgcctctgctctgtat
KU668093_C_P-B      ttgccttctgacttctttccttcttttcgagatctcctcgacaccgcctctgctctgtat
AF121247_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037619_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KU576024_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ803817_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KC774400_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
JX661480_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
GQ924611_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668027_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EF494380_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgataccgcctctgctctgtat
KU576940_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF479684_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgttctgtat
AF121248_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571348_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX870001_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF233234_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF233231_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964158_C_P-B      ttgcctactgacttctttccttccattcgagacctcctcgacaccgcctctgctctgtat
KU964154_C_P-B      ttgccttctgacttctttcctgctattcgagatctcctcgacaccgcctctgctctgtat
KU964168_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964153_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964159_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964160_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964167_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964156_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964157_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964161_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964162_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964163_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU964166_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MK038139_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacgccgcctctgctctgtat
MK038143_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgactccgcctctgctctgtat
MK038142_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgactccgcctctgctctgtat
MK038135_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgactccgcctctgctctgtat
MK038131_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgactccgcctctgctctgtat
MK038133_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgactccgcctctgctctgtat
MK038134_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgactccgcctctgctctgtat
AF335746_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
AF335754_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
KJ173374_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK075117_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY217359_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY217360_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306695_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306697_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306698_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU306696_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576939_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038162_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038159_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038151_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038149_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038129_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038132_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgactccgcctctgctctgtat
MK038165_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038160_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038155_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038147_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038146_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038145_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
KJ173399_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173400_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038137_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038153_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038157_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038161_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038164_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT111595_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038264_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038090_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK037648_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MG571364_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964164_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
KU668108_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU577003_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576022_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KC774396_C_P-B      ttgccttctgacttctttccttctattcgagatctcatcgacaccgcctctgctctgtat
GU815572_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ924606_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgntctgtat
DQ995801_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
D00330_C_P-B        ttgccttctgacttctttccgtcggtgcgagatctcctcgacaccgcctctgctttgtat
AB246339_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB287328_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963842_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963843_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963844_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963845_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963846_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963847_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963848_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963849_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963850_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963851_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963852_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963853_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038120_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038117_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038116_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038101_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038128_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038127_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcttccgctctgtat
MK038103_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038097_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccgcctccgctctgtat
MK038089_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038096_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038088_C_P-B      ttgccttctggcttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038084_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038099_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038114_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038115_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038121_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038124_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038126_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038027_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963825_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963824_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963814_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963815_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963817_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963818_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963820_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963821_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963822_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963823_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963826_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963827_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963854_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963819_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040856_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038030_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037997_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037991_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386583_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctctat
MK038012_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038031_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038123_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038118_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038107_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctccgctctgtat
MK038086_C_P-B      ttgccttctgacttctttccttctatttgagatctcctcgacaccgcctccgctctgtat
MK038122_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038113_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038111_C_P-B      ttgccttctgacttctttcctcctattcgagatctcctcgacaccgcctccgctctgtat
MK038108_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038081_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038082_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038083_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038092_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038102_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038106_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038109_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038110_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038112_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038119_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
MK038093_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KC774412_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774407_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774393_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctccgctttgtat
AF324085_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576040_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576053_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576054_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU577004_C_P-B      ttgccttctgacttctttctttctattcgagatctcctcgacaccgcctctgctctgtat
KU576052_C_P-B      ttgccttctggcttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576044_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576042_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576041_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576038_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576026_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX429900_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774411_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576039_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576045_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576043_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EF473975_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ410507_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ410516_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ410517_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040877_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MZ671236_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MW310264_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT426100_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038311_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037813_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037647_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037618_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037617_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MH061283_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571347_C_P-B      ttgccttctgacttctttccttctattcgagatctccttgacaccgcctctgctctgtat
MG571346_C_P-B      ttgccttctgacttctttccttctatacgagatctcctcgacaccgcctctgctctatat
MG571341_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MG571322_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KX765856_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963951_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668069_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU577081_C_P-B      ttgccttctggcttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ803764_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173369_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KJ173370_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
JX869999_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
JQ040125_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815678_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
FJ386634_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU570069_C_P-B      ttgccttcagacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ993700_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ993701_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ993702_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ448619_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
AY220698_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY167097_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF121251_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF121249_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB073840_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctggat
AB073833_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ448623_C_P-B      ttgccgtctgacttctttccttctattcgagatctcctcgacaccgcttctgctctgtat
KU668116_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668037_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668046_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668058_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774417_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774402_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774391_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774373_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774379_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774385_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815677_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815676_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815673_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815669_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815668_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815664_C_P-B      ttgccttctgacttttttccttctattcgcgatctcctcgacaccgcctctgctctgtat
GU815662_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815659_C_P-B      ttgccttctggcttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815657_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815646_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815641_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815640_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815635_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815627_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815616_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815617_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815618_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815620_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815621_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815622_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815623_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815624_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815625_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815626_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815628_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815629_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815630_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815631_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815632_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815633_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815634_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815636_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815637_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815638_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815642_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815643_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815644_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815645_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815647_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815648_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815649_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815650_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815651_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815652_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815653_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815654_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815656_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815658_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815660_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815661_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815663_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815665_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815666_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815667_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815670_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815672_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815674_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815675_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815619_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037644_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037643_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037639_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037638_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037627_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037624_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037637_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037640_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037641_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037649_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037650_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK040876_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037621_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK037622_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MK534601_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KM359440_C_P-B      ctgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KJ173420_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
KJ173421_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
JQ801512_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctttgtat
AF121243_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
AF121244_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
AF121245_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
AF121246_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
JX507215_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
DQ993699_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571328_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815558_C_P-B      ttgccttctgacttctttcctcctattcgagatctcctcgacaccgcctctgctctgtat
DQ448621_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ801514_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY167089_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038232_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MZ671238_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
MZ671239_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
MZ675785_C_P-B      ttgccttctgacttctttccttctattcgagatctactcgacaccgcctctgctctgtat
MK534707_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037626_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtat
MG571366_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674426_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964165_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964155_C_P-B      ttgccttctgacttctttcctgctattcgagatctcctcgacaccgcctctgctctgtat
KU963956_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963949_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KM392072_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KM392083_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038312_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173422_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173423_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173359_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173360_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX661479_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX429908_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ801479_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JQ040171_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JN827419_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815573_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815554_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815552_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815564_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815550_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815548_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815549_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815551_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815553_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815555_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815556_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815557_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815559_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815560_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815561_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815562_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815563_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815565_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815566_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815567_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815568_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815569_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815570_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815571_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815575_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815576_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU451682_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ924627_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
GQ924610_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ924603_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ855532_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963945_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963946_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963947_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963948_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963950_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963952_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963953_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963954_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963955_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963957_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963958_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU963959_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ855522_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377625_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377547_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU570071_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU570070_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB195933_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ924653_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571369_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB073828_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ993697_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB073827_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB073829_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB195934_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB195935_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ448627_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU350409_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ377612_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GQ924608_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774375_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774399_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774403_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173343_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173345_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173365_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173366_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173424_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173425_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ803763_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674427_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674449_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571344_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571365_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037556_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038320_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667549_C_P-B      ttgcctggcgacttctatccttctattcgagatctcctcgataccgcctctgctctgtat
KU668293_C_P-B      ttgcctggcgacttctatccttctattcgagatctcctcgataccgcctctgctctgtat
KU576749_C_P-B      ttgcctggcgacttctatccttctattcgagatctcctcgataccgcctctgctctgtat
KU667539_C_P-B      ttgcctggcgacttctatccttctattcgagatctcctcgataccgcctctgctctgtat
KU576628_C_P-B      ttgcctggcgacttctatccttctattcgagatctcctcgataccgcctctgctctgtat
KU576145_C_P-B      ttgcctggcgacttctatccttctattcgagatctcctcgataccgcctctgctctgtat
KU576736_C_P-B      ttgcctggcgacttctatccttctattcgagatctcctcgataccgcctctgctctgtat
KU667528_C_P-B      ttgcctaatgacttctttccttctattcgagatctcctcgataccgcctctgctctgtat
KU667517_C_P-B      ttgcctaatgacttctttccttctattcgagatctcctcgataccgcctctgctctgtat
KU668302_C_P-B      ttgcctactgacttctttccttctattcgagatctcctcgatactgcctctgctctgtat
KU576146_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgataccgcctctgctctgtat
KU576148_C_P-B      ttgcctactgacttcttttcttctattcgagttctcctcgataccgcctctgctctgtat
HM011483_C_P-B      ttgcctyttgayttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571352_C_P-B      ttgcctgctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtat
MK040784_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MK040782_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcatctgctctgtat
MK040789_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcagctgctctgtat
EU564825_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccgcctctgctctgtat
EU564826_C_P-B      ttgccttctgacttctttccttctgttcgagatcttctcgacaccgcctctgctctgtat
EU939636_C_P-B      ttgcctcctgacttttatccttctattcgagatctcctcgataccgcctctgctctatat
KX276772_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571337_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgyat
KU667891_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667531_C_P-B      ttgccttctgacttttatcctaatgttcgagatctgctcgacaccgcctctgctctgtat
MF568491_C_P-B      ttgcctcctgacttctttcctaatattcgagacctcctcgacaccgcctctgctctgtat
KU667859_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctccgctctgtat
KU667840_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667936_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU668367_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU668308_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667938_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667422_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgataccgcctctgctctgtat
KU576387_C_P-B      ttgccttccgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667438_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667569_C_P-B      ttgccttctgacttctttcctaatattcgagacctcctcgacaccgcctctgctctgtat
KU667508_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667493_C_P-B      ttgccttctgacttctttcctaatattcgagacctcctcgacaccgcctctgctctgtat
KU667460_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667469_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667540_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667412_C_P-B      ttgccttctgacttttttcctaatattcgagacctcctcgacaccgcctctgctctgtat
KU668358_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU668318_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgacaccgactctgctctgtat
KU668330_C_P-B      ttgccttctgacttttttcctaatattcgagatctcctcgacaccgcctctgctctgtat
MF568485_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU668132_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU668169_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667448_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU668289_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU668076_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667879_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667700_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667619_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU668103_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU668299_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU668307_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667980_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU668300_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667955_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667996_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU668167_C_P-B      ttgtcttctgacttctttccttctattcaagatctcctcgacaccgcctctgctctgtat
KU667492_C_P-B      ttgtcttctggcttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667957_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccacctctgctctgtat
KU668305_C_P-B      ttgtcttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgtat
KU667812_C_P-B      tagtcttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667740_C_P-B      ttgtcttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF568475_C_P-B      ttgtcttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668012_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacatcgcctctgctctgtat
KU667506_C_P-B      ttgtcttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667968_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668304_C_P-B      ttgtcttctgacttctttccttctatccgagatctcctcgacaccgcctctgctctgtat
KU667640_C_P-B      ttgtcttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667586_C_P-B      ttgtcttctgacttctttccttctattcaagatctcctcgacaccgcctctgctctgtat
KU667455_C_P-B      ttgtcttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668165_C_P-B      ttgtcttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU668014_C_P-B      ttgccttctgacttctttccatctattcgagatctcctcgacaccgcctctgctctgtat
KU667817_C_P-B      ttgtcttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667787_C_P-B      ttgtcttctaacttctttccttctattcgagatctccccgacaccgcctctgctctgtat
KU667647_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667473_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667481_C_P-B      ttgccttctgacttccttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667701_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667794_C_P-B      ttgccttctgactcctttccttctattcgagacctcctcgacaccgcctctgctctgtat
KU667768_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK534727_C_P-B      ttgcctactgacttctttccttccattcgagatctcctcgacaccgcctctgctctgtat
MG571354_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KU667944_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgctactgctctgtat
KU667951_C_P-B      ttgccttctgacttctttcctactattcgaaatctcctcgacaccgctactgctctgtat
KU576622_C_P-B      ttgccttctgatttctttcctactattcgagatctcctcgacaccgccactgctctgtat
KU668259_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgctactgctctgtat
KU668229_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgctactgctctgtat
KU668278_C_P-B      ttgccttctgacttctttcctactattcgagatcccctcgacaccgctactgctctgtat
KU668202_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgctactgctctgtat
KU668249_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgctactgctctgtat
KU668238_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgctactgctctgtat
KU576611_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgctactgctctgtat
KU576613_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgctactgctctgtat
KU576616_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgctactgctctgtat
MF568474_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgctactgctctgtat
KU668290_C_P-B      ttgccttctgacttctttcctactattcgagatctcctcgacaccgctactgctctgtat
KX276782_C_P-B      ttgcctgctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038341_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctactctgtat
GQ924648_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AB073836_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173371_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173372_C_P-B      ttgccttctgacttctttccttctattcgagaactcctccacaccgcctctgctctgtat
KP406273_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406260_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406257_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406280_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406269_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406271_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406262_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406266_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
FJ386688_C_P-B      ttgccttctgacttctttccgtctattcgagatctcctcgacaccgcctctgctctgtat
FJ386615_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KU575981_C_P-B      ttgcctactgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575927_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575922_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575982_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575976_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575959_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576740_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575983_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575979_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AF100309_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575945_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575973_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575974_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575975_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575978_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575980_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575984_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU575928_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
JX026879_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcttctgctctgtat
JX429911_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcttctgctctgtat
EU939638_C_P-B      ttgccttctgacttctttccttctgttcgagatctsctcgacaccgcctctgctctgtat
FJ787477_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406249_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406246_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406244_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406247_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406248_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406251_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406252_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406253_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406254_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406245_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406250_C_P-B      ttgccttcggacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173347_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KJ173348_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctccgctctgtat
KJ173384_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KJ173383_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
GU815639_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AY596104_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgatctgtac
KC774376_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
FJ562303_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgctgctgctctgtat
MK038474_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173379_C_P-B      ttgccttctgacttctttccttctgttcgagagctcctcgacaccgcctctgctctgtat
FJ562219_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KJ173377_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KJ173380_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038503_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038156_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038505_C_P-B      ttgccttctgacttttttccttctgttcgagatctccttgacaccgcctctgctctgtat
MK038502_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038494_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctatgtat
MK038487_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038489_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038498_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038499_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038504_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038497_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038492_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038475_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038509_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038490_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038493_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK040775_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgactccgcctctgctttgtat
KU667581_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacgccgcctctgctctgtat
KP406282_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406290_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406291_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406283_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK040739_C_P-B      ttgccttctgacttctttccttctgttcgagatctactcgacaccgcctctgctctgtat
MK040745_C_P-B      ttgccttctgacttctttccttctgttcgagatctactcgacaccgcctctgctctgtat
MK040750_C_P-B      ttgccttctgacttctttccttctgttcgagatctactcgacaccgcctctgctctgtat
MK040744_C_P-B      ttgccttctgacttctttccttctgttcgagatctactcgacaccgcctctgctctgtat
MK040747_C_P-B      ttgccttctgactcctttccttctgttcgagatctactcgacaccgcctctgctctgtat
KC774415_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AY167100_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040748_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK040749_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK040740_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040742_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815574_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815577_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
GU815578_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MF674506_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MG571323_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KY470956_C_P-B      ttgccttctgacttttttccttctattcgagatctccttgacaccgcctctgctctgtat
KU667796_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667784_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK040809_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038485_C_P-B      ctgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038347_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667591_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038339_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgccactgctctgtat
MK038356_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038353_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgccactgctctgtat
MK038331_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038342_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038368_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038334_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667612_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576804_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU576806_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037570_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038501_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038478_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038357_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
AB287329_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038359_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038350_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038332_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038348_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038354_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038355_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038360_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774371_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KC774365_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038345_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MT448621_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173363_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ173364_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534573_C_P-B      ttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU522067_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK534629_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038479_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038473_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK038491_C_P-B      ttgccttctgacttttttccttctgttcgagatctcctcgacaccgcctctgctctgtat
MK037925_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038480_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038481_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038486_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038488_C_P-B      ttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406311_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406303_C_P-B      tngccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406299_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406292_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406307_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406308_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406309_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406310_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406313_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406315_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406316_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406317_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406304_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406302_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406301_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406297_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406305_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406306_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406312_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406314_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406288_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406298_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406296_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406300_C_P-B      ttgcctcctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406294_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KP406281_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406284_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406286_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406289_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406293_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406285_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
KP406287_C_P-B      ttgccttctgacttcttcccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038268_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
DQ993711_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038058_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038291_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038287_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038284_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038278_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038066_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038063_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038060_C_P-B      ttgccttctgactcctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038037_C_P-B      ttgccttctgacttctttccttctattcgagatttcctcgacaccgcctctgctctgtat
MK038281_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038258_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038080_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038079_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038076_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038075_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038074_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038073_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038072_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038071_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038070_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038068_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038057_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038056_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtat
MK038055_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038054_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038047_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038046_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038045_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038043_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038044_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038035_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038036_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038038_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038039_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038040_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038041_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038048_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038049_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038050_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038051_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038052_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038053_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038059_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038061_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038062_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038064_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038067_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038077_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038078_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038042_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038261_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038247_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038283_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038251_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038280_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038279_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038274_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038272_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038269_C_P-B      ttgccttccgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038266_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038277_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038255_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038250_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038256_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038265_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038267_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038285_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK038289_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667546_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
KU963816_C_P-B      ttgccttctgacttctttccatctattcgagacctcctcgacaccgcctctgctctgtat
MK037509_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037516_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037511_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK040774_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037512_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037510_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK040769_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK040790_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037515_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037522_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427097_C_P-B      ttcccttctgacttctctctttctattcgagacctcctcgacaccgcctctgctctgtat
MT427056_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037519_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427108_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427072_C_P-B      tttccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427079_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427109_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427104_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427086_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427089_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427082_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427075_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427067_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427066_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427062_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427055_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427042_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427037_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427036_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427026_C_P-B      ttgccttccgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427018_C_P-B      ttgccttctgacttctttccttctattcgagaccttctcgacaccgcctctgctctgtat
MK040778_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK040770_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037521_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037518_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK037517_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK040776_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MK040777_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
DQ993703_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427016_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427017_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427019_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427020_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427021_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427022_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427023_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427024_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427025_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427027_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427028_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427029_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427030_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427031_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427032_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427033_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427034_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427035_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427038_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427039_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427040_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427041_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427043_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427044_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427045_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427046_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427047_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427048_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427049_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427050_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427051_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427052_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427053_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427054_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427057_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427058_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427059_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427060_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427061_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427063_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427064_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427065_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427068_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427069_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427070_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427071_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427073_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427074_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427077_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427078_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427080_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427081_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427083_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427084_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427085_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427087_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427088_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427090_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427091_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427092_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427093_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427094_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427095_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427096_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427099_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427102_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427103_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427105_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427106_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427107_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427098_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427100_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427076_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
MT427101_C_P-B      ttgccttctgacttctttccttctattcgagacctcctcgacaccgcctctgctctgtat
AY206391_C_P-B      ttgccgtctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EF494382_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgccaatgctctgtat
KU667811_C_P-B      ttgccttctgacttctttccttctgtgcgagatctgatcgacaccgcctctgctctgtat
KU667825_C_P-B      ttgccttccgacttctttccttccattcgagatctgctcgacaccgcttctgctctgtat
KU576876_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KU667834_C_P-B      ttgccttccgacttctttccttccattcgagatctgctcgacaccgcttctgctctgtat
KU667773_C_P-B      ttgccttctgacttctttccttccattcgagatctgctcgacaccgcttctgctctgtat
KU667668_C_P-B      ttgccttccgacttctttccttccattcgagatctgctcgacaccgcttctgctctgtat
KU667835_C_P-B      ttgccttccgacttctttccttccattcgagatctgctcgacaccgcttctgctctgtat
JQ027315_C_P-B      ttgccttctgacttctttccttctgttcgagatctactcgacaccgcctctgctctgtat
AB073839_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
MK037558_C_P-B      ttgccttctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MK037827_C_P-B      ttgccttctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtat
MK037824_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
MK037831_C_P-B      ctgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KJ410502_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
JQ027329_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
GQ924660_C_P-B      ttgccttctgacttctttccttctattcgagatcttctcgacaccgcctccgctttgcat
KM875427_C_P-B      ttgcctgccgacttctttccttccattcgagatctcctcgacactgcatctgctctgtat
KC492740_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KU964152_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964138_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964139_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964140_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964142_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964144_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964145_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964147_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964148_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964150_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964151_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964141_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964143_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964146_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU964149_C_P-B      ttgccgtctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
JX504543_C_P-B      ttgccttctgacttctttcctaatattcgagatctcctcgacaccgcctctgctctgtat
KU667801_C_P-B      ttgccttctgacttctttccttctgttcgagatctgctcgacaccgcctctgctctgtat
KU667730_C_P-B      ttgccttctgacttctttccttctgttcgagatctgctcgacaccgcctctgctctgtat
KU667828_C_P-B      ttgccttctgacttctttccttctgttcgagatctgctcgacaccgcctctgctctgtat
KU668243_C_P-B      ttgccttctgacttctttccttctgttcgagatctgctcgacaccgcctctgctctgtat
KY881861_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU667789_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
FJ899786_C_P-B      ttaccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
FJ899787_C_P-B      ttaccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
EU939672_C_P-B      ttaccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
FJ899784_C_P-B      ttaccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
FJ899785_C_P-B      ttaccttctgacttctttccttctgttcgagacctcctcgacaccgcctctgctctgtat
AY206390_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
AY238972_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KY881792_C_P-B      ttgccttctgacttctttccttctattcaagatctgctcgacaccgcctctgctctgtat
EU939667_C_P-B      ttgccttctgacttctttccttctgttcgagatctactcgacaccgcctctgctctgtat
FJ386680_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgcaactgctctgtat
FJ562321_C_P-B      ttgccttctgacttctttccttctattcgggatcttctcgacaccgccactgctctgtat
KY881838_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgcat
EU939660_C_P-B      ttgccttctgacttctttccttctatacgagatctcctcgacaccgctactgctctgtat
KU576879_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KU576875_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KU576877_C_P-B      ttgcctcctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881783_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
GQ377622_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
EU796066_C_P-B      ttgccttctgacttctttccttcgattcgagatctactcgacaccgcctctgctctgtat
KY881833_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881826_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgcgt
KY881834_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgcat
KY881830_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgcat
KY881825_C_P-B      ttgccttctgacttctttccttctgttcgagatctgctcgacaccgcctctgctctgtat
MK037995_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881799_C_P-B      tttccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881829_C_P-B      ttgccttctgacttcttcccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038029_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038023_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038018_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038000_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881823_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881794_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881827_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881828_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881831_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881820_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgcat
KY881839_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881841_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881836_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881843_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881821_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881824_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881835_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881822_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881798_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881796_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038013_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038010_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038003_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038001_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK037988_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK037990_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038005_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038015_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038032_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK037989_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038026_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038016_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038011_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038002_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK037999_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK037994_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038006_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
MK038009_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881842_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881808_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881797_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgcat
KY881788_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881786_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881780_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881781_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881782_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881784_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881787_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881790_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881791_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881793_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881800_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881801_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY881795_C_P-B      ttgccttctgacttctttccttctattcgagatctgctcgacaccgcctctgctctgtat
KY689494_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KY689562_C_P-B      ttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctctgctctgtat
KU964080_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KU964082_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KU964091_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgaaaccgccactgctctgtat
KU964084_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KU964088_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KU964087_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KU964089_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KU964090_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KU964092_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KU964085_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KU964079_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KU964081_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KU964086_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KU964083_C_P-B      ttgccttctgacttctttccttccattcgagatctcctcgacaccgccactgctctgtat
KY881844_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctacat
KY881863_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctacat
KY881902_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctacat
KY881903_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctacat
KY881905_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctacat
KY881912_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881862_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatgt
KY881856_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881854_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881846_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881867_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881909_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881908_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881904_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881911_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881899_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881898_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881894_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881897_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881901_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881893_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881859_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881857_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881851_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacgccgcctctgctctatat
KY881848_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881847_C_P-B      ttgccttctgacttctatccttctattcgagatctcctcgacaccgcctctgctctatat
KY881852_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881855_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881858_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881860_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881866_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881868_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881895_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881896_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881900_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881906_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881907_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881910_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881913_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
KY881914_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatat
AF121250_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgcat
KU576046_C_P-B      ttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtat
KU964394_C_P-B      ttgccttctgatttctttccttctattcgagatcttctcgacaccgcctctgctctacat
KU964244_C_P-B      ttgccttctgatttctttccttctattcgagatcttctcgacaccgcctctgctctacat
KU964246_C_P-B      ttgccttctgatttctttccttctattcgagatcttctcgacaccgcctctgctctacat
KU964251_C_P-B      ttgccttctgatttctttccttctattcgagatcttctcgacaccgcctctgctctacat
KU964253_C_P-B      ttgccttctgatttctttccttctattcgagatcttctcgacaccgcctctgctctacat
KU964254_C_P-B      ttgccttctgatttctttccttctattcgagatcttctcgacaccgcctctgctctacat
KU964247_C_P-B      ttgccttctgatttctttccttctattcgagatcttctcgacaccgcctctgctctacat
KU964249_C_P-B      ttgccttctgatttctttccttctattcgagatcttctcgacaccgcctctgctctgcat
KU964245_C_P-B      ttgccttctgatttctttccttctattcgagatcttctcgacaccgcctctgctctgcat
KU964255_C_P-B      ttgccttctgatttctttccttctattcgagatcttctcgacaccgcctctgctctgcat
KU964256_C_P-B      ttgccttctgatt