HBVdb

Dataset for nucleotide sequence X of genotype A

[Download (right click)] [Edit] [Sequences] [Repertoires]

986 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


EU054331_X_C-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MK512469_X_P-A      atggctgctaggttgtactaccaacaggattcttcgctggacgtcctttgtttacgttcc
MF925362_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
AY161142_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY161143_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY161144_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KX357650_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
LT992441_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacatcctttgtctacgtccc
JX310722_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JX310723_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ854709_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477479_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AJ627227_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ331046_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
EU859952_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
GQ331047_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AF297624_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB697487_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AF297621_X_P-A      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ843184_X_P-A      atggctgctcggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KF922406_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF922407_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF922408_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF922409_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
GQ477487_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcttttgtttacgtccc
EU859900_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477469_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
MF772347_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859901_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KC875260_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GU563550_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
GQ477462_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB453984_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AF297622_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
GQ477493_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP995108_X_P-A      atggctgctgtgctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477463_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477488_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477491_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GU563551_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477502_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477500_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY233286_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgcccc
KT749825_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
KT749826_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
KT749832_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
KT749834_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
KT749839_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
KT749846_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
KT749847_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
KT749849_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
KT749842_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
AB246338_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB453981_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697506_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697507_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB205118_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB480036_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
GQ184323_X_P-A      atggctgctaggctgtactcccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859932_X_P-A      atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
KJ843215_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ843216_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AF043580_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB697498_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697488_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697489_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697501_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697511_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697512_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
LC311241_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
GQ477482_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
EU859954_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
KX827293_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697505_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB116079_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB116080_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB300367_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB453979_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB453980_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB453982_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB480038_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB480041_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697491_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697496_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697497_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697499_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697503_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697504_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697508_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB697509_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB937798_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
KY886219_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
LC074724_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
LC311242_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
LC311243_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
MH932713_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB480040_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB116078_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY738142_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY738140_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY738139_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY738141_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY738143_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KT749822_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ586809_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707551_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707532_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU414133_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EF208113_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY233280_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB116076_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707672_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707659_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707537_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707658_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707661_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707662_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707663_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707664_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707665_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707667_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707669_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707670_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707674_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707675_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707676_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707681_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477504_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477494_X_P-A      atggctgctaagctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477474_X_P-A      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF143298_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KT749831_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
Z72478_X_P-A        atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
L13994_X_P-A        atgggtgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ843173_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707383_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
EU859938_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
X70185_X_P-A        atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ843186_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707418_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707414_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707413_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707411_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707405_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707403_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707400_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707402_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707397_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707371_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707372_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707373_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707375_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707377_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707378_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707379_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707381_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707382_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707384_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707386_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707387_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707388_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707390_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707391_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707392_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707393_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707394_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707395_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707396_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707399_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707404_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707406_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707407_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707408_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707409_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707410_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707412_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707415_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707416_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707417_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707419_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707420_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707374_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
EU859949_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859948_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
FJ349224_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP274927_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB300366_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB480039_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB116081_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB697492_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859930_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
X51970_X_P-A        atggctactaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
X02763_X_C-A        atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KX827298_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KU605532_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
MN507849_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KT749840_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KT749833_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718102_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718098_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718095_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718094_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttatttacgtccc
KP718100_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttatttacgtccc
KP718093_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718092_X_P-A      atggctgctaggctgtrctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718090_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718091_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718087_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KM519454_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ843182_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ843217_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707654_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707646_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707642_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707632_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707626_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707625_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707650_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707617_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707611_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707610_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KT749836_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707568_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707560_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707559_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707558_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707544_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707543_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707613_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707618_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707644_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707648_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707536_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707540_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707535_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GU563562_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GU563558_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707634_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GU563557_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GU563546_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477497_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707539_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707542_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707545_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707547_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707553_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707554_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707555_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707556_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707563_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707564_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477477_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477470_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707538_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707548_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707557_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707562_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707572_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KM606742_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KM606746_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477464_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ184324_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
FJ349222_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859941_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
EU859933_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
EU859943_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
GU563555_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
KT749824_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
KT749838_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtccc
EU859927_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859923_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859925_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ854710_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KT749843_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859917_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859906_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859903_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU594391_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU594389_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859946_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY902775_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP274925_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KT749850_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY862868_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY862867_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY128092_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AM282986_X_P-A      atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY707087_X_P-A      atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AF090841_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU594384_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU594386_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KT749829_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB775198_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB775199_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB775200_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB775201_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB937793_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB937794_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477467_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477503_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GU563553_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JX096952_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JX096953_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB453983_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB362931_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ843166_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ843192_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ843214_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB246337_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB116077_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859945_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ843218_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB126580_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB222707_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB549213_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB697493_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB697495_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB937792_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AF090839_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AF090840_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AF536524_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AJ012207_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AM295795_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AM295796_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AM295797_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AM295798_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AM295799_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AM410963_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
DQ788725_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU086721_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU185786_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU185787_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU185788_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU185789_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU594383_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU594388_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU594390_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU594392_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU594393_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU594394_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU594395_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859898_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859899_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859902_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859904_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859905_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859907_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859908_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859909_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859910_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859911_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859912_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859913_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859914_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859915_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859916_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859918_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859919_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859920_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859921_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859922_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859924_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859926_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859928_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859929_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859931_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859935_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859936_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859937_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859939_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859940_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859942_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859947_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859950_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859951_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859953_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859956_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ414522_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477461_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GU563554_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
HE576988_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
HE576989_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ687529_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ687533_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707531_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707541_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707546_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707549_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707550_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707552_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707566_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707567_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707573_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707585_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707591_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707594_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707609_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707612_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707614_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707615_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707616_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707619_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707620_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707621_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707623_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707624_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707628_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707629_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707631_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707633_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707635_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707636_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707637_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707638_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707639_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707640_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707641_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707643_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707645_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707647_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707649_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707651_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707652_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707653_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707655_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707656_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ854708_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KM606749_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP274928_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718088_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718089_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718097_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718099_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718101_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KT749830_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KT749835_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KT749837_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KT749844_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KX827294_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KX827295_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KX827296_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KX827297_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KY003230_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KY382410_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
LC430617_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
LC458430_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
LC458431_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP718096_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477466_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
MF772346_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
FJ904411_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB937797_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
DQ298162_X_P-A      atggcggctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
DQ298163_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
DQ298164_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
DQ298165_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
DQ298161_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477486_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477480_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY034878_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AF090838_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AJ627226_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707401_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
AB064314_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
MF772350_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
MF772349_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
MF772348_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ843188_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707533_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707340_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707306_X_P-A      atggctgataggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477490_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU747320_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AJ344115_X_P-A      atggctgctaggctgttctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707360_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477495_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477473_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477484_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707581_X_P-A      gtggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707362_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
V00866_X_P-A        atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
Z35717_X_P-A        atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707622_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707604_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707600_X_P-A      atggctgctaggctgtactgccaactggatccttcgagggacgtcctttgtttacgtccc
JQ707592_X_P-A      atggctgctgggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707589_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707582_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707598_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707571_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707570_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707565_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707561_X_P-A      atggctgctaggctgtactgccaactggatccttcacgggacgtcctttgtttacgtccc
JQ707534_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707577_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707595_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707596_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707601_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707605_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707380_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707385_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707376_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707389_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707398_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttcc
JQ707368_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707353_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttccgtccc
JQ707351_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707348_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707335_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707329_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707322_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707331_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707317_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707318_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707309_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707299_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707300_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707301_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707302_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707303_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707304_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707305_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707307_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707308_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707310_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707311_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707312_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707313_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707314_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707315_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707316_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707319_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707320_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707321_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707323_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707324_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707325_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707326_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707327_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707328_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707330_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707332_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707333_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707334_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707336_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707337_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707338_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707339_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707341_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707342_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707343_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707344_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707345_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707346_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707347_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707349_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707350_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707352_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707354_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707355_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707356_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707357_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707358_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707359_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707361_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707363_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707364_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707365_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707366_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707367_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707369_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707370_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477478_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477472_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477468_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859944_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU594385_X_P-A      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU594387_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859955_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707569_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707574_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707575_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707576_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707578_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707579_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707580_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707583_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707584_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707586_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707587_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707588_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707590_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707593_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707597_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707599_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707602_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707603_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707606_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707607_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707608_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707627_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
JQ707630_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AY152726_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB014370_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477475_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtgcc
GQ477501_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477499_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
KJ843172_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
EU859934_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
MF772345_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
MF772344_X_P-A      atggctgctaggctgtgctgccaactggatccttcgagggacgtcctttgtttacgtccc
GQ477465_X_P-A      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
FJ904434_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
DQ788728_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AJ627228_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AJ309371_X_P-A      atgactgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AJ309369_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AJ309370_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AF537372_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477476_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AF143302_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AF537371_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
GQ477496_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KP168435_X_P-A      atggctgctagggtgtgctgccaactggattcttcgcgggacgtcctttgtctacgttcc
HM011485_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB194950_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FN545831_X_P-A      atggctgctaggctgtactgccaactggattcttcgcggaacgtcctttgtttacgtccc
MN544634_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
AM180624_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
AY934763_X_P-A      atggctgctaggatgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
FN545826_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FN545825_X_P-A      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB194952_X_P-A      atggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtccc
FJ692603_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FN545836_X_P-A      atggctgctaggctgtactgccaactggattcttcgcggaacgtcctttgtttacgtccc
AM184125_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacatcctttgtttacgtccc
AM184126_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FN545838_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FN545829_X_P-A      atggctgctaggctgtactgccaactggattcttcgmgggacgtcctttgtttacgtccc
FN545833_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FN545834_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692598_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MH580627_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
MH580639_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
MH580642_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
MH580643_X_P-A      atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
LC462120_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FN545828_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692592_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB194951_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692613_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FN545835_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692597_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KM606737_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FN545832_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FN545840_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692612_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY934764_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
GQ161813_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692610_X_P-A      atggctgytaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692609_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692602_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692607_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692596_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692600_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692604_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692611_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692608_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692606_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FN545830_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692605_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FN545839_X_P-A      atggctgctaggctgtactgccaattggattcttcgcgggacgtcctttgtttacgtccc
FJ692601_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692593_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FN545837_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692555_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692595_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692599_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MK512464_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttcc
FM199978_X_P-A      atggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtccc
MK512470_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcac
MK512456_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
LC051141_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
KX357643_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
AB453987_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
AY934774_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
EU410082_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
MK512461_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KM519452_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KM519453_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MK512465_X_P-A      atggctgctaggttgtactgccaactggattcttctcgggacgtcctttgtttacgtccc
MK512459_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB116086_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MK512477_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MK512458_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KX357644_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692567_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB937791_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB937796_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB246336_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KX276769_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB241115_X_P-A      atggctgctagggtgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
FJ692590_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692591_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692564_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692565_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692586_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692588_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MK512468_X_P-A      atggctcctaggttgttatgccaaccggattcttcgcgggacgtcctttgtttacgtccc
FM199977_X_P-A      atggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtccc
MK512466_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FM199974_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
GU563547_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MK512463_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MK512457_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MK512474_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FM199975_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MK512473_X_P-A      atggctgctcggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
GU563545_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FM199981_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FM199979_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
GU563548_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FM199980_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FM199976_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MK512476_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF922420_X_P-A      atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtccc
KF922421_X_P-A      atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtccc
KF922414_X_P-A      atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtccc
KF922415_X_P-A      atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtccc
KF922416_X_P-A      atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtccc
KF922417_X_P-A      atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtccc
KF922418_X_P-A      atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtccc
KF922419_X_P-A      atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtccc
KP168430_X_P-A      atggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtccc
AB116089_X_P-A      atggctgctaggatgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF922429_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF922430_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF922431_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
DQ315786_X_P-A      atggctgctaggttgtactgccaactggatactacgagggacgtcctttgtttacgtccc
MF925373_X_P-A      atggctgctaggttgtactgccaactggattcttcgagggacgtcctttgtttacgtccc
KF214666_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KR905427_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF214662_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
EF103278_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtccttagtctacgtccc
KC875255_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KC875256_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KC875257_X_P-A      atggctgctaggttgtactgccaactggattcttcgagggacgtcctttgtttacgtccc
KX357649_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
DQ315785_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacatcctttgtttacgtccc
AB116090_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB116085_X_P-A      atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
M57663_X_P-A        atagctgctaggttgtactgccaactagattcttcgcgggacgtcctttgtctacgtccc
KP168429_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacatcctttgtttacgtccc
KF214660_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT151615_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB937795_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT151613_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MH464817_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
MF925400_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KP168428_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854701_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KC875254_X_P-A      atggctgctaggttgtactgccaactggattctacgcgggacgtcctttgtttacgtccc
KC875253_X_P-A      atggctgctcggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
DQ315784_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB116084_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KC875259_X_P-A      atggctgctaggttgtactgccaactggatccttcgagggacgtcctttgtttacgtccc
KP168427_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB453986_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MF772353_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854685_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF214665_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF214661_X_P-A      atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KF214658_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY233275_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY233281_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF214663_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KC875252_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KC875251_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692575_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB116092_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
KT151611_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB116088_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB116082_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB116087_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MF925385_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MF925407_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KR905426_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT366467_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MF925372_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MF925361_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT366469_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF214657_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KC875258_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB241114_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF214659_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY373429_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY373432_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KR905425_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT366466_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KM243029_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT151616_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT366471_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT151618_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KR905430_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KR905431_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT366468_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT366470_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KR905429_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtccttcgtttacgtccc
AB246335_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AF090842_X_P-A      atggctgctaggttgtactgccaactggattcttcgagggacgtcctttgtttacgtccc
MK512475_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY233290_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
KJ854695_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KP168434_X_P-A      atggctgctaggctgtactgccaactggattcttcgcggaacgtcctttgtttacgtccc
KF922433_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF922434_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MH464808_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MF925368_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MK512462_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KP168431_X_P-A      atggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtccc
AB116083_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT151612_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT151617_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854699_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB246317_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MK512472_X_P-A      atggctgctaggttgtgctgccaattggattcttcgcgggacgtcctttgtttacgtccc
KP168425_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692554_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
MK512471_X_P-A      atggctgctaggttgtactgccaactggattcttctcgggacgtcctttgtttacgtccc
AF297623_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692571_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692562_X_P-A      atggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtccc
KP168433_X_P-A      atggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtccc
FJ692572_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN182322_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN182323_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KX357647_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT151614_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MH464811_X_P-A      atggctgctaggttgtactgccaactggatacttcgcgggacgtcctttgtttacgtccc
KP168432_X_P-A      atggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgttcc
KP168422_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY934772_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB453988_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB116093_X_P-A      atggctgctaggttgtgctgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB453989_X_P-A      atggctgctaggatgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692587_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY934771_X_P-A      atggctgctaggatgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY233278_X_P-A      atggctgctaggttgtactgccaactggattcttcgagggacgtccttcgtctacgtccc
KU605536_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
MH464809_X_P-A      atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
FJ692558_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692561_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB116091_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692570_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KP168424_X_P-A      atggctgctagggtgtactggcaactggattcttcgcgggacgtcctttgtttacgtccc
KP168423_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854687_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF922435_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
KF922436_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
KF922437_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
JX154582_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692573_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB076679_X_P-A      atggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtccc
JQ023660_X_P-A      atggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtccc
JQ023661_X_P-A      atggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtccc
JQ023662_X_P-A      atggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtccc
JQ023663_X_P-A      atggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtccc
KP718085_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KP718086_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MH464812_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KU736920_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
EU366129_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
DQ020003_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY934769_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KU605534_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN182318_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KX648547_X_P-A      atggctgctaggttgtactgccaaytggattcttcgcgggacgtcctttgtttacgtccc
KX357645_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854691_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854686_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692577_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692563_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692559_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY161138_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY161139_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB116094_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692566_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
DQ020002_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KU736918_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KU736919_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MH464825_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MH464810_X_P-A      atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KX357642_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
KP168426_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854707_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854704_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttcc
JN182321_X_P-A      acggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
HM535205_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY934767_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY373428_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY233279_X_P-A      atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
KF922424_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
KF922425_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
KU605537_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
KU605538_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
KU605539_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtccc
JX154579_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JX154580_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JX154581_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KX648549_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT347091_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KM606748_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT347092_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KU605533_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT347088_X_P-A      atggctgctaggctgtgctgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT347087_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN182319_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN182327_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN182334_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN182333_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN182331_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN182330_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN182324_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN182325_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN182328_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN182332_X_P-A      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY934765_X_P-A      atggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtccc
AY934766_X_P-A      atggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtccc
FJ692557_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692578_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692579_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692580_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692581_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692582_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692583_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692584_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692585_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF922426_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF922427_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KF922428_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692574_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MF772351_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KX357646_X_P-A      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854700_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854690_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
HM535200_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY934773_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY934770_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY934768_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY233288_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY233276_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY233285_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttcc
AY233289_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttcc
AY233282_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttcc
AY233283_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttcc
AY233284_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AF297625_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY233274_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AF043560_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ843183_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MH464814_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MH464813_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MH464818_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MH464830_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AB076678_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY233287_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KX648548_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MH464815_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
MH464828_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AM494718_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ692576_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KU605535_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854705_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854696_X_P-A      atggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtccc
KJ854692_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854689_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854703_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
AY903452_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ010776_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ010777_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ010778_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854702_X_P-A      atggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtccc
KJ854694_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854688_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854697_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KJ854706_X_P-A      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
                            *  * ***  *  ***   *** ** *   * ** ** **  * * **   *

EU054331_X_C-A      gtcggcgctgaatcacgcggacgacccctctcggggccctttggtcatttctcgtcccct
MK512469_X_P-A      gtcggcgctgaatcccgcgcccgacccctccaggtgcctcctgggacaggatcgtcccct
MF925362_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgtcccct
AY161142_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttggggctgtatcgtcccct
AY161143_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttggggctgtatcgtcccct
AY161144_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttggggctgtatcgtcccct
KX357650_X_P-A      gtcagcgctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtcccct
LT992441_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggtttctatcgtcccct
JX310722_X_P-A      gtcagcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JX310723_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctctcgtcccct
KJ854709_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477479_X_P-A      gtcggcgctgaatccagcggacgacccctctcggggccgcttgggactctctcgtcccct
AJ627227_X_P-A      gtcgrcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
GQ331046_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
EU859952_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggtcgcttgggactctatcgtcccct
GQ331047_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggtcgcttgggactctatcgtcccct
AF297624_X_P-A      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctgtcgtcccct
AB697487_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AF297621_X_P-A      gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccct
KJ843184_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactgtctcgtcccct
KF922406_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctctcgtcccct
KF922407_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctctcgtcccct
KF922408_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctctcgtcccct
KF922409_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctctcgtcccct
GQ477487_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
EU859900_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477469_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctatcgtcccct
MF772347_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859901_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KC875260_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggagtctctcgtcccct
GU563550_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactttatcgtcccct
GQ477462_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AB453984_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AF297622_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477493_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP995108_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477463_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactttatcgtcccct
GQ477488_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
GQ477491_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
GU563551_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477502_X_P-A      gtcagcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477500_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactttctcgtcccct
AY233286_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749825_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749826_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749832_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749834_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749839_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749846_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749847_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749849_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749842_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB246338_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctatctcgtcccct
AB453981_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctatctcgtcccct
AB697506_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctatctcgtcccct
AB697507_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctatctcgtcccct
AB205118_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctatctcgtcccct
AB480036_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctatctcgtcccct
GQ184323_X_P-A      gtcggcgctgaatcccgcggacgacccctctcgggcccgcctgggactctctcgtcccct
EU859932_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactttctcgtcccct
KJ843215_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctctcgtcccct
KJ843216_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctctcgtcccct
AF043580_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697498_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697488_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697489_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697501_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697511_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697512_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
LC311241_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477482_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859954_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KX827293_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697505_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB116079_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB116080_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB300367_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB453979_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB453980_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB453982_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB480038_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB480041_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697491_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697496_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697497_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697499_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697503_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697504_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697508_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697509_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB937798_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KY886219_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
LC074724_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
LC311242_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
LC311243_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
MH932713_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB480040_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB116078_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AY738142_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AY738140_X_P-A      atcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AY738139_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AY738141_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AY738143_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749822_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KJ586809_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707551_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707532_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggaatctctcgtcccct
EU414133_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EF208113_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AY233280_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggtcgcttgggactctctcgtcccct
AB116076_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707672_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707659_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707537_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707658_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707661_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707662_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707663_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707664_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707665_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707667_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707669_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707670_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707674_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707675_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707676_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707681_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477504_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
GQ477494_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
GQ477474_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AF143298_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
KT749831_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
Z72478_X_P-A        gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
L13994_X_P-A        gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KJ843173_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707383_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859938_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
X70185_X_P-A        gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggagtctctcgtcccct
KJ843186_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707418_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
JQ707414_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggtcgcttgggactctctcgtcccct
JQ707413_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707411_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707405_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707403_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707400_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707402_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707397_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707371_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707372_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707373_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707375_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707377_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707378_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707379_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707381_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707382_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707384_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707386_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707387_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707388_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707390_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707391_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707392_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707393_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707394_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707395_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707396_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707399_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707404_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707406_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707407_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707408_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707409_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707410_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707412_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707415_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707416_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707417_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707419_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707420_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707374_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859949_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859948_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
FJ349224_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP274927_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB300366_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB480039_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB116081_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697492_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859930_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
X51970_X_P-A        gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
X02763_X_C-A        gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KX827298_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KU605532_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcctaggactctctcgtcccct
MN507849_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcctaggactctctcgtcccct
KT749840_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749833_X_P-A      atcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718102_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718098_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718095_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718094_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718100_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718093_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718092_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718090_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718091_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718087_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KM519454_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KJ843182_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KJ843217_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707654_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707646_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707642_X_P-A      gtcggcgctgaatcccgcggacgatccctctcggggccgcttgggactctctcgtcccct
JQ707632_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707626_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707625_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707650_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707617_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707611_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707610_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749836_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707568_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707560_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707559_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707558_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707544_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707543_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707613_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707618_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707644_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707648_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707536_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707540_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707535_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GU563562_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GU563558_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707634_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GU563557_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GU563546_X_P-A      gtcggcgctgaatcctgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477497_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707539_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707542_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707545_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707547_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707553_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707554_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707555_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707556_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707563_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707564_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477477_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477470_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707538_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707548_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707557_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707562_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707572_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KM606742_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KM606746_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477464_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ184324_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcctgggactctctcgtcccct
FJ349222_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859941_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
EU859933_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
EU859943_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
GU563555_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
KT749824_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
KT749838_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
EU859927_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859923_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859925_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KJ854710_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749843_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859917_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859906_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859903_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU594391_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU594389_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859946_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AY902775_X_P-A      gtcagcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP274925_X_P-A      gtcagcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749850_X_P-A      gtcagcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AY862868_X_P-A      gtcggcgttgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AY862867_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AY128092_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctctcgtcccct
AM282986_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AY707087_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AF090841_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
EU594384_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
EU594386_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
KT749829_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
AB775198_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB775199_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB775200_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB775201_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB937793_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB937794_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477467_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477503_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GU563553_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JX096952_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JX096953_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB453983_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctatcgtcccct
AB362931_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctctcgtcccct
KJ843166_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctctcgtcccct
KJ843192_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctctcgtcccct
KJ843214_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctctcgtcccct
AB246337_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactttctcgtcccct
AB116077_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859945_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KJ843218_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB126580_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB222707_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB549213_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697493_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB697495_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB937792_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AF090839_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AF090840_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AF536524_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AJ012207_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AM295795_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AM295796_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AM295797_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AM295798_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AM295799_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AM410963_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
DQ788725_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU086721_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU185786_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU185787_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU185788_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU185789_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU594383_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU594388_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU594390_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU594392_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU594393_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU594394_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU594395_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859898_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859899_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859902_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859904_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859905_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859907_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859908_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859909_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859910_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859911_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859912_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859913_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859914_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859915_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859916_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859918_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859919_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859920_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859921_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859922_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859924_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859926_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859928_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859929_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859931_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859935_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859936_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859937_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859939_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859940_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859942_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859947_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859950_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859951_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859953_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859956_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ414522_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477461_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GU563554_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
HE576988_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
HE576989_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ687529_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ687533_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707531_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707541_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707546_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707549_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707550_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707552_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707566_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707567_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707573_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707585_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707591_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707594_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707609_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707612_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707614_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707615_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707616_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707619_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707620_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707621_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707623_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707624_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707628_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707629_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707631_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707633_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707635_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707636_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707637_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707638_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707639_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707640_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707641_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707643_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707645_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707647_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707649_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707651_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707652_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707653_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707655_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707656_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KJ854708_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KM606749_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP274928_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718088_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718089_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718097_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718099_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718101_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749830_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749835_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749837_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KT749844_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KX827294_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KX827295_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KX827296_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KX827297_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KY003230_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KY382410_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
LC430617_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
LC458430_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
LC458431_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP718096_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477466_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggatctctcgtcccct
MF772346_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ904411_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
AB937797_X_P-A      atcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
DQ298162_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
DQ298163_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
DQ298164_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
DQ298165_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
DQ298161_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477486_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
GQ477480_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AY034878_X_P-A      gtcggcgctgaatcccgcagacgacccctctcggggccgcttgggactctatcgtcccct
AF090838_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AJ627226_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
JQ707401_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB064314_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
MF772350_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
MF772349_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
MF772348_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KJ843188_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctctcgtcccct
JQ707533_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707340_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707306_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477490_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggaatctctcgtcccct
EU747320_X_P-A      gtcagcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AJ344115_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707360_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477495_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
GQ477473_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477484_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707581_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707362_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
V00866_X_P-A        gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
Z35717_X_P-A        gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707622_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707604_X_P-A      gtcggcgctgaatcccgcagacgacccctctcggggccgcttgggactctctcgtcccct
JQ707600_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707592_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707589_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgagactctctcgtcccct
JQ707582_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707598_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707571_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707570_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707565_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707561_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707534_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707577_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707595_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707596_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707601_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707605_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707380_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707385_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707376_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707389_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707398_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707368_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707353_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707351_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
JQ707348_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707335_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707329_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707322_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707331_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707317_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707318_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707309_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707299_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707300_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707301_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707302_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707303_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707304_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707305_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707307_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707308_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707310_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707311_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707312_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707313_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707314_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707315_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707316_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707319_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707320_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707321_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707323_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707324_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707325_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707326_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707327_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707328_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707330_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707332_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707333_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707334_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707336_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707337_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707338_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707339_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707341_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707342_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707343_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707344_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707345_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707346_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707347_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707349_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707350_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707352_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707354_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707355_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707356_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707357_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707358_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707359_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707361_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707363_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707364_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707365_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707366_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707367_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707369_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707370_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477478_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477472_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477468_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859944_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactgtctcgtcccct
EU594385_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU594387_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859955_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707569_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707574_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707575_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707576_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707578_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707579_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707580_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707583_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707584_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707586_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707587_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707588_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707590_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707593_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707597_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707599_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707602_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707603_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707606_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707607_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707608_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707627_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
JQ707630_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AY152726_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
AB014370_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
GQ477475_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
GQ477501_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
GQ477499_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggtctctctcgtcccct
KJ843172_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
EU859934_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
MF772345_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtcccct
MF772344_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
GQ477465_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ904434_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
DQ788728_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AJ627228_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AJ309371_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AJ309369_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AJ309370_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AF537372_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
GQ477476_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AF143302_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AF537371_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
GQ477496_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtcccct
KP168435_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctatcggcccct
HM011485_X_P-A      gtcrgcgctgaatcccgcggacgacccctcgcgcggccgcttggggctctatcgtcccct
AB194950_X_P-A      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtcccct
FN545831_X_P-A      gtcgacgctgaatcccgcggacgacccctctcggggccgcttggggctctatcgtcccct
MN544634_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AM180624_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggrmtctaccgtcccct
AY934763_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctatcgtcccct
FN545826_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FN545825_X_P-A      gtcggcgctgaatcctgcggacgacccctctcggggccgcttgggtctgtatcgtcccct
AB194952_X_P-A      gtcggcgctgaatcctgcggacgacccctctcggggccggttgggactctatcgtcccct
FJ692603_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FN545836_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AM184125_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AM184126_X_P-A      gtcggcgctgaatcacgcggacgacccctctcggggtcgcttgggactctatcgtcccct
FN545838_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FN545829_X_P-A      gtcagcgctgaatcccgcggacgacccctctcggggccgcttgggcctctatcgtcccct
FN545833_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctatcgtcccct
FN545834_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctatcgtcccct
FJ692598_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
MH580627_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctttcgtcccct
MH580639_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctttcgtcccct
MH580642_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctttcgtcccct
MH580643_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctttcgtcccct
LC462120_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FN545828_X_P-A      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggcctctatcgtcccct
FJ692592_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AB194951_X_P-A      gtcggcgctgaatcctgcggacgacccctctcggggccggttgggactctatcgtcccct
FJ692613_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggtctctatcgtccgct
FN545835_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctatcgtcccct
FJ692597_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
KM606737_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FN545832_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctatcgtcccct
FN545840_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctatcgtcccct
FJ692612_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggtctctatcgtcccct
AY934764_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
GQ161813_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ692610_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ692609_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ692602_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ692607_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggtctctatcgtcccct
FJ692596_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ692600_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ692604_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ692611_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ692608_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ692606_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FN545830_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctatatcgtcccct
FJ692605_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FN545839_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctatcgtcccct
FJ692601_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ692593_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FN545837_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ692555_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ692595_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
FJ692599_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
MK512464_X_P-A      gtcggctctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
FM199978_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
MK512470_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggagacgcttgggactctatcgtcccct
MK512456_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
LC051141_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggtctctatcgtcccct
KX357643_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
AB453987_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
AY934774_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
EU410082_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
MK512461_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
KM519452_X_P-A      gtcagcgctgaatcccgcggacgatccctcacggggtcgcttgggactctatcgtcccct
KM519453_X_P-A      gtcagcgctgaatcccgcggacgatccctcacggggtcgcttgggactctatcgtcccct
MK512465_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactttatcgtcctct
MK512459_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
AB116086_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggtcgcttgggactctatcgtcccct
MK512477_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggcctctatcgtcccct
MK512458_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
KX357644_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
FJ692567_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttggggctctatcgtcccct
AB937791_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcgaggtcgcttgggactgtatcgtcccct
AB937796_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcgaggtcgcttgggactgtatcgtcccct
AB246336_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcgaggtcgcttggggctctatcgtcccct
KX276769_X_P-A      gtcrgcgctgaatcccgcggacgacccctcgcggggtcgcttgggactctatcgtcccct
AB241115_X_P-A      atcagcgctgaatcccgcggacgacccctcgcgcggtcgcttgggactctatcgtcccct
FJ692590_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttggggctctatcgtcccct
FJ692591_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttggggctctatcgtcccct
FJ692564_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttgggactctatcgtcccct
FJ692565_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttgggactctatcgtcccct
FJ692586_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttgggactctatcgtcccct
FJ692588_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttgggactctatcgtcccct
MK512468_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttggggctctatcgtcccct
FM199977_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
MK512466_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
FM199974_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctakcgtcccct
GU563547_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
MK512463_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
MK512457_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
MK512474_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
FM199975_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
MK512473_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
GU563545_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
FM199981_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
FM199979_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
GU563548_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
FM199980_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggcckcttgggactctatcgtcccct
FM199976_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
MK512476_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
KF922420_X_P-A      gtcagcgctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtcccct
KF922421_X_P-A      gtcagcgctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtcccct
KF922414_X_P-A      gtcagcgctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtcccct
KF922415_X_P-A      gtcagcgctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtcccct
KF922416_X_P-A      gtcagcgctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtcccct
KF922417_X_P-A      gtcagcgctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtcccct
KF922418_X_P-A      gtcagcgctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtcccct
KF922419_X_P-A      gtcagcgctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtcccct
KP168430_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcgcggccgcttgggaatctatcgtcccct
AB116089_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggccgcttggggctgtatcgtcccct
KF922429_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttggggctctatcgtcccct
KF922430_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttggggctctatcgtcccct
KF922431_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttggggctctatcgtcccct
DQ315786_X_P-A      gtcggcgctgaatcccgcggacgacccttcgcgaggccgcttgggactgtatcgtcccct
MF925373_X_P-A      gtcggcgctgaatcccgcggacgacccttcgcgaggccgcttgggactgtatcgtcccct
KF214666_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctgtatcgtcccct
KR905427_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggccgcttggggctgtatcgtcccct
KF214662_X_P-A      gtcggcgctgaatcctgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
EF103278_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KC875255_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KC875256_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KC875257_X_P-A      gtcagcgctgaatcccccggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KX357649_X_P-A      gtcagcgctgaatcccgcggacgatccctcgcgaggccgcttgggtctctatcgtcccct
DQ315785_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggccgcttggggctgtatcgtcccct
AB116090_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
AB116085_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
M57663_X_P-A        gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactgtatcgtcccct
KP168429_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcgcggccgcttgggaatctatcgtcccct
KF214660_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KT151615_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgrrgccgcttggggctgtatcgtcccct
AB937795_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KT151613_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgrggccgcttgggratgtatcgtcccct
MH464817_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtcccct
MF925400_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcgaggccgcttggggatctatcgtcccct
KP168428_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcgcggccgcttggggctctatcgtcccct
KJ854701_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtcccct
KC875254_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KC875253_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
DQ315784_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
AB116084_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KC875259_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KP168427_X_P-A      gtcggcgctgaatcccgcrgacgacccctcgcggggccgcttggggctctatcgtcccct
AB453986_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
MF772353_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggccgcttggggctctatcgtcccct
KJ854685_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtcccct
KF214665_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KF214661_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtttcgtcccct
KF214658_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
AY233275_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtcccct
AY233281_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtcccct
KF214663_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KC875252_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KC875251_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ692575_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtcccct
AB116092_X_P-A      gtcggcgctgaatcccgcggacgacccttcgcgaggccgcttggggctgtatcgtcccct
KT151611_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgrggtcgtttggggctgtatcgtcccct
AB116088_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggccgcttggggctgtatcgtcccct
AB116082_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggatgtatcgtcccct
AB116087_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggatgtttcgtcccct
MF925385_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
MF925407_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KR905426_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KT366467_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
MF925372_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
MF925361_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KT366469_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KF214657_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KC875258_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
AB241114_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctgtatcgtcccct
KF214659_X_P-A      gtcggcgctgaatcccgcggacgacccctcgccgggccgcttggggctgtatcgtcccct
AY373429_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
AY373432_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KR905425_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactatatcgtcccct
KT366466_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactatatcgtcccct
KM243029_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctgtatcgtcccct
KT151616_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgrrgccgcttggggctgtatcgtcccct
KT366471_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KT151618_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctgtatcgtcccct
KR905430_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KR905431_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KT366468_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KT366470_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KR905429_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
AB246335_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
AF090842_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
MK512475_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
AY233290_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggatctatcgtcccct
KJ854695_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtcccct
KP168434_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggacgcttgggtctgtatcgtcccct
KF922433_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtcccct
KF922434_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtcccct
MH464808_X_P-A      gtcagcgctgaatcccgcggacgacccctcacggggccgcttrggactctatcgtcccct
MF925368_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctttatcgtcccct
MK512462_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
KP168431_X_P-A      gtcrgcgctgaatcccgcggacgacccctcgcgcggccgcttgggactctatcgtcccct
AB116083_X_P-A      gtcggcgctgaatcccgcggacgacccttcgcgaggccgcttgggactgtatcgtcccct
KT151612_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgrggccgcttgggactctatcgtcccct
KT151617_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgrggccgcttgggactctatcgtcccct
KJ854699_X_P-A      gtcrgcgctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtcccct
AB246317_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
MK512472_X_P-A      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggactctatcgtcccct
KP168425_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
FJ692554_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
MK512471_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgggggcgcttgggactctaccgtcccct
AF297623_X_P-A      gtcggcgctgaatcctgcggacgacccctctcggggtcgcttgggactctatcgtcccct
FJ692571_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
FJ692562_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
KP168433_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcgcggccgcttgggaatctatcgtcccct
FJ692572_X_P-A      gtcagcgctgaatcccgcggacgacccttcacggggtcgcttgggactctatcgtcccct
JN182322_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
JN182323_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
KX357647_X_P-A      gtcagcgctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtcccct
KT151614_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgrrgccgcttgggactgtatcgtcccct
MH464811_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KP168432_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggccgcttgggaatctatcgtcccct
KP168422_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctctatcgtcccct
AY934772_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggtctctatcgtcccct
AB453988_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcggggtcgcttgggactctatcgtcccct
AB116093_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttgggactctatcgtcccct
AB453989_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
FJ692587_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccact
AY934771_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtcccct
AY233278_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggtcgcttgggactctatcgtcccct
KU605536_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctatcgtcccct
MH464809_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
FJ692558_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctatcgtcccct
FJ692561_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctatcgtcccct
AB116091_X_P-A      gtcngcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctatcgtcccct
FJ692570_X_P-A      gtcagcgctgaatcccgcggacgacccttcgaggggtcgcttgggactctatcgtcccct
KP168424_X_P-A      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggactctatcgtcccct
KP168423_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctctatcgtcccct
KJ854687_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KF922435_X_P-A      gtcggcgctgaatcctgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KF922436_X_P-A      gtcggcgctgaatcctgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KF922437_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
JX154582_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggcctctatcgtcccct
FJ692573_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AB076679_X_P-A      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggactctatcgtcccct
JQ023660_X_P-A      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggactctatcgtcccct
JQ023661_X_P-A      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggactctatcgtcccct
JQ023662_X_P-A      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggactctatcgtcccct
JQ023663_X_P-A      gtcggcgctgaatcccgcggacgacccctcccggggccgcttgggactctatcgtcccct
KP718085_X_P-A      gtcggcgctgaatcccgcggamgamccctcgcggggccgcttgggactctatcgtcccct
KP718086_X_P-A      gtcggcgctgaatcccgcggamgacccctcgcggggccgcttgggactctatcgtcccct
MH464812_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
KU736920_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctatcgtcccct
EU366129_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
DQ020003_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctatcgtcccct
AY934769_X_P-A      gtcggcgctgaatcccgcagacgacccctcgcggggccgcttgggactctatcgtcccct
KU605534_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
JN182318_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
KX648547_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctatcgtcccct
KX357645_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KJ854691_X_P-A      gtcggcgctgaatcctgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KJ854686_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgrggccgcttgggactctatcgtcccct
FJ692577_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctatcgtcccct
FJ692563_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctatcgtcccct
FJ692559_X_P-A      gtcggcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
AY161138_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactgtatcgtcccct
AY161139_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgcggccgcttgggactgtatcgtcccct
AB116094_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
FJ692566_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggccgcttgggactctatcgtcccct
DQ020002_X_P-A      gtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtcccct
KU736918_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KU736919_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
MH464825_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
MH464810_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KX357642_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KP168426_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggacgcttgggactctatcgtcccct
KJ854707_X_P-A      gtcggcgctgaatcccgcggacgacccctcacgaggccgcttgggaatctatcgtcccct
KJ854704_X_P-A      gtctgcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
JN182321_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
HM535205_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
AY934767_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctctatcgtcccct
AY373428_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactgtatcgtcccct
AY233279_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KF922424_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggtcgcttgggactctatcgtcccct
KF922425_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggtcgcttgggactctatcgtcccct
KU605537_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctatcgtcccct
KU605538_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctatcgtcccct
KU605539_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctatcgtcccct
JX154579_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggcctctatcgtcccct
JX154580_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggcctctatcgtcccct
JX154581_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggcctctatcgtcccct
KX648549_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
KT347091_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KM606748_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KT347092_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KU605533_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KT347088_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtcccct
KT347087_X_P-A      gtcggcgctgaatcctgcggacgacccctcgcgaggccgcttggggctctatcgtcccct
JN182319_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
JN182327_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
JN182334_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
JN182333_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
JN182331_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
JN182330_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
JN182324_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
JN182325_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
JN182328_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
JN182332_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
AY934765_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
AY934766_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
FJ692557_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
FJ692578_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
FJ692579_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
FJ692580_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
FJ692581_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
FJ692582_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
FJ692583_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
FJ692584_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
FJ692585_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
KF922426_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
KF922427_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
KF922428_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
FJ692574_X_P-A      gtcagcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctatcgtcccct
MF772351_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtcccct
KX357646_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KJ854700_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggagtctatcgtcccct
KJ854690_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtcccct
HM535200_X_P-A      gtcggcgctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtcccct
AY934773_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
AY934770_X_P-A      gtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtcccct
AY934768_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
AY233288_X_P-A      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccct
AY233276_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
AY233285_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
AY233289_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
AY233282_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
AY233283_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
AY233284_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctctcgtcccct
AF297625_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctatcgtcccct
AY233274_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctatcgtcccct
AF043560_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggtcgcttgggactctatcgtcccct
KJ843183_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtcccct
MH464814_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
MH464813_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
MH464818_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
MH464830_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
AB076678_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
AY233287_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KX648548_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
MH464815_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
MH464828_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
AM494718_X_P-A      gtcagcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
FJ692576_X_P-A      gtcggcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctatcgtcccct
KU605535_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KJ854705_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KJ854696_X_P-A      gtcggcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
KJ854692_X_P-A      gtcggcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctatcgtcccct
KJ854689_X_P-A      gtcggcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
KJ854703_X_P-A      gtcggcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtcccct
AY903452_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KJ010776_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KJ010777_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KJ010778_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtcccct
KJ854702_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtcccct
KJ854694_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtcccct
KJ854688_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggtcgcttgggactctatcgtcccct
KJ854697_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtcccct
KJ854706_X_P-A      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtcccct
                     **  *  ******   *    ** ** **       *   *          ** ** **

EU054331_X_C-A      tctctgtctaacattccgaacgaccacggagcgcacctctcattccactgcctacccgtc
MK512469_X_P-A      tctccgtctgccataccgtcctatcacggggcacacctctctttacgcggactccccgtc
MF925362_X_P-A      tctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtc
AY161142_X_P-A      tctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtc
AY161143_X_P-A      tctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtc
AY161144_X_P-A      tctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtc
KX357650_X_P-A      tctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtc
LT992441_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JX310722_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JX310723_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KJ854709_X_P-A      tctccgtctgccgttccagccgaccacggcgcgcacctctctttacgcggtctccccgtc
GQ477479_X_P-A      tctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtc
AJ627227_X_P-A      tctccgtctgccgttccagccgtccacggggcgaacctctctttacgcggtctccccgtc
GQ331046_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU859952_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ331047_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AF297624_X_P-A      tctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtc
AB697487_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AF297621_X_P-A      tctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtc
KJ843184_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KF922406_X_P-A      tctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtc
KF922407_X_P-A      tctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtc
KF922408_X_P-A      tctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtc
KF922409_X_P-A      tctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtc
GQ477487_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU859900_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ477469_X_P-A      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
MF772347_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU859901_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KC875260_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GU563550_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ477462_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB453984_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AF297622_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ477493_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KP995108_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ477463_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ477488_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ477491_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GU563551_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ477502_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ477500_X_P-A      tctccgtctgccgttccagccgactacggggcgcacctctctttacgcggtctccccgtc
AY233286_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KT749825_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KT749826_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KT749832_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KT749834_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KT749839_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KT749846_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KT749847_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KT749849_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KT749842_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB246338_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB453981_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697506_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697507_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB205118_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB480036_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ184323_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU859932_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KJ843215_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KJ843216_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AF043580_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacncggtctccccgtc
AB697498_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697488_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697489_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697501_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697511_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697512_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
LC311241_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ477482_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU859954_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KX827293_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697505_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB116079_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB116080_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB300367_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB453979_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB453980_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB453982_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB480038_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB480041_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697491_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697496_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697497_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697499_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697503_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697504_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697508_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB697509_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB937798_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KY886219_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
LC074724_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
LC311242_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
LC311243_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH932713_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB480040_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB116078_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AY738142_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AY738140_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AY738139_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AY738141_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AY738143_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KT749822_X_P-A      tctccgtctgccgttccagccgtccacggggcacacctctctttacgcggtctccccgtc
KJ586809_X_P-A      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707551_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707532_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU414133_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EF208113_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AY233280_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB116076_X_P-A      tctccgtctgccgttccagccgcccacggggcgcacctctctttacgcggtctccccgtc
JQ707672_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707659_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707537_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707658_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707661_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707662_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707663_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707664_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707665_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707667_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707669_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707670_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707674_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707675_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707676_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707681_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ477504_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ477494_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ477474_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AF143298_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KT749831_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
Z72478_X_P-A        tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
L13994_X_P-A        tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KJ843173_X_P-A      tctccgtctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtc
JQ707383_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU859938_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
X70185_X_P-A        tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KJ843186_X_P-A      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707418_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707414_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707413_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707411_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707405_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707403_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707400_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707402_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707397_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707371_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707372_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707373_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707375_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707377_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707378_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707379_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707381_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707382_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707384_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707386_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707387_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707388_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707390_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707391_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707392_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707393_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707394_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707395_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707396_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707399_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707404_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707406_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707407_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707408_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707409_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707410_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707412_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707415_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707416_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707417_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707419_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707420_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ707374_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU859949_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU859948_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FJ349224_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KP274927_X_P-A      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB300366_X_P-A      tctccgt