Dataset for nucleotide sequence PreS2 of genotype A

[Download (right click)] [Edit] [Sequences] [Repertoires]

1576 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

JN604218_PreS2_P-A      atrcagtggaattccactgccttccaccaagctctgcargaycccaragt
JN604308_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgaaaaatcccaaagt
AB937797_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
JN604249_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagggt
JN604176_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU185786_PreS2_P-A      atgcagtggaattccactgccttcctccaagytctsgaggrtccctgagt
AY232837_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
DQ298161_PreS2_P-A      atgcagtggaattccattgccttccaccaagctctgcaggatcccagagt
AY230118_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
DQ298165_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
DQ298164_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
DQ298163_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AY232836_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AY232838_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AY232839_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AY232840_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AY230117_PreS2_P-A      atgcagtggaattccactgccttccatcaagctttgcaggatcccagagt
DQ298162_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477477_PreS2_P-A      acgcagtggaattccactgccgtccaccaagatccgcaggaccccaaagt
GQ477474_PreS2_P-A      atgcagtggaattacgctgccttccaccgggctctgcaggatcccaaagt
EU185789_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU185787_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU185788_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604285_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccmaagt
AJ344115_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
MF772348_PreS2_P-A      ctacggaggacttccacnnnnnnnnnnnnnnnncacctacagtggagagt
JN604314_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604165_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JN604229_PreS2_P-A      gtgcagtggaactccactgcctttcaccaarctctgaaggatcccagagt
JN604220_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
MK568525_PreS2_P-A      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
MK568535_PreS2_P-A      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
MK568530_PreS2_P-A      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
MK568531_PreS2_P-A      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AY934763_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JX125364_PreS2_P-A      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JF439821_PreS2_P-A      atacagtggaattacactaccttccgccaagctatgcaggatcccagagt
JF439931_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439935_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439919_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439923_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439921_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439912_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439915_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439914_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439927_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439925_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439924_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439920_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439917_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439916_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439926_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439911_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439913_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439922_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439918_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439936_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439942_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439933_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439938_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439939_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439937_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439941_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439930_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439932_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439929_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439928_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439934_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439940_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439823_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439819_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439827_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439824_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439832_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439826_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439820_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439830_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439828_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439822_PreS2_P-A      atgcagtggaattccactgccctccaccaagctctgcaggatcccagagt
JF439825_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439829_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439831_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439852_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439843_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439867_PreS2_P-A      atgcagtggaattccactgccgtccaccaagctctacaggatcccagagt
JF439846_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439855_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439850_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439841_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439857_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439854_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439856_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439839_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439836_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439840_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439859_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439847_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439851_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439865_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439858_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439860_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439853_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439838_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439835_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439837_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439834_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439833_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439844_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439845_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439848_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707599_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707589_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707608_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707590_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707576_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707585_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707586_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707592_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707595_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707597_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707584_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707574_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707602_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707579_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707588_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707591_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707598_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707593_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707582_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707607_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707605_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707600_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707596_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707577_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707594_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707601_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707604_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707587_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707580_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707606_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707581_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707603_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707583_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707575_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707578_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439842_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707401_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JF439864_PreS2_P-A      atgcagtggaattctactgccttccatcaagctctgcaggatcccagagt
JF439868_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439866_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcagggtcccagagt
JF439849_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439861_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439862_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439990_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439767_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaagaccccaaagt
JF439777_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaagaccccaaagt
JF439768_PreS2_P-A      atgcagtggaattccactgccttcccccaagctctgcaagaccccagagt
JF439769_PreS2_P-A      atgcagtggaattccactgccttcccccaagctctgcaagaccccagagt
JF439774_PreS2_P-A      atgcagtggaattccactgccttacaccaagctctgcaagaccccagagt
JF440020_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaaaaccccagagt
JQ707370_PreS2_P-A      acgcagtggaattccactgccttccatcaagctctgcaggatcccagagt
JQ707345_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707348_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707357_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707351_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgaaggatcccagagt
JQ707367_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707364_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707354_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707362_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707347_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707361_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707358_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707346_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707349_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707355_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707356_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707363_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707365_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707369_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707368_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707353_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707350_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707352_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707359_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707360_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707366_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439970_PreS2_P-A      atgcagtggaattccactgccttccaccgggctctgcaggatcccagagt
JF439958_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707406_PreS2_P-A      atgcagtggaactccactgccttccaccttgctcttcaggatcccagagt
JQ707417_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707408_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707400_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707402_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707403_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707404_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707405_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707409_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707410_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707411_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707412_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707413_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707414_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707416_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707418_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707419_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707420_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707407_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707415_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KT749834_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749839_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749846_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749847_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749849_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439993_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439992_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439991_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439982_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439979_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439976_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439975_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439961_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439952_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439949_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859934_PreS2_P-A      atacagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439966_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439971_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859955_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859956_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KP718089_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KM519454_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439988_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439985_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439984_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439978_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439973_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439972_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439965_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439960_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcagggtcccagagt
JF439959_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439953_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439951_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859951_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
JF439989_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439944_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439945_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439964_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707676_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707663_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707653_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707651_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707647_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707644_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707640_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707638_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707639_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707641_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707642_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707643_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707645_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707646_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707648_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707649_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707650_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707652_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707654_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707655_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707656_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439987_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439986_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439983_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439977_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439968_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439963_PreS2_P-A      atgcaggggaattccactgccttccaccaagctctgcaggatcccagagt
JF439957_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439956_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439954_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439950_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439947_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439943_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GU563550_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439946_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439948_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439955_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439962_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439967_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439969_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439974_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439980_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697493_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AM295798_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AM295799_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AM410963_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859954_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707658_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707659_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707661_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707662_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707664_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707665_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707667_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707669_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707670_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707672_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707675_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707681_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707674_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604309_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707318_PreS2_P-A      gtgcagtggaattccgctgtcttccaccaagctctgcaggatcccagagt
GQ477493_PreS2_P-A      atgcagtggagttccactgctttccaccaagctctgcaggatcccaaagt
GQ477476_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctacaggatcccaaagt
GQ477473_PreS2_P-A      atgcagtggaattccactgccttccaccaagccctgcaggatcccagagt
MF772347_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaagatcccaaagt
AJ627227_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439872_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctaaacccccgagt
JF439881_PreS2_P-A      atgcagtggaattccactgccttccaccaggctctgctagacccccgagt
JF439877_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctagacccccgagt
JF439878_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctagacccccgagt
JF439870_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctagacccccgagt
JF439880_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctagacccccgagt
JF439875_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctagacccccgagt
JF439873_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctagacccccgagt
JF439869_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctagacccccgagt
JF439876_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctagacccccgagt
JF439871_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctagacccccgagt
JF439874_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctagacccccgagt
JF439879_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctagacccccgagt
JF439882_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctagacccccgagt
JF439883_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgctagacccccgagt
KT749822_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604305_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
U87735_PreS2_P-A        atgcaatggaattccactgccttccaccaagctctgcaagatcccagagt
MF772345_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaagatcccagagt
JN604183_PreS2_P-A      acgcagtggamytycaatgcctttcwccaagatctgcaagatcccagagt
AF537372_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AY152726_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT151612_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT151617_PreS2_P-A      gtgaagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604302_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477502_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB205118_PreS2_P-A      atgcagtggaattccactgccctccaccaagctctgcaggaacccagagt
AY738142_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AY738140_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AY738141_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT151614_PreS2_P-A      atgcagtggnnttccactgccttccaccaagctctgcaggatcccagagt
GQ477463_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaagatcccagagt
GQ477500_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
U87726_PreS2_P-A        atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477480_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcagaatcccaaagt
AY233286_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AF536524_PreS2_P-A      atgcagtggaattccactgccctccaccaagctctgcaggatcccagagt
KX827297_PreS2_P-A      atgcagtggaattccactgccctccaccaagctctgcaggatcccagagt
AF143302_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
DQ788728_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AJ309369_PreS2_P-A      acgcagtggaattccactgccttccaccaagcactgcaggatcccagagt
AJ309370_PreS2_P-A      atgcagtggaattccactgccttccaccaagcactgcaggatcccagagt
AJ309371_PreS2_P-A      acgcagtggaattccactgccttccaccaagcactgcaggatcccagagt
X51970_PreS2_P-A        atgcagtggaattccactgccttccaccaagctctgcaagaccccagagt
AF090838_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaagaccccaaagt
MF772346_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaagatcccagagt
JN604209_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GU563551_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctacaggatcccaaagt
GQ477494_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
KF779320_PreS2_P-A      atgcagtggaactccactgccttcctccaagctctgcaggatcccagagt
KF779321_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JX125368_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcatgatcccagagt
JN604290_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604236_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604227_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477464_PreS2_P-A      atgcagtggaattccactgctttccaccaagctctgcaaaatcccagagt
AF297622_PreS2_P-A      atgcagtggaattccactgccttgcaccaagctctgcaggatcccagagt
JN604298_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604190_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604179_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
GQ477495_PreS2_P-A      atgcagtggaattccactgccttccaccaaactctgcaggatcccagagt
AB116076_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
JN604269_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477478_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgaaggataccagagt
GQ477470_PreS2_P-A      atacagtggaattccactgccttccaccaagctctgcaggatcccaaagt
AY034878_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
MF772349_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaagatcccagagt
KJ586809_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccaaggt
GQ477469_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AJ627226_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
MF772344_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaagatcccagagt
KY382410_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779298_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779293_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
HE576989_PreS2_P-A      atgcagtggaatcccactgccttccaccaagctctgcaggatcccagagt
GQ477504_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB222707_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AY738139_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AY738143_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779272_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
GQ477501_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
KP995108_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaagaccccagagt
KF779260_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
GQ477490_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779210_PreS2_P-A      atgcagtggaattccactgccttccaccaacctctgcaggatcccagagt
KF779211_PreS2_P-A      atgcagtggaattccactgccttccaccaacctctgcaggatcccagagt
KX827293_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707340_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
GQ184324_PreS2_P-A      acgcagtggaattacactgccttccaccaagctctgcaggatcccagagt
GQ184323_PreS2_P-A      atgcagtggaattacactgccttccaccaagctctgcaggatcccagagt
Z72478_PreS2_P-A        atgcagtggaattccactgccttccaccaagctctgcaggaccccagagt
MF772350_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaagatcccagagt
KT749833_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779264_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF476012_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475994_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagggt
KF475984_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KC875260_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
JQ707628_PreS2_P-A      atgcagtggaattccactgccttccaccaagctcggcaggatcccagagt
JQ707537_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604317_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JN604277_PreS2_P-A      atgcagtggaaytccactgccttccaccaagctctgcaggatcccagagt
JN604188_PreS2_P-A      atgcagtggaactccactgcctttcaccaagctctgcaggatcccagagt
JN604172_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
HE576988_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477497_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477472_PreS2_P-A      atgcagtggaattccactgccttccaccaagatctgcaggatcccagagt
GQ477462_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU747320_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AM282986_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
AY707087_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
AF143298_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB362931_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
U87732_PreS2_P-A        atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707398_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JN604266_PreS2_P-A      atgcagtggaattccactgcctttcaccaagctctgcaggatcccagagt
GQ477488_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859950_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477475_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779295_PreS2_P-A      atgcagtggaattccactgccttccaccaaactctgcaggatcccagagt
JX125367_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AF537371_PreS2_P-A      atacagtggaattccactgccttccaccaagctctgcaggatcccagagt
AF090841_PreS2_P-A      atgcagtggaattccactgccttccaccaagttctgcaagaccccagagt
JQ707325_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477468_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
DQ788725_PreS2_P-A      acgcagtggaattccactgccgtccaccaagctctgcaggatcccagagt
JQ707319_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatctcagagt
JN604197_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749825_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749826_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749842_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
X70185_PreS2_P-A        atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
V00866_PreS2_P-A        atgcagtggaattccactgccttgcaccaagctctgcaggatcccagagt
MT426097_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
MN507849_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KY886219_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KJ843184_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KJ843172_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KF779324_PreS2_P-A      atgcagtggaattccactgccttccacaaagctctgcaggatcccagagt
KF779261_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF476013_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF476006_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF476002_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475982_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707536_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707372_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JN604307_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JN604159_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
JF439981_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477482_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctacaggatcccagagt
GQ477465_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
EU859944_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctacaggatcccagagt
EU859939_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctacaggatcccagagt
EU594386_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EF208113_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697511_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB480040_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB453984_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB453983_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707335_PreS2_P-A      atacagtggaactccactgccttccaccaagctctgcaggatcccagagt
AB014370_PreS2_P-A      atgcagtggaattccactgccttccaccaaactctgcaggatcccagagt
JQ707301_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707316_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707337_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779213_PreS2_P-A      atgcagtggaattccactgccttccaccaaactctgcaggatcccagagt
KF779215_PreS2_P-A      atgcagtggaattccactgccttccaccaaactctgcaggatcccagagt
JN604181_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779370_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779283_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779268_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB549213_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779280_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779274_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779271_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779281_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779253_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AY862867_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AY862868_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604173_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779256_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779383_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779282_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU594385_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779249_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779273_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779275_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779305_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779306_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779307_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779308_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779309_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779371_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707561_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707554_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707545_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707531_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707538_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697506_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707543_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707569_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707571_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707540_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707533_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707542_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707535_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707539_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707305_PreS2_P-A      atgaagtggaactccactgccttccaccaagctctgcaggatcccagagt
JN604274_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477499_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU594387_PreS2_P-A      atacagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB126580_PreS2_P-A      aagcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KP718100_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KJ843182_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KJ843186_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KJ843218_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KJ843217_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KP718088_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KP718090_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KP718091_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KP718094_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KP718095_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KP718096_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KP718097_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KP718098_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KP718099_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
KP718101_PreS2_P-A      atgcagtggaattccactgccttccaccaagcgctgcaggatcccagagt
JQ707309_PreS2_P-A      atgcagtggaactccactgccttccaccaagctttgcaggatcccagagt
JQ707323_PreS2_P-A      attcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707303_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707312_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccaaagt
KT749832_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859938_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707344_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707324_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707326_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
U87730_PreS2_P-A        atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
U87729_PreS2_P-A        atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
MT426099_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
MT426098_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KX827298_PreS2_P-A      atgcagtggaattccactgtcttccaccaagctctgcaggatcccagagt
KP718102_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KP718092_PreS2_P-A      atgcagtggaattccactgccttycaccaagcrctgcaggatcccagagt
KF779365_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779322_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779319_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779311_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779284_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779265_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcgggatcccagagt
KF779263_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779257_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779252_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779232_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779231_PreS2_P-A      atgcagtggaattccactgccttccaccaaactctgcaggatcccagagt
KF476015_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF476014_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF476008_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF476007_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475995_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475992_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JX096952_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707635_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707550_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707549_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707547_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707532_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707397_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707343_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707339_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707334_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707329_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707321_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ687533_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604288_PreS2_P-A      atgcagtggaattccactgtcttccaccaagctctgcaggatcccagagt
JN604282_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaagatcccagagt
KF779234_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaagatcccagagt
JN604270_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604268_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604214_PreS2_P-A      atgcagtggaattccactgcctttcaccaagctctgcaggatcccagagt
GQ477498_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477491_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477487_PreS2_P-A      atgcagtggaattccactgccttccaccaaactctgcaggatcccagagt
GQ477484_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477479_PreS2_P-A      atgcagtggaattccactgccttccaccaaactctgcaggatcccagagt
EU859947_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
EU859945_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859907_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859900_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
DQ131121_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AY233280_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB480036_PreS2_P-A      atgcagtggaattccactgcctttcaccaagctctgcaggatcccagagt
AB263406_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB116077_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB064314_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779372_PreS2_P-A      atgcagtggaactccactgcctttcaccaagctctgcaggatcccagagt
KF779349_PreS2_P-A      atgcagtggaactccactgcctttcaccaagctctgcaggatcccagagt
KF779356_PreS2_P-A      atgcagtggaactccactgcctttcaccaagctctgcaggatcccagagt
KF779374_PreS2_P-A      atgcagtggaactccactgcctttcaccaagctctgcaggatcccagagt
JQ707333_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707299_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707302_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707308_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707311_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707320_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707341_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707342_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
Z35717_PreS2_P-A        atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
KF779316_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
KF779254_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
AB453982_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
AB116081_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccaaagt
AB300366_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccaaagt
AB480039_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccaaagt
JN604276_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
JQ707306_PreS2_P-A      atgcagtggaactccactgccttccaccaaactctgcaggatcccagagt
JQ707317_PreS2_P-A      atgcagtggaactccactgccttccaccaaactctgcaggatcccagagt
JQ707313_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707300_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707314_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707330_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707331_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JN604242_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477466_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707615_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707627_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707633_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707636_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779221_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KJ843188_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KX827296_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779358_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779354_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779344_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779345_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779348_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779276_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779239_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779269_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707391_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707388_PreS2_P-A      atgcagtggaacgccactgccttccaccaagctctgcaggatcccagagt
JQ707387_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707384_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707378_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707377_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707374_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707338_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707328_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707327_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707322_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707315_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707310_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707304_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JN604319_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604306_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JN604167_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JN604162_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcgggatcccagagt
AY902775_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JN604299_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707371_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707373_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707375_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707376_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707379_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707381_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707382_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707383_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707385_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707386_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707389_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707390_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707392_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707393_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707394_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707396_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707399_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779312_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779331_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779359_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779375_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KX827294_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KX827295_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JN604160_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707307_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779337_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779351_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779361_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779323_PreS2_P-A      atgcagtggaattccactgccttccaccaagctccgcaggatcccagagt
JF439753_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439762_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604240_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
LC517161_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707564_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779291_PreS2_P-A      atgcagtggaattccactgccttccaccaaactctgcaggatcccagagt
KF779290_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779294_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779286_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779287_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707572_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AF090839_PreS2_P-A      atgcagtggaattccactgccttccaccaagccctgcaggatcccagagt
AF090840_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779335_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707395_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
AB697492_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779277_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779328_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779330_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KF779342_PreS2_P-A      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
JQ707559_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707553_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707558_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707562_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU414133_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697488_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697489_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697501_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU086721_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU159676_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779240_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
LC311241_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
LC311242_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
MH932713_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697512_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KM606746_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707570_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604247_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859940_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
EU859946_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
EU859948_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
EU859949_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
KT749829_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
KT749844_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagt
GQ414522_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604304_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JX310721_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779385_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KM606742_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KM606749_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779381_PreS2_P-A      gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779336_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779317_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779313_PreS2_P-A      gtgcagtggaattccactgtcttccaccaagctctgcaggatcccagagt
KF779259_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779255_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
MT426094_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477496_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707332_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707336_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707380_PreS2_P-A      acgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
X02763_PreS2_C-A        atgcagtggaattccactgccttccaccaaactctgcaggatcccagagt
U87725_PreS2_P-A        atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
OK106253_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
LC458431_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749838_PreS2_P-A      atgcagtggacttccactgccttccaccaagctctgcaggatcccagagt
KT749835_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749831_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KP718087_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KP274927_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KJ843216_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779386_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779379_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779367_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779333_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779329_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779325_PreS2_P-A      atgcagtggaattccactgccttccacaaagctctgcaggatcccagagt
KF779315_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779310_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779279_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779270_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779266_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779262_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779251_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779238_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgaaggatcccagagt
KF779246_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgaaggatcccagagt
KF779247_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgaaggatcccagagt
KF779248_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgaaggatcccagagt
KP718093_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgaaggatcccagagt
KF476010_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF476005_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF476003_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF476001_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF476000_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475999_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475998_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475997_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475996_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475993_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475991_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475989_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475988_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475986_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475985_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcgggatcccagagt
KF475983_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JX310730_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JX310723_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JX310722_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707634_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707616_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707614_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707573_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707563_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707557_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707556_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707552_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707551_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707560_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707548_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707541_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604300_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604293_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604257_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604216_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KU605532_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604194_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475987_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF475990_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF476004_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF476009_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF476011_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604185_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604180_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GU563557_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707544_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
MT426096_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GU563553_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477503_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604164_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604200_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604297_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604315_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JX096953_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779326_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779334_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779346_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779347_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779352_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779373_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477486_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859953_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859943_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859923_PreS2_P-A      atgcagtggaattccactgcctttcaccaagctctgcaggatcccagagt
EU859921_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU594393_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatccaagagt
EU594391_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU594384_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU594383_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctacaggatcccagagt
AY128092_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AJ012207_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctacaggatcccagagt
KF779304_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctacaggatcccagagt
KY003230_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctacaggatcccagagt
AB937798_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB775199_PreS2_P-A      atgcagtggaattccactgccttccaccaarctctgcaggatcccagagt
AB697487_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB480041_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB300367_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB116078_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477467_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604273_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604294_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779366_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB116079_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB116080_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB246337_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB246338_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB453979_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB453980_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB453981_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB480038_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697491_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697495_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697496_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697497_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697498_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697499_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697503_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697504_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697505_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697507_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697508_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB697509_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB775198_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB775200_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB775201_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB937792_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB937793_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB937794_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AF043580_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AF297624_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AM295795_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AM295797_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU414132_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU594388_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU594389_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU594390_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU594392_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU594394_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU594395_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859898_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859899_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859901_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859902_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859903_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859904_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859905_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859906_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859908_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859909_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859910_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859911_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859912_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859913_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859914_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859915_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859916_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859917_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859918_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859919_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859920_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859922_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859924_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859925_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859926_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859927_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859928_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859929_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859930_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859931_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859932_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859933_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859935_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859936_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859937_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859941_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
EU859942_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
FJ349224_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GQ477461_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GU563546_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GU563554_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GU563555_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GU563558_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
GU563562_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439752_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439754_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439755_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439756_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439757_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439758_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439759_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439760_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439761_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439763_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439764_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439765_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF439766_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604158_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604178_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604184_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604191_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604204_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604228_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604262_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604279_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604283_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604291_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604292_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JN604303_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ687529_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707534_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707546_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707555_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707565_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707566_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707567_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707568_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707609_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707610_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707611_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707612_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707613_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707617_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707618_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707619_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707620_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707621_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707622_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707623_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707624_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707625_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707626_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707629_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707630_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707631_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707632_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707637_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JX310724_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JX310725_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JX310731_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JX310732_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779227_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779243_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779244_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779245_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779258_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779297_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779299_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779314_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779338_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779339_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779350_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779355_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779360_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779362_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779363_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779364_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779368_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779369_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KF779378_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KJ843166_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KJ843173_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KJ843192_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KJ843214_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KJ843215_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KJ854708_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KJ854709_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KJ854710_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KP274925_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KP274928_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749824_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749830_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749836_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749837_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749840_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749843_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
KT749850_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
L13994_PreS2_P-A        atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
LC074724_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
LC311243_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
LC430617_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
LC458430_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
LC592168_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
LC592169_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
LC592170_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
MT426093_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
MT426095_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
LT992448_PreS2_P-A      atgcagtggaactcyacaaccttccaccaaactctgcaagatcccagagt
KF922431_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
LT992441_PreS2_P-A      atgcagtggaattccacaaccttccaacaagctctgcaagatcccagagt
FN545837_PreS2_P-A      atccagtggagttccacaacttcccaccaagctctgcaagatcccagggt
MN585097_PreS2_P-A      atgcagtggaatgccacaaccttccaccaagctctacaagatcccagagt
FN545830_PreS2_P-A      ayccagtggmattccacaactttccaccaagctctgcaagatcccagggt
FN545833_PreS2_P-A      attcagtggaattccacaactttccaccaagctctgcaagatcccagggt
FN545834_PreS2_P-A      attcagtggaattccacaactttccaccaagctctgcaagatcccagggt
MH580627_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagggt
MH580639_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagggt
MH580642_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagggt
MH580643_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagggt
FN545832_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagggt
FN545829_PreS2_P-A      atacagtggaattccacaactttccaccaagctctgcaggatcccaaggt
FN545828_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctacaagatcccagggt
FN545835_PreS2_P-A      atgcartggaattccacaactttccaccaagctctacaagatcccagggt
KP168435_PreS2_P-A      atgcagtggaattccacaacctttcaccaagctctacaagatcccagagt
EU304331_PreS2_P-A      atacaatggaattccacagttttccaccaagctctgaaagatcccagagt
FN545838_PreS2_P-A      atgcagtggaattccacagmtttccaccaagctctgrmagatcccagagt
JF439727_PreS2_P-A      atgcagtagacttccacagcttttcaccaaactctgcaagatcccagagt
JF439732_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439733_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439751_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439906_PreS2_P-A      acgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439910_PreS2_P-A      gtgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439900_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439908_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439898_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439899_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439901_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439896_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439909_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439724_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439907_PreS2_P-A      gtgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439897_PreS2_P-A      gtgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439902_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439904_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439738_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439903_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439905_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439747_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439723_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439721_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439735_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439736_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439737_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439725_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439728_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439750_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439734_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439720_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439744_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439742_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439739_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439722_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439731_PreS2_P-A      atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagt
JF439746_PreS2_P-A      atgcagtggacttccacagcttttcaccgaactctgcaagatcccagagt
JF439745_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439748_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439740_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439741_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439743_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439730_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439726_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
JF439729_PreS2_P-A      atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagt
MW567972_PreS2_P-A      atgcagtggaatgccacagctttccaccaagctctgcaaaatcccagagt
AY934764_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
GQ161813_PreS2_P-A      atgcagtggaactccacagctttccaccaagctctgcaagatcccagagt
MW567976_PreS2_P-A      atacagtggaattccacagctttccaccaagctctgcaagatcccagagt
MW567975_PreS2_P-A      atgcagtggaattccacagctttccaccaagctttgcaagatcccagagt
KM606737_PreS2_P-A      gtgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MW567973_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB194951_PreS2_P-A      atgcagtggaattccacaaatttccaccaagctctgcaagatcccagagt
AB194952_PreS2_P-A      atgcagtggaattccacaaagttccaccaaactctgcaagatcccagagt
MT622525_PreS2_P-A      atgcaatggaattccacaaatttccaccaagccctgcaagatcccagagt
FJ692606_PreS2_P-A      atgcaatggaattccccagttttccaccaagctctgcaagatcccagagt
FJ692613_PreS2_P-A      atgcagtggaattccacagctttccaccaarccctgcaagatcccagagt
FJ692603_PreS2_P-A      atgcagtggaattccacagctttccaccaarctctgcaagatcccagagt
MN544634_PreS2_P-A      atacagtggaattccacaactttccatcaagctctgcaagatcccagagt
FN545825_PreS2_P-A      atacagtggaattccacaactttccaccaagctctgcaagatcccagagt
HM363613_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
FJ692554_PreS2_P-A      atgcagtggaattccacagctttccaccaaactctacaagatcccagagt
FN545836_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctacaagatcccagagt
FN545831_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
LC462120_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692598_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692593_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaaratcccaaagt
HM363612_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN604217_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692605_PreS2_P-A      atgcagtggaattccacagctttccaccaarctctgcaagatcccagagt
FJ692599_PreS2_P-A      atgcagtggaattccacagcttttcaccaagcgctgcaagatcccagagt
FJ692608_PreS2_P-A      atgcaatggaattccacagctttccaccaagctctgcaagatcccagggt
FJ692611_PreS2_P-A      ayacagtggaattccacagctttccaccaagctctgcaagatcccacagt
FJ692595_PreS2_P-A      atrcagtggaattccacagctttccaccamgctctgcaagatcccagagt
FJ692609_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692610_PreS2_P-A      atgcagtggaattccacagctttccaycaarmtctgcaagatcccagagt
FJ692612_PreS2_P-A      atgcagtggaattccacagctttccaccaagcgctgcaagatcccagagt
FJ692607_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692600_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692597_PreS2_P-A      atgcagtggaattccacagckttccaccaagctytgcaagatcccagagt
FJ692604_PreS2_P-A      atgcagtggaattccacagctttccaccaagcyctgcaagatcccagagt
FJ692596_PreS2_P-A      atgcagtggaattccacwgctttccaccaagctctgcaagatcccagagt
FJ692601_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692602_PreS2_P-A      atgcaatggaattccacagctttccaccaagctctgcaagatcccagagt
FN545826_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB194950_PreS2_P-A      ataaagtggaattccccagctttccaccaagctctgcaagatcccagagt
AM180624_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AM184125_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AM184126_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctacaagatcccagagt
EU054331_PreS2_C-A      atgcagtggaattccacagctttccaccaagctctacaagatcccagagt
MT114170_PreS2_P-A      atacagtggaattccaccgctttccaccaagctctgcaagatcccagagt
KX276769_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
MN758699_PreS2_P-A      --gcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ349296_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctacaagatcccagagt
EU366129_PreS2_P-A      atgcagtggaattccacagctttccaccaagccctgcaagatcccagagt
JN604186_PreS2_P-A      atgctgtggaattccacagctttccaccaagctctgcaagatcccaragt
LT992440_PreS2_P-A      atgcagtggaattccacagccttccaccaagctctgcaagatcccagagt
JQ023660_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
JQ023662_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN604163_PreS2_P-A      gtgcagtggaattccacagcttttcaccaaactctgcaagatcccagagc
JN604155_PreS2_P-A      atgcaatggaattccacaactttccaccaagctctrcaagatcccagggt
JN604150_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgmaagatcccagagt
JN604128_PreS2_P-A      gtacagtggaattccacagcttttcaccaagctctgcaagatcccagagt
AB937795_PreS2_P-A      atgcagtggaattccaccgctttccaccaagctctgcaagatcccagagt
KP168431_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgaaagatcccagagt
JQ023661_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
HM011485_PreS2_P-A      atgcagtggaattccacagcgttccaccaagctctgcaagatcccagagt
AB116083_PreS2_P-A      atgcagtggaattccacagctttccaccaagccctgcaagatcccagagt
AB246336_PreS2_P-A      gtgcggtggaattccacaactttccaccaaactctgcaagatcccagagt
JN604251_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagaat
AB116094_PreS2_P-A      atgcagtggaattccacagcttttcgccaagctctgcaagatcccagagt
MG877723_PreS2_P-A      atgcaatggaattccacaaatttccaccaaactctgcaagatcccagagt
MG877725_PreS2_P-A      atgcaatggaattccacaaatttccaccaaactctgcaagatcccagagt
FJ692575_PreS2_P-A      rtgcagtggaattccacagctttccaccaagctctgcaagatcccaaagt
EF103278_PreS2_P-A      atgcagtggaattccacagctttccaccaaactctgcaagatcccagagt
MF925362_PreS2_P-A      atgcagtggaattccaccgctttccaccaagctctgcaagatcccagagt
AB116091_PreS2_P-A      atacagtggaattccacagcttttcgccaagctctgcaagatcccagagt
KX357649_PreS2_P-A      gtgcagtggaattccatagctttccaccaaactctgcaagatcccagagt
KC875254_PreS2_P-A      atgcagtg---ttccacagcattccaccaagctctgcaagatcccagagt
AB453988_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
MN758701_PreS2_P-A      --------gaattccacaacttttcaccaagctctgcaagatcccagagt
MK517517_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854689_PreS2_P-A      atgcagtggaattccacagctttccaccaaactctgcaagatcccagagt
KP168434_PreS2_P-A      atgcagtggaattccacagcgttccaccaagctctgcaagatcccagagt
KJ854685_PreS2_P-A      atrcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854691_PreS2_P-A      atacagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854686_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ843183_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854697_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
JN604230_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854698_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
MN758716_PreS2_P-A      --------gaattccacagctttccaccaagctctgcaagatcccagagt
MN053840_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854706_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
KJ854703_PreS2_P-A      atgcagtggaattccacagctttccaccaaactctgcaagatcccagagt
KJ854696_PreS2_P-A      atgcagtggaattccacagcttcccaccaagctctgcaagatcccagagt
KJ854694_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
MN758684_PreS2_P-A      --gcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MK517516_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MK517519_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AF043560_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854702_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854704_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854705_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854692_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854701_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
MF925385_PreS2_P-A      atgcagtggaattccaccgctttccaccaagctctacaagatcccagagt
MF925407_PreS2_P-A      atgcagtggaattccaccgctttccaccaagctctgcaagatcccagagt
AB116084_PreS2_P-A      atgcagtggaattccacagctttccaccaagccctgcaagatcccagagt
FJ692567_PreS2_P-A      atgcagtggaattccacractttccaycaagctctgcaagatcccagagt
KJ854699_PreS2_P-A      atgcagtggaattccacagctttccaccaagctckgaaagatcccagagt
AB786655_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
AB786656_PreS2_P-A      ------tggaattccacggctttccaccaagctctgcaagatcccagagt
MN476101_PreS2_P-A      atacagtggaattccacagcgttccaccaaactctgcaagatcccagagt
AB116093_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
MF925373_PreS2_P-A      gtgcagtggaattccacagctttccaccaagctctgcaagaccccagagt
AB116086_PreS2_P-A      gtgaagtggaattccacaactttccaccaagctctgcaagatcccagagt
U87731_PreS2_P-A        atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
AY161138_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctacaagatcccagagt
AY161139_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctacaagatcccagagt
DQ315786_PreS2_P-A      atgcagtg---ttccacagctttccaccaagctctgcaagatcccagagt
KX357647_PreS2_P-A      atgcagtggaattccacaactttccaccaaactctgcaagatcccagagt
JN604237_PreS2_P-A      atgcagtggaattccacagctttccaccaarctctgcaagatcccagagt
JN604136_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464816_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagaat
KF922424_PreS2_P-A      nnnnnnnnnnnttccacagctttccaccaagctctgcaagatcccagagt
KF922425_PreS2_P-A      nnnnnnnnnnnttccacagctttccaccaagctctgcaagatcccagagt
KC875259_PreS2_P-A      atgcagtg---ctccacagctttccaccaagctctgcaagatcccagagt
KC875252_PreS2_P-A      atgcagtg---ctccacagctttccaccaagctctgcaagatcccagagt
KC875253_PreS2_P-A      atgcagtg---ctccacagctttccaccaagctctgcaagatcccagagt
KP168429_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY373428_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctacaagatcccagagt
AY934770_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY934768_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY934767_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY934765_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY934769_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KM606748_PreS2_P-A      gtgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN604260_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KC875258_PreS2_P-A      atgcagtg---ttccacagctttccaccaagctctgcaagatcccagagt
KC875255_PreS2_P-A      atgcagtg---ctccacagccttccaccaagctctgcaagatcccagagt
MN476102_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctacaagatcccagagt
KX357643_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KX357642_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KP168428_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY934771_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctacaagatcccagagt
KJ854700_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
FJ692588_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
KJ194506_PreS2_P-A      atacagtggaattccacaactttccaccaagctctacaagatcccagagt
LC051141_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854695_PreS2_P-A      atacagtggaattccacagcttttcaccaagctctgcaagatcccagagt
KF170754_PreS2_P-A      acacagtggaattccacagatttccaccaagctctgcaagatcccagagt
FJ692565_PreS2_P-A      atrcagtggaattccacaactttccaccaagctctgcaagatcccagagt
AB786660_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692591_PreS2_P-A      atgcagtggaattccacarctttccaccaagctctgcaagatcccagagt
FJ692564_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
FJ692590_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
KP168432_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctacaagatcccagagt
KP168430_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854690_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
FJ692566_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB786651_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
AB786647_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
MF772353_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KX357650_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KX357645_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KU736920_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KP718086_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
KJ854707_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
KJ854693_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
AY903452_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB241115_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
KC875257_PreS2_P-A      atgcagtg---ttccacagctttccaccaagctctgcaagatcccagagt
KC875251_PreS2_P-A      atgcagtg---ttccacagctttccaccaagctctgcaagatcccagagt
KC875256_PreS2_P-A      atgcagtg---ttccacagctttccaccaagctctgcaagatcccagagt
AB453987_PreS2_P-A      atacagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854687_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KP718085_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
MF772351_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KM519452_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
KM519453_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
KF922428_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
JN604145_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB937791_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
AB937796_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
KF922426_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
KF922427_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
AY934774_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
DQ020003_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
EU410082_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY233278_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
JQ023663_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KP168433_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB786662_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
AB786645_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
AB786657_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
AB786658_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
AB786643_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
AB786646_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
AB786648_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
AB786649_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
AB786652_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
AB786654_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
AB116090_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MN585096_PreS2_P-A      atgcagtggaattccacaaccttccaccaagctctgcaagatcccagagt
EU859952_PreS2_P-A      atgcagtggaattccacaaccttccaccaagctctgcaagatcccagagt
GQ331047_PreS2_P-A      atgcagtggaattccacaaccttccaccaagctctgcaagatcccagagt
GQ331046_PreS2_P-A      gtgcagtgggagtccacaaccttccaccaagctctgcaagatcccagagt
FJ692558_PreS2_P-A      ctgmagtggaattccacagctttacacmaaactcagcaagatcccagagt
KF779384_PreS2_P-A      atgcagtggaattccacagctttccaccaagctttgcaagatcccagagt
JN604193_PreS2_P-A      atgcaatggaattccacagctttccaccaagctctgcaagatcccagagt
KF214662_PreS2_P-A      gcgcagtggaattccacagctttccaccaaactctgcaagatcccagagt
AY373432_PreS2_P-A      atgcagtggaattccactgccttccaccaagctctgcagaatcccaaaga
KF214659_PreS2_P-A      atgcagtggaattccaccgctttccaccaaactctgcaagatcccagagt
AB453986_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB116088_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
KR905426_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KT366467_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KR905429_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
DQ315784_PreS2_P-A      atgcagtg---ttccacagctttccaccaagctctgcaagatgttagaaa
AB116082_PreS2_P-A      atgcagtggaattccacagctttccaccaaactctgcaagataccagagt
AB116085_PreS2_P-A      atgcagtggaattccacagctgtccaccaagctctgcaagatcccagagt
KT151615_PreS2_P-A      atgcagtggaattccaccgccttccgccaagctctgcaagatcccagagt
KR905427_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KR905425_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KT366466_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF214666_PreS2_P-A      atgcagtggaattccacagctttccatcaagctctgcaagatcccagagt
AB116092_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB116089_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
KF214657_PreS2_P-A      atgcagtggaattccacagctttccaccaaactctgcaagatcccagagt
AY373429_PreS2_P-A      atacagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF214665_PreS2_P-A      atgcagtggaattccccagctttccaccaagctctgcaagatcccagagt
JN604252_PreS2_P-A      atgcagtggaattccacagcgttccaccaagctctgcaagatcccagagt
JN604156_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB116087_PreS2_P-A      atgcaatggaattccacagctttccaccaaactctgcaagatcccagagt
MF925372_PreS2_P-A      acgcagtggaaggccacagctttccaccaagctctgcaagatcccagagt
KF214660_PreS2_P-A      atacagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF214661_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AF090842_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB241114_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagaat
DQ315785_PreS2_P-A      atgcagtg---ttccacagctttccaccaagctctgcaagatcccagagt
OK274310_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
M57663_PreS2_P-A        atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KT366471_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KR905430_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KR905431_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KT366468_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KT366470_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB246335_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagaat
KF214663_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MF925361_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MT426088_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KT366469_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
JN604171_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
JN604261_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY233290_PreS2_P-A      atgcagtggaattccaccgctttccaccaagctctgcaagatcccagagt
MF979149_PreS2_P-A      atgcaatggaattccacagctttccaccaagctctgcaagatcccaaaat
MH464817_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464808_PreS2_P-A      atgcagtggaactccacagctttccmccaamctcwgcaagatmccmgast
MH464823_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KR139742_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464809_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF922420_PreS2_P-A      atacagtggaattccacagcttgccatcaagctctgaaagatcccagagt
KF922421_PreS2_P-A      atacagtggaattccacagcttgccatcaagctctgaaagatcccagagt
KF922414_PreS2_P-A      atacagtggaattccacagcttgccatcaagctctgaaagatcccagagt
KF922415_PreS2_P-A      atacagtggaattccacagcttgccatcaagctctgaaagatcccagagt
KF922416_PreS2_P-A      atacagtggaattccacagcttgccatcaagctctgaaagatcccagagt
KF922417_PreS2_P-A      atacagtggaattccacagcttgtcatcaagctctgcaagatcccagagt
KF922418_PreS2_P-A      atacagtggaattccacagcttgtcatcaagctctgcaagatcccagagt
KF922419_PreS2_P-A      atacagtggaattccacagcttgtcatcaagctctgcaagatcccagagt
MT210032_PreS2_P-A      atgcagtggaattccacagttttccacagagctctgcaagatcccagagt
KF476023_PreS2_P-A      atgcagtggaattccacagctttccgcagagctctgcaagatcccagagt
KF476022_PreS2_P-A      atgcagtggaattccacagctttccacagagctctgcaagatcccagagt
KF476024_PreS2_P-A      atgcagtggaattccacagctttccacagagctctgcaagatcccagagt
KF476025_PreS2_P-A      atgcagtggaattccacagctttccacagagctctgcaagatcccagagt
KF476026_PreS2_P-A      atgcagtggaattccacagctttccacagagctctgcaagatcccagagt
KF476027_PreS2_P-A      atgcagtggaattccacagctttccacagagctctgcaagatcccagagt
KU605536_PreS2_P-A      atgcagtggaattccacagctttccacagagctctgcaagatcccagagt
KU605537_PreS2_P-A      atgcagtggaattccacagctttccacagagctctgcaagatcccagagt
KU605538_PreS2_P-A      atgcagtggaattccacagctttccacagagctctgcaagatcccagagt
KU605539_PreS2_P-A      atgcagtggaattccacagctttccacagagctctgcaagatcccagagt
U87733_PreS2_P-A        atgcaatggaattccacagctttccacaaagctctgcaagatcccagagt
AF297621_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
U87727_PreS2_P-A        atgcactggaattccacagctttccacagagctctgcaagatcccagagt
U87728_PreS2_P-A        atgcagtggaattccacaaccttccaccaagctctgcaagatcccagagt
MF979153_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF922435_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF922436_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF922437_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MF979143_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB453989_PreS2_P-A      atgcagtggaattccacaactttccaccaaactctgcaagatcccagagt
FJ692561_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
KR139744_PreS2_P-A      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
AY233287_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF922429_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF922430_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY934772_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692576_PreS2_P-A      atgcagtggaaytccacagctttccaccaarctctgcaagatcccagart
FJ692562_PreS2_P-A      atacagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464811_PreS2_P-A      atgcartggaattccacagctttccaccaagctctgcaagatcccagagt
JN604241_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MF925368_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KR139743_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MF925400_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464820_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY233276_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY233279_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692572_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ854688_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
FJ692577_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692559_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692571_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692578_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692579_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692580_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692581_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692582_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692583_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692584_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692585_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692557_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692574_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692563_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB076679_PreS2_P-A      gtgcagtggaatttcacagctttccaacaagccctacaagatcccagagt
KF779332_PreS2_P-A      atgcagtggaattccacagctttccaccaaactctgcaggatcccagagt
AB076687_PreS2_P-A      atgcagtggaattccacagtttttcaccaagctctgcaagatcccagagt
U87736_PreS2_P-A        atgcagtggaattccacagctttccacaaagctctgcaatatcccagagt
AB076682_PreS2_P-A      atgcagtggaattccacaaatcttcaacaagccctgcaagatcccagagt
AB076685_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY233288_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
AB076681_PreS2_P-A      atacagtggaattccacagctttccaccaagctctgcaagatcccagagt
JN182334_PreS2_P-A      atgcagtggaattccacagcttttcaccaggctctgcaagatcccagagt
AB786661_PreS2_P-A      ------tggaattccacagcttttcaccaagctctgcaagatcccagagt
AY934773_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
AM494718_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182333_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182332_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182331_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182328_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182324_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182330_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182323_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182321_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182320_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182319_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182318_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182322_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182325_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182326_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182327_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN182329_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
AB076690_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
AB076689_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
AB076683_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccaaagt
AB076686_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
AB076678_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
AB076688_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
JN604157_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MK512462_PreS2_P-A      gcgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692587_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FJ692592_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaggatccaaaagt
KF922433_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF922434_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY233275_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY233281_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY233284_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KT347087_PreS2_P-A      atgcagttgaattccacagctttccaccaagctctgcaagatcccagagt
KP168427_PreS2_P-A      atgcagtggaattccacagctttccatcaagctctgcaagatcccagagt
KF476019_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MK512455_PreS2_P-A      atgcagtggaattccacagctttccatcaagctctgcaagatcccagagt
MK512475_PreS2_P-A      atgcagtggaattccacagctttccaccaaactctgcaagatcccagagt
KF476020_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MK512471_PreS2_P-A      gtgcagtggaattccacagctttccaccaaactctgcaagatcccaaagt
HM535205_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagc
AB076680_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KP168422_PreS2_P-A      atgcagtggaattccacagcgttccaccaagcactacaagatcccagagt
KJ010776_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ010778_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ010777_PreS2_P-A      atgcaatggaattccacagctttccaccaagctctgcaagatcccagagt
MK512457_PreS2_P-A      atgcattggaattccacacctttccacccagctctgcaagatcccagagt
AF297625_PreS2_P-A      atgcagtggaattccacagctttgcaccaagctctgcaagatcccagagt
U87734_PreS2_P-A        atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464825_PreS2_P-A      atgcagtggaattccacagctttccaccaggctctgcaagatcccagagt
KF476018_PreS2_P-A      atgcagtggaattccacagctttccaccaaactctgcaagatcccagagt
KU605533_PreS2_P-A      atgcagtggaattccacagctttccaccaaactctgcaagatcccagagt
KU605534_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB786663_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
MK512464_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KX357646_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KP168426_PreS2_P-A      atgcagtggaattccacagctttctaccaagctctgcaagatcccagagt
FM199980_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FM199974_PreS2_P-A      atgcagtggaattccamagctttccaccaagctctgcaagatcccagagt
MT426092_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF476016_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KT347091_PreS2_P-A      atgcagtggaattccacagccttccaccaagctctgcaagatcccagagt
KT347092_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MK512466_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464812_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
GU563547_PreS2_P-A      atgcagtggaattccacagctttccaccaaactctgcaagattccagagt
AY233289_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY233285_PreS2_P-A      atgcagtggaatcccacagctttccaccaagctctgcaagatcccagagt
AY233274_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY934766_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
JN604169_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF922409_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF922408_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF922406_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF922407_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MT426091_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MK512468_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MK512465_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FM199981_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FM199977_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY233282_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
JX154579_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
JX154580_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
JX154581_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
JX154582_PreS2_P-A      atgcagtggaattccacaactttccaccaagctctgcaagatcccagagt
KP168424_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KP168423_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AB786659_PreS2_P-A      ------tggaattccacagctttccaccaagctctgcaagatcccagagt
KP168425_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MF979146_PreS2_P-A      aygcagtggaattccacagctttccaccaggctctgcaagatcccagagt
MH464810_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464829_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464813_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464814_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464818_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464819_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464821_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464822_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464826_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464827_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464830_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464824_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
HM535200_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MF979151_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF476021_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF476017_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MF979144_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KX648548_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY233283_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KT347088_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KU605535_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464815_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MH464828_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MK512467_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KU736919_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
DQ020002_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaggatcccagagt
KU736918_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MK512456_PreS2_P-A      aggcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MK512474_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FM199976_PreS2_P-A      rtgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FM199978_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
FM199979_PreS2_P-A      atgcagtggaattccacagcttttcaacaagctctgcaagatcccagagt
MK512460_PreS2_P-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
MK512473_PreS2_P-A      atgcagtggaattccacagctttccagcaagctctgcaagatcccagagt
MK512472_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
GU563545_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
GU563548_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MK512470_PreS2_P-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt

JN604218_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JN604308_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacaggaaacc
AB937797_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcagamacagtaaacc
JN604249_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604176_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU185786_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY232837_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
DQ298161_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY230118_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
DQ298165_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
DQ298164_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
DQ298163_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY232836_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY232838_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY232839_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY232840_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY230117_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
DQ298162_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477477_PreS2_P-A      caggggtctgtgttttcctgctggtggctccagttcaggaacagtaaacc
GQ477474_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU185789_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU185787_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU185788_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604285_PreS2_P-A      cmagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AJ344115_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
MF772348_PreS2_P-A      cagggatctgtgtcttcctgctggtggctccagttcaggaacagtaaacc
JN604314_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604165_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604229_PreS2_P-A      cargggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604220_PreS2_P-A      ccggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
MK568525_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
MK568535_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
MK568530_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
MK568531_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY934763_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX125364_PreS2_P-A      gaggggtctgtattttcctgctggtggctccagttcagaaacagtaaacc
JF439821_PreS2_P-A      caggggaatgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439931_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439935_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439919_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439923_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439921_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439912_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439915_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439914_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439927_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439925_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439924_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439920_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439917_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439916_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439926_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439911_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439913_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439922_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439918_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439936_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439942_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439933_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439938_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439939_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439937_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439941_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439930_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439932_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439929_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439928_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439934_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439940_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439823_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439819_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439827_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439824_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439832_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439826_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439820_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439830_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439828_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439822_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439825_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439829_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439831_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439852_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439843_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439867_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439846_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439855_PreS2_P-A      cgggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439850_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439841_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439857_PreS2_P-A      cgggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439854_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439856_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439839_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaagaacagtaaacc
JF439836_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439840_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439859_PreS2_P-A      cgggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439847_PreS2_P-A      cgggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439851_PreS2_P-A      cgggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439865_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439858_PreS2_P-A      cgggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439860_PreS2_P-A      cgggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439853_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439838_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439835_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439837_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439834_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439833_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439844_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439845_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439848_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707599_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707589_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707608_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707590_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707576_PreS2_P-A      caagggtctgaattttcctgctggtggctccagttcaggaacagtaaacc
JQ707585_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707586_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707592_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707595_PreS2_P-A      caagggtctgaattttcctgctggtggctccagttcaggaacagtaaacc
JQ707597_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707584_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707574_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707602_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707579_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707588_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707591_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707598_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707593_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707582_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707607_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707605_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707600_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707596_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707577_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707594_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707601_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707604_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707587_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707580_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707606_PreS2_P-A      caagggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707581_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707603_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707583_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707575_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707578_PreS2_P-A      caagggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439842_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707401_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439864_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439868_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439866_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439849_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439861_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439862_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439990_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439767_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439777_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439768_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439769_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439774_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF440020_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707370_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707345_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707348_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707357_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707351_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707367_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707364_PreS2_P-A      caggggtctgtatcttcctgctggcggctccagttcaggaacagtaaacc
JQ707354_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707362_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707347_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707361_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707358_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707346_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707349_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707355_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707356_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707363_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707365_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707369_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707368_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707353_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707350_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707352_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707359_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707360_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707366_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439970_PreS2_P-A      ctggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439958_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707406_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707417_PreS2_P-A      caggggtctatattttcctgctggtggctccagttcaggaacagtaaacc
JQ707408_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707400_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707402_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707403_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707404_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707405_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707409_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707410_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707411_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707412_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707413_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707414_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707416_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707418_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707419_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707420_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707407_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707415_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749834_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KT749839_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KT749846_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KT749847_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KT749849_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439993_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439992_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439991_PreS2_P-A      caggggtctgtattttcctgctggcggctccagttcaggaacagtaaacc
JF439982_PreS2_P-A      caggggtctgtattttcctgctggtggctccagtccaggaacagtaaacc
JF439979_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439976_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439975_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439961_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439952_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439949_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859934_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439966_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439971_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859955_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859956_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718089_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KM519454_PreS2_P-A      caggggtctgtattctcctgctggtggctccagttcaggaacagtaaacc
JF439988_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439985_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439984_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439978_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439973_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggagcagtaaacc
JF439972_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439965_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439960_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439959_PreS2_P-A      caggggtctatattttcctgctggtggctccagttcaggaacagtaaacc
JF439953_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439951_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859951_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439989_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439944_PreS2_P-A      cgggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439945_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439964_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707676_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707663_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707653_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707651_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707647_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707644_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707640_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707638_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707639_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707641_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707642_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707643_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707645_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707646_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707648_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707649_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707650_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707652_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707654_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707655_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707656_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439987_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439986_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439983_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtagacc
JF439977_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439968_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439963_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439957_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439956_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439954_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439950_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439947_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439943_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GU563550_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439946_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439948_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439955_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439962_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439967_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439969_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439974_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439980_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697493_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AM295798_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AM295799_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AM410963_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859954_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707658_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707659_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707661_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707662_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707664_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707665_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707667_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707669_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707670_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707672_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707675_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707681_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707674_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604309_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707318_PreS2_P-A      caggggtctgtattttcctggtggtggctccagttcaggaacagtaaacc
GQ477493_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477476_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477473_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
MF772347_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
AJ627227_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439872_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439881_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439877_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439878_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439870_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439880_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439875_PreS2_P-A      cacgggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439873_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439869_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439876_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439871_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439874_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439879_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439882_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439883_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749822_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604305_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtcaacc
U87735_PreS2_P-A        caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
MF772345_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JN604183_PreS2_P-A      caggggtytgtattttcctgctggtggctccagttcaggaacagtaaacc
AF537372_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
AY152726_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KT151612_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT151617_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604302_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477502_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB205118_PreS2_P-A      caggggtccgtatcttcctgctggtggctccagttcaggaacagtaaacc
AY738142_PreS2_P-A      caggggtctgtcttttcctgctggtggctccagttcaggaacagtaaacc
AY738140_PreS2_P-A      caggggtctgtcttttcctgctggtggctccagttcaggaacagtaaacc
AY738141_PreS2_P-A      caggggtctgtcttttcctgctggtggctccagttcaggaacagtaaacc
KT151614_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477463_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477500_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
U87726_PreS2_P-A        caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
GQ477480_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY233286_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AF536524_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KX827297_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AF143302_PreS2_P-A      caggggtctg------cccgctggtggctccagttcaggaacagtaaacc
DQ788728_PreS2_P-A      caggggtctg------cctgctggtggctccagttcaggaacagtaaacc
AJ309369_PreS2_P-A      caggggtccgtattttcctgctggtggctccagttcaggaacagtaaacc
AJ309370_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AJ309371_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
X51970_PreS2_P-A        caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AF090838_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcagaaacagtaaacc
MF772346_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JN604209_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
GU563551_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477494_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779320_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779321_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX125368_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604290_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JN604236_PreS2_P-A      caggggtctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN604227_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
GQ477464_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AF297622_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604298_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JN604190_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604179_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477495_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB116076_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JN604269_PreS2_P-A      caggggtctatatcttcctgctggtggctccagttcagggacagtaaacc
GQ477478_PreS2_P-A      caggggtctgtattctcctgctggtggctccagttcaggaacagtaaacc
GQ477470_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY034878_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
MF772349_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ586809_PreS2_P-A      caggggtctgtattttcctgctggtggctcccgttcaggaacagtaaacc
GQ477469_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AJ627226_PreS2_P-A      caggga---------tcctgctggtggctccagttcaggaacagtaaacc
MF772344_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KY382410_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779298_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779293_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
HE576989_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477504_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB222707_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY738139_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY738143_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779272_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
GQ477501_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP995108_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779260_PreS2_P-A      caggggtctgaattttcctgctggtggctccagttcaggaacagtaaacc
GQ477490_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779210_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779211_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KX827293_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707340_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ184324_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ184323_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
Z72478_PreS2_P-A        caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
MF772350_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749833_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779264_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476012_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475994_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475984_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KC875260_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtcaacc
JQ707628_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707537_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604317_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604277_PreS2_P-A      gaggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604188_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604172_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
HE576988_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477497_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477472_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477462_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU747320_PreS2_P-A      caggggtctatatcttcctgctggtggctccagttcaggaacagtaaacc
AM282986_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY707087_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AF143298_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
AB362931_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
U87732_PreS2_P-A        caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707398_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604266_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477488_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
EU859950_PreS2_P-A      caggggtc------ttcctgctggtggctccagttcaggaacagtaaacc
GQ477475_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779295_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX125367_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AF537371_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
AF090841_PreS2_P-A      caggggtctgtattttcctgctggtggcttcagttcaggaacagtaaacc
JQ707325_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477468_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
DQ788725_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707319_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604197_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749825_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KT749826_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KT749842_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
X70185_PreS2_P-A        caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
V00866_PreS2_P-A        caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
MT426097_PreS2_P-A      caggggtccgtattttcctgctggtggctccagttcaggaacagtaaacc
MN507849_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY886219_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ843184_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ843172_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779324_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779261_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476013_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476006_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476002_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaccagtaaacc
KF475982_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707536_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707372_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604307_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604159_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439981_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477482_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477465_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859944_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
EU859939_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594386_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EF208113_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697511_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaatagtaaacc
AB480040_PreS2_P-A      caggggtctgtatyttcctgctggtggctccagttcaggaacagtaaacc
AB453984_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB453983_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707335_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB014370_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707301_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707316_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707337_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779213_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779215_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604181_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779370_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779283_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaagaacagtaaacc
KF779268_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB549213_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779280_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779274_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779271_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779281_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779253_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY862867_PreS2_P-A      caggggtctgtattttcctgctggtggttccagttcaggaacagtaaacc
AY862868_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604173_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779256_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779383_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779282_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594385_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779249_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779273_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779275_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779305_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779306_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779307_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779308_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779309_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779371_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707561_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707554_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707545_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707531_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707538_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697506_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707543_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707569_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707571_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707540_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707533_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707542_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707535_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707539_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707305_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604274_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
GQ477499_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594387_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
AB126580_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718100_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ843182_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ843186_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ843218_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ843217_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718088_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718090_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718091_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718094_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718095_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718096_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718097_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718098_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718099_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718101_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707309_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707323_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707303_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707312_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749832_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859938_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707344_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707324_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707326_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
U87730_PreS2_P-A        caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
U87729_PreS2_P-A        caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
MT426099_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
MT426098_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KX827298_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718102_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KP718092_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779365_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779322_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779319_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779311_PreS2_P-A      caggggtctgtattttcctgcaggtggctccagttcaggaacagtaaacc
KF779284_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779265_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779263_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779257_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779252_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779232_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KF779231_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476015_PreS2_P-A      caggggtctgtattttcctgccggtggctccagttcaggaacagtaaacc
KF476014_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476008_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476007_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475995_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475992_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX096952_PreS2_P-A      caggggactgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707635_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707550_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707549_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707547_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707532_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707397_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707343_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707339_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707334_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707329_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707321_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ687533_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604288_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604282_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779234_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604270_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604268_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604214_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477498_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477491_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477487_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477484_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477479_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
EU859947_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859945_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859907_PreS2_P-A      cagggatctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859900_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
DQ131121_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY233280_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB480036_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
AB263406_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB116077_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB064314_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KF779372_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779349_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779356_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779374_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707333_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707299_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707302_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707308_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707311_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707320_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707341_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707342_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
Z35717_PreS2_P-A        caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779316_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779254_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB453982_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB116081_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB300366_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB480039_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604276_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707306_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707317_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707313_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707300_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707314_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707330_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707331_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604242_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477466_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707615_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707627_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707633_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707636_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779221_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ843188_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KX827296_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779358_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779354_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779344_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779345_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779348_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779276_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779239_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779269_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707391_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707388_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707387_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707384_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707378_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707377_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707374_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707338_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707328_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707327_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707322_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707315_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707310_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707304_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604319_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604306_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604167_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604162_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY902775_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604299_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707371_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707373_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707375_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707376_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707379_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707381_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707382_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707383_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707385_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707386_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707389_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707390_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707392_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707393_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707394_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707396_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707399_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779312_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779331_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779359_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779375_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KX827294_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KX827295_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604160_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707307_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779337_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779351_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779361_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779323_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439753_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439762_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604240_PreS2_P-A      caggggtctatattttcctgctggtggctccagttcaggaacagtaaacc
LC517161_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcagacatagtaaacc
JQ707564_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779291_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779290_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779294_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779286_PreS2_P-A      caggggtctgtatttacctgctggtggctccagttcaggaacagtaaacc
KF779287_PreS2_P-A      caggggtctgtatttacctgctggtggctccagttcaggaacagtaaacc
JQ707572_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AF090839_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AF090840_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779335_PreS2_P-A      caggggtctgtattttcctgctggtggctccagtttaggaacagtaaacc
JQ707395_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697492_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779277_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779328_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779330_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779342_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707559_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707553_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707558_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707562_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU414133_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697488_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697489_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697501_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU086721_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU159676_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779240_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
LC311241_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
LC311242_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
MH932713_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697512_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KM606746_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707570_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604247_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859940_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859946_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859948_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859949_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749829_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749844_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ414522_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604304_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX310721_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779385_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KM606742_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KM606749_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779381_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KF779336_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779317_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779313_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KF779259_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779255_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
MT426094_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477496_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707332_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707336_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JQ707380_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
X02763_PreS2_C-A        caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
U87725_PreS2_P-A        caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
OK106253_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
LC458431_PreS2_P-A      caggggtctgtattttccygctggtggctccagttcaggaacagtaaacc
KT749838_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749835_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749831_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718087_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP274927_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KJ843216_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779386_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779379_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779367_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779333_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779329_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779325_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779315_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779310_PreS2_P-A      caggggtctgtattttcctgcaggtggctccagttcaggaacagtaaacc
KF779279_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779270_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779266_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779262_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779251_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779238_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779246_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779247_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779248_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP718093_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476010_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476005_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476003_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476001_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476000_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475999_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475998_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475997_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475996_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475993_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475991_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475989_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475988_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475986_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475985_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475983_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX310730_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX310723_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX310722_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707634_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707616_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707614_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707573_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707563_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707557_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707556_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707552_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707551_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707560_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707548_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707541_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604300_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604293_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604257_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604216_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KU605532_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604194_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475987_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF475990_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476004_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476009_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF476011_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604185_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604180_PreS2_P-A      caggggtctatattttcctgctggtggctccagttcaggaacagtaaacc
GU563557_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707544_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
MT426096_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GU563553_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477503_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604164_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604200_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604297_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604315_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX096953_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779326_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779334_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779346_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779347_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779352_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779373_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477486_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859953_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859943_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859923_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859921_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594393_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594391_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594384_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594383_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AY128092_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
AJ012207_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779304_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY003230_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB937798_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB775199_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697487_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB480041_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB300367_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB116078_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
GQ477467_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JN604273_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JN604294_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KF779366_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
AB116079_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB116080_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB246337_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB246338_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB453979_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB453980_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB453981_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB480038_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697491_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697495_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697496_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697497_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697498_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697499_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697503_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697504_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697505_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697507_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697508_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB697509_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB775198_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB775200_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB775201_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB937792_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB937793_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB937794_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AF043580_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AF297624_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AM295795_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AM295797_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU414132_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594388_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594389_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594390_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594392_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594394_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594395_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859898_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859899_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859901_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859902_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859903_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859904_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859905_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859906_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859908_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859909_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859910_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859911_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859912_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859913_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859914_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859915_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859916_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859917_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859918_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859919_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859920_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859922_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859924_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859925_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859926_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859927_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859928_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859929_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859930_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859931_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859932_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859933_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859935_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859936_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859937_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859941_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU859942_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ349224_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ477461_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GU563546_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GU563554_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GU563555_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GU563558_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
GU563562_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439752_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439754_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439755_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439756_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439757_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439758_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439759_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439760_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439761_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439763_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439764_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439765_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF439766_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604158_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604178_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604184_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604191_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604204_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604228_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604262_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604279_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604283_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604291_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604292_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN604303_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ687529_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707534_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707546_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707555_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707565_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707566_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707567_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707568_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707609_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707610_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707611_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707612_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707613_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707617_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707618_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707619_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707620_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707621_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707622_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707623_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707624_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707625_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707626_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707629_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707630_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707631_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707632_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707637_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX310724_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX310725_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX310731_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JX310732_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779227_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779243_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779244_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779245_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779258_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779297_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779299_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779314_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779338_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779339_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779350_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779355_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779360_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779362_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779363_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779364_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779368_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779369_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF779378_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ843166_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ843173_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ843192_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ843214_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ843215_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ854708_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ854709_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ854710_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP274925_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP274928_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749824_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749830_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749836_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749837_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749840_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749843_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KT749850_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
L13994_PreS2_P-A        caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
LC074724_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
LC311243_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
LC430617_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
LC458430_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
LC592168_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
LC592169_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
LC592170_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
MT426093_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
MT426095_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
LT992448_PreS2_P-A      caggagcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF922431_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
LT992441_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaagcc
FN545837_PreS2_P-A      caggggc---------cctgctggtggctccaattcaggaacagtaaacc
MN585097_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FN545830_PreS2_P-A      caggggcctgtatttacctgctggtggctccaattcaggaacagtaaacc
FN545833_PreS2_P-A      caggggcctgtatctccctgctggtggctccaattcaggaacagtaaacc
FN545834_PreS2_P-A      caggggcctgtatctccctgctggtggctccaattcaggaacagtaaacc
MH580627_PreS2_P-A      caggggtctgtatttccctgctggtggctccaattcaggaacagtaaacc
MH580639_PreS2_P-A      caggggtctgtatttccctgctggtggctccaattcaggaacagtaaacc
MH580642_PreS2_P-A      caggggtctgtatttccctgctggtggctccaattcaggaacagtaaacc
MH580643_PreS2_P-A      caggggtctgtatttccctgctggtggctccaattcaggaacagtaaacc
FN545832_PreS2_P-A      caggggcctgtatttccctgctggtggctccaattcaggaacagtaaacc
FN545829_PreS2_P-A      caggggcctgtatttccctgctggtggctccaattcaggaacagtaaacc
FN545828_PreS2_P-A      caggggcctgtatttccctgctggtggctccaattcaggaacagtaaacc
FN545835_PreS2_P-A      caggggcctgtatttccctgctggtggctccaattcaggaacagtaaacc
KP168435_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacartaaacc
EU304331_PreS2_P-A      caggggactgtattttcctgctggtggctccagttcagaaacactcaacc
FN545838_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaagcc
JF439727_PreS2_P-A      cgggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439732_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439733_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439751_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439906_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439910_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439900_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439908_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439898_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439899_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439901_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439896_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439909_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439724_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439907_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439897_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439902_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439904_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439738_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439903_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439905_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439747_PreS2_P-A      caggggcctgtatcttcctgctggtggctccggttcaggaacagtaaacc
JF439723_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439721_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439735_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439736_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439737_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439725_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439728_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439750_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439734_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439720_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439744_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439742_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439739_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439722_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439731_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439746_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439745_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439748_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439740_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439741_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439743_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439730_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
JF439726_PreS2_P-A      caggggcctgtatcttcctgctggtagctccagttcaggaacagtaaacc
JF439729_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
MW567972_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaagcc
AY934764_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatagtaaacc
GQ161813_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
MW567976_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaagcc
MW567975_PreS2_P-A      cagaggcctgtatcttcctgctggtggctccagttcaggaacagtaagcc
KM606737_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaagcc
MW567973_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB194951_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtcaacc
AB194952_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtcaacc
MT622525_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtcaacc
FJ692606_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692613_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692603_PreS2_P-A      caggarcctgtgtcttcctgctggtggctccagttcaggaacagtaaacc
MN544634_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FN545825_PreS2_P-A      aaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaccc
HM363613_PreS2_P-A      aaggggcctgtattttcctgctggtggctccagttcaggaacagtaaccc
FJ692554_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FN545836_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FN545831_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
LC462120_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692598_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692593_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
HM363612_PreS2_P-A      caggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
JN604217_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692605_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692599_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692608_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692611_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692595_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692609_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692610_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692612_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692607_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692600_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692597_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692604_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtraacc
FJ692596_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692601_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692602_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FN545826_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB194950_PreS2_P-A      caagggcctgtattttcctgctggtggctccagttcaggaacagtaagcc
AM180624_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaagcc
AM184125_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaagaacagtaagcc
AM184126_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaagcc
EU054331_PreS2_C-A      caggggcctgtattttcctgcggggtgctccagttcaggaacagtaagcc
MT114170_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcagggacactcaacc
KX276769_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MN758699_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ349296_PreS2_P-A      caggggcctgtattttcctgctggtgggtccagttcaggaacagtcagcc
EU366129_PreS2_P-A      aaggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN604186_PreS2_P-A      caggggcctgtactttcctgctggtggctccagttcaggaacactcaacc
LT992440_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ023660_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JQ023662_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactgaacc
JN604163_PreS2_P-A      caggggcctgtgtcctcctgctggtggctccagttcaggaacactcaacc
JN604155_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN604150_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN604128_PreS2_P-A      caggggcctgtatctccctgctggtggctccagttcaggaacactcaacc
AB937795_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcagggacactcaacc
KP168431_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
JQ023661_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
HM011485_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB116083_PreS2_P-A      caggggcctgtatattcctgctggtggctccagttcaggaactctcaacc
AB246336_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
JN604251_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB116094_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
MG877723_PreS2_P-A      caggggactgtattttcctgctggtggctccagttcaggaacactcaacc
MG877725_PreS2_P-A      caggggactgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692575_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
EF103278_PreS2_P-A      caggggcctgtattctcctgctggtggctccagttcaggaacactcaacc
MF925362_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB116091_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
KX357649_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KC875254_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
AB453988_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MN758701_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcagraacactcaacc
MK517517_PreS2_P-A      caggggcctgtattttcctgttggtggctccagttcaggaacactcaacc
KJ854689_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KP168434_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854685_PreS2_P-A      caggggcctgtattctcctgctggtggctccagttcaggaacactcaacc
KJ854691_PreS2_P-A      caggggcctgtatctacctgctggtggctccagttcaggaacactcaacc
KJ854686_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ843183_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854697_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN604230_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854698_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MN758716_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MN053840_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854706_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854703_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854696_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854694_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MN758684_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MK517516_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MK517519_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AF043560_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854702_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854704_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854705_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854692_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854701_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MF925385_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
MF925407_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
AB116084_PreS2_P-A      caggggcctgtatattcctgctggtggctccagttcaggaacactcaacc
FJ692567_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854699_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
AB786655_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786656_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MN476101_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB116093_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
MF925373_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaactctcaacc
AB116086_PreS2_P-A      caggagcctgtatcttcctgctggtggctccagttcaggaacactcaacc
U87731_PreS2_P-A        caggggcctgtattttcctcgtggtggctccagttcaggaacactcaacc
AY161138_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY161139_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
DQ315786_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcagggactctcaacc
KX357647_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
JN604237_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN604136_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
MH464816_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
KF922424_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF922425_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KC875259_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcagggactctcaacc
KC875252_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
KC875253_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcagggacactcaacc
KP168429_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
AY373428_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY934770_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
AY934768_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
AY934767_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
AY934765_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
AY934769_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
KM606748_PreS2_P-A      caggggcctatattttcctgctggtggctccagttcaggaacactcaacc
JN604260_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KC875258_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggcacactcaacc
KC875255_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaactctcaacc
MN476102_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KX357643_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KX357642_PreS2_P-A      caggggcctgtattttcctgttggtggctccagttcaggaacactcaacc
KP168428_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY934771_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854700_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692588_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ194506_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
LC051141_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcagggacactcaacc
KJ854695_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
KF170754_PreS2_P-A      caggggcctgtattttcctgttggtggctccagttcaggaacactcaacc
FJ692565_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786660_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
FJ692591_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692564_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692590_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KP168432_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KP168430_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854690_PreS2_P-A      caggggcctgtattctcctgctggtggctccagttcaggaacactcaacc
FJ692566_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786651_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786647_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MF772353_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KX357650_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KX357645_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KU736920_PreS2_P-A      caggggcctgtattttcctgttggtggctccagttcaggaacactcaacc
KP718086_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854707_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854693_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY903452_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB241115_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KC875257_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
KC875251_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
KC875256_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
AB453987_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854687_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KP718085_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MF772351_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KM519452_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KM519453_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF922428_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN604145_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB937791_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB937796_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF922426_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF922427_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY934774_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
DQ020003_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
EU410082_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY233278_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JQ023663_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KP168433_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786662_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786645_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786657_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786658_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786643_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786646_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786648_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786649_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786652_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786654_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB116090_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MN585096_PreS2_P-A      cagaggcctgtattttcctgctggtggctccagttcaggaacactaaacc
EU859952_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ331047_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ331046_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ692558_PreS2_P-A      caggggcctrtatttccctgctggtggctccagttcaggaacactcaacc
KF779384_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN604193_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacactcaacc
KF214662_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
AY373432_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacactcaacc
KF214659_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB453986_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttccggaacactcaacc
AB116088_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KR905426_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KT366467_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KR905429_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
DQ315784_PreS2_P-A      cagggccctgaatcttcctgctggtggctccagttcaggaacactcaacc
AB116082_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB116085_PreS2_P-A      caggggcctgtatattcctgctggtggctccagttcaggaacactcaacc
KT151615_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacactcaacc
KR905427_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
KR905425_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KT366466_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF214666_PreS2_P-A      caggggcctgtattctcctgctggtggctccagttcaggaacactcaacc
AB116092_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB116089_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF214657_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
AY373429_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF214665_PreS2_P-A      caggggcctgtatgttcctgctggtggctccagttcaaaaacactcaacc
JN604252_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN604156_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacactcaacc
AB116087_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MF925372_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF214660_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacacacaacc
KF214661_PreS2_P-A      caggggcctgtatttccctgctggtggctccagttcaggaacactcaacc
AF090842_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB241114_PreS2_P-A      caggggcctgtattttcctgctggtggctccacttcaggaacagtcaacc
DQ315785_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
OK274310_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
M57663_PreS2_P-A        caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KT366471_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KR905430_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KR905431_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KT366468_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KT366470_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB246335_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF214663_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtgaacc
MF925361_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MT426088_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KT366469_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN604171_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN604261_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY233290_PreS2_P-A      caggggcctgtatttccctgctggtggctccagttcaggaatactcaacc
MF979149_PreS2_P-A      caggtrcctgaatcttcctgctggtggctccagtttaggaacacgcaacc
MH464817_PreS2_P-A      caggggcctgtccacagctgctggtggctccagttcaggaacactcaacc
MH464808_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464823_PreS2_P-A      caggggcctgtatyttcctgctggtggctccagttcaggaacactcaacc
KR139742_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
MH464809_PreS2_P-A      caggggcctgtatyttcctgctggtggctccagttcaggaacactcaacc
KF922420_PreS2_P-A      caggggcctgtatttccctgctggtggctccagttcaggaacactcaacc
KF922421_PreS2_P-A      caggggcctgtatttccctgctggtggctccagttcaggaacactcaacc
KF922414_PreS2_P-A      caggggcctgtatttccctgctggtggctccagttcaggaacactcaacc
KF922415_PreS2_P-A      caggggcctgtatttccctgctggtggctccagttcaggaacactcaacc
KF922416_PreS2_P-A      caggggcctgtatttccctgctggtggctccagttcaggaacactcaacc
KF922417_PreS2_P-A      caggggcctgtatttccctgctggtggctccagttcaggaacactcaacc
KF922418_PreS2_P-A      caggggcctgtatttccctgctggtggctccagttcaggaacactcaacc
KF922419_PreS2_P-A      caggggcctgtatttccctgctggtggctccagttcaggaacactcaacc
MT210032_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF476023_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF476022_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF476024_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF476025_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF476026_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaactctcaacc
KF476027_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KU605536_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KU605537_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KU605538_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KU605539_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
U87733_PreS2_P-A        caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
AF297621_PreS2_P-A      aaggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
U87727_PreS2_P-A        caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
U87728_PreS2_P-A        caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MF979153_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF922435_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF922436_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF922437_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MF979143_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB453989_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692561_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KR139744_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY233287_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF922429_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
KF922430_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
AY934772_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
FJ692576_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692562_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaaaaatactcaacc
MH464811_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN604241_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaagaacactcaacc
MF925368_PreS2_P-A      caggggcctgtgtcttcctgctggtggctccagttcaggaactctcaacc
KR139743_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
MF925400_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaactctcaacc
MH464820_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY233276_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY233279_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692572_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KJ854688_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692577_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
FJ692559_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
FJ692571_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
FJ692578_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692579_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692580_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692581_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692582_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692583_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692584_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692585_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692557_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692574_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FJ692563_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB076679_PreS2_P-A      caggggcatatatcttcctgctggtggctccagttcaggaacactcaacc
KF779332_PreS2_P-A      caggggcctgtactttcctgctggtggctccagttcaggaacagtcaacc
AB076687_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcagaaacactcaacc
U87736_PreS2_P-A        caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB076682_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB076685_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY233288_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB076681_PreS2_P-A      cagggacctgtgtcttcctgctggtggctccagttcaggaacactcaacc
JN182334_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
AB786661_PreS2_P-A      caggggtctgtattttcctgctggtggctccagttcaggaacactcaacc
AY934773_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AM494718_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN182333_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182332_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182331_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182328_PreS2_P-A      caggggcctgtactttcctgctggtggctccagttcaggaacattcaacc
JN182324_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182330_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182323_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182321_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182320_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182319_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182318_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182322_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182325_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182326_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182327_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
JN182329_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacattcaacc
AB076690_PreS2_P-A      caagggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB076689_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB076683_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB076686_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB076678_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB076688_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN604157_PreS2_P-A      caagggcctgtatttccctgctggtggctccagttcaggaacactcaacc
MK512462_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactccccc
FJ692587_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
FJ692592_PreS2_P-A      cagggccctgtattttcctgctggtggctccagttcaggaacgctcaacc
KF922433_PreS2_P-A      caggggcctgtatcgtcctgctggtggctccagttcaggaacacacaacc
KF922434_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacacacaacc
AY233275_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacacacaacc
AY233281_PreS2_P-A      caggggtctgtatcttcctgctggtggctccagttcaggaacacacaacc
AY233284_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacacacaacc
KT347087_PreS2_P-A      caggggcctgtattttcctgctggtgcctccagttcaggaacacacaacc
KP168427_PreS2_P-A      caggggcctgtactttcctgctggtggctccagttcaggaacactcaacc
KF476019_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
MK512455_PreS2_P-A      caggggcctgtattcccctgctggtggctccagttcaggaacactcaacc
MK512475_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF476020_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
MK512471_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
HM535205_PreS2_P-A      caggggcctgtattttccggctggtggctccagttcaggaacactcaacc
AB076680_PreS2_P-A      cagaggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KP168422_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
KJ010776_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
KJ010778_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
KJ010777_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
MK512457_PreS2_P-A      caggggcctgtattgtcctgctggtggctccagttcaggaacactcaacc
AF297625_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
U87734_PreS2_P-A        caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464825_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF476018_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KU605533_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KU605534_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AB786663_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MK512464_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KX357646_PreS2_P-A      caggggcctgtactttcctgctggtggctccagttcagggacactcaacc
KP168426_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FM199980_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FM199974_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MT426092_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF476016_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KT347091_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaatactcaacc
KT347092_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaatactcaacc
MK512466_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464812_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
GU563547_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY233289_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
AY233285_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaccactcaacc
AY233274_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY934766_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JN604169_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcagggacactcaacc
KF922409_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
KF922408_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
KF922406_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
KF922407_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
MT426091_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MK512468_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MK512465_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
FM199981_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FM199977_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY233282_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
JX154579_PreS2_P-A      caggggcctgaattttcctgctggtggctccagttcaggaacactcaacc
JX154580_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JX154581_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
JX154582_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KP168424_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KP168423_PreS2_P-A      caggggcctatattttcctgctggtggctccagttcaggaacactcaacc
AB786659_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KP168425_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MF979146_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464810_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464829_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464813_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464814_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464818_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464819_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464821_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464822_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464826_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464827_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464830_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464824_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
HM535200_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MF979151_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF476021_PreS2_P-A      aaggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF476017_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MF979144_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KX648548_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY233283_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KT347088_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KU605535_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464815_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MH464828_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MK512467_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KU736919_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
DQ020002_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KU736918_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MK512456_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
MK512474_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaaaaacactcaacc
FM199976_PreS2_P-A      caggggcctgtatcttcctgctggtggctccagttcaggaacactcaacc
FM199978_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
FM199979_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MK512460_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MK512473_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MK512472_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
GU563545_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
GU563548_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
MK512470_PreS2_P-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
                                         *    **    * *  *              **

JN604218_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgargactggg
JN604308_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctccgggaggactggg
AB937797_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcamtctccgcgaggactggg
JN604249_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604176_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
EU185786_PreS2_P-A      ctgctccgaatattgsctctcacatctcgtcwatctccgmgaggactggg
AY232837_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
DQ298161_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
AY230118_PreS2_P-A      ctgccccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
DQ298165_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
DQ298164_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
DQ298163_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
AY232836_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgtggactggg
AY232838_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgtggactggg
AY232839_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
AY232840_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
AY230117_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
DQ298162_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
GQ477477_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggg
GQ477474_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU185789_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactgkg
EU185787_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU185788_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604285_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AJ344115_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MF772348_PreS2_P-A      ctgctccgaatattgcctctcacatctcatcaatctccgcgaggactggg
JN604314_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604165_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604229_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604220_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MK568525_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MK568535_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MK568530_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MK568531_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AY934763_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
JX125364_PreS2_P-A      ctgctccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JF439821_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439931_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggg
JF439935_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggg
JF439919_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439923_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439921_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439912_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439915_PreS2_P-A      ctgctccgaatattgcctctcacctctcgtcaatctccgcgaggactggg
JF439914_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439927_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439925_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439924_PreS2_P-A      ctgctccgaatatcgcctctcacatctcgtcaatctccgcgaggactggg
JF439920_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439917_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439916_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439926_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439911_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439913_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439922_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439918_PreS2_P-A      ctgctccgaatattgcctctcacatctcgccaatctccgcgaggactggg
JF439936_PreS2_P-A      ctgctccgaacattgcctctcacatctcgtcaatctccgcgaggactggg
JF439942_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439933_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439938_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439939_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439937_PreS2_P-A      ctgctccgaatattgcccctcacatctcgtcaatctccgcgaggactggg
JF439941_PreS2_P-A      ctgctccgaatattgcccctcacatctcgtcaatctccgcgaggactggg
JF439930_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439932_PreS2_P-A      ctgctccgaacattgcctctcacatctcgtcaatctccgcgaggactggg
JF439929_PreS2_P-A      ctgctccgaacattgcctctcacatctcgtcaatctccgcgaggactggg
JF439928_PreS2_P-A      ctgctccgaacattgcctctcacatctcgtcaatctccgcgaggactggg
JF439934_PreS2_P-A      ctgctccgaacattgcctctcacatctcgtcaatctccgcgaggactggg
JF439940_PreS2_P-A      ctgctccgaacattgcctctcacatctcgtcaatctccgcgaggactggg
JF439823_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439819_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439827_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439824_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439832_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439826_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439820_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439830_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439828_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439822_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439825_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439829_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439831_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439852_PreS2_P-A      ctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggg
JF439843_PreS2_P-A      ctgctccgaatattgcttcccacatctcgtcaatctccgcgaggactggg
JF439867_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439846_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439855_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439850_PreS2_P-A      ctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439841_PreS2_P-A      ctgttccgaatattgcctcccacatctcgtcaatctccgcgaggactggg
JF439857_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439854_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439856_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439839_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439836_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439840_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439859_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggaccggg
JF439847_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439851_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439865_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439858_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439860_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439853_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439838_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439835_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439837_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439834_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439833_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439844_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439845_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439848_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707599_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707589_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707608_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707590_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707576_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707585_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707586_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707592_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707595_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707597_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707584_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707574_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707602_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707579_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707588_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707591_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707598_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707593_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707582_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707607_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707605_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggtctggg
JQ707600_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707596_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707577_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707594_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707601_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707604_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707587_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707580_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707606_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707581_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707603_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707583_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707575_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707578_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439842_PreS2_P-A      ctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707401_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439864_PreS2_P-A      ctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439868_PreS2_P-A      ctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439866_PreS2_P-A      ctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439849_PreS2_P-A      ctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439861_PreS2_P-A      ctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439862_PreS2_P-A      ctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439990_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439767_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439777_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439768_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439769_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439774_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF440020_PreS2_P-A      ctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggg
JQ707370_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707345_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggattggg
JQ707348_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707357_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707351_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707367_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707364_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707354_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707362_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707347_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707361_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707358_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707346_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707349_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707355_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707356_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707363_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707365_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707369_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707368_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707353_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707350_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707352_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707359_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707360_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707366_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439970_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439958_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707406_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707417_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707408_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707400_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707402_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707403_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707404_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707405_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707409_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707410_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707411_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707412_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707413_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707414_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707416_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707418_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707419_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707420_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707407_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707415_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
KT749834_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749839_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749846_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749847_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749849_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439993_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439992_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439991_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439982_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439979_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439976_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439975_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439961_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439952_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439949_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859934_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439966_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439971_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859955_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaagctccgcgaggactggg
EU859956_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaagctccgcgaggactggg
KP718089_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KM519454_PreS2_P-A      ctgctccgaatattccctctcacatctcgtcaatctccgcgaggactggg
JF439988_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439985_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439984_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439978_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439973_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439972_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439965_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439960_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439959_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439953_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439951_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859951_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JF439989_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439944_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439945_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439964_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707676_PreS2_P-A      ctgctccgaatattgcctttcacatctcgtcaatctccgcgaggactggg
JQ707663_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707653_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707651_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707647_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707644_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707640_PreS2_P-A      ctgctccgaatattgcctctcacacatcgtcaatctccgcgaggactggg
JQ707638_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707639_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707641_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707642_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707643_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707645_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707646_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707648_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707649_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707650_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707652_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707654_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707655_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707656_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JF439987_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439986_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439983_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439977_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439968_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439963_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439957_PreS2_P-A      ctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggg
JF439956_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439954_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439950_PreS2_P-A      ctgctccgaatattgcctcccacatctcgtcaatctccgcgaggactggg
JF439947_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439943_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GU563550_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439946_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439948_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439955_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439962_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439967_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439969_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439974_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439980_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697493_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AM295798_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AM295799_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AM410963_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859954_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707658_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707659_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707661_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707662_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707664_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707665_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707667_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707669_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707670_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707672_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707675_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707681_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707674_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604309_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707318_PreS2_P-A      gtgctccgaatattgcctctcacatctcgtcaatctccccgaggactggg
GQ477493_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggg
GQ477476_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477473_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MF772347_PreS2_P-A      ctgctccgaatattgcctctcacatctcatcaatctccgcgaggactggg
AJ627227_PreS2_P-A      ctgctccaaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439872_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439881_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439877_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439878_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439870_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439880_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439875_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439873_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439869_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439876_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439871_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439874_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439879_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439882_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439883_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749822_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JN604305_PreS2_P-A      ctgctccgaatattgcctctcacatctcgttaatctccgcgaggactggg
U87735_PreS2_P-A        ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MF772345_PreS2_P-A      ctgctccgaatattgcctctcacatctcatcaatctccgcgaggactggg
JN604183_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AF537372_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AY152726_PreS2_P-A      ctgctcagaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT151612_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT151617_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604302_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477502_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggg
AB205118_PreS2_P-A      ctgctccgaatattgcctctcacgtctcgtcaatctccgcgaggactggg
AY738142_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AY738140_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AY738141_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT151614_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477463_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477500_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
U87726_PreS2_P-A        ctgctccgaatattgcctctcacatgtgtccaatctccgcgaggaccggg
GQ477480_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggg
AY233286_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AF536524_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KX827297_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AF143302_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
DQ788728_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
AJ309369_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AJ309370_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AJ309371_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
X51970_PreS2_P-A        ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggaccggg
AF090838_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
MF772346_PreS2_P-A      ctgctccgaatattgcctctcacatctcatcaatctccgcgaggactggg
JN604209_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GU563551_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477494_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779320_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779321_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JX125368_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604290_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604236_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604227_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477464_PreS2_P-A      ctgctccgaatattgcatctcacatatcgtcaatctccgcgaggactggg
AF297622_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604298_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604190_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604179_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
GQ477495_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB116076_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604269_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477478_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477470_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AY034878_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MF772349_PreS2_P-A      ctgctccgaatattgcctctcacatctcatcaatctccgcgaggactggg
KJ586809_PreS2_P-A      ctgctccgaatattgcctctcacatctcctcaatctccgcgaggactggg
GQ477469_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AJ627226_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MF772344_PreS2_P-A      ctgctccgaatattgcctctcacatctcatcaatctccgcgaggactggg
KY382410_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
KF779298_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779293_PreS2_P-A      ttgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
HE576989_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477504_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB222707_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AY738139_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AY738143_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779272_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477501_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP995108_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779260_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477490_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779210_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779211_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KX827293_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707340_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ184324_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ184323_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
Z72478_PreS2_P-A        ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MF772350_PreS2_P-A      ctgctccgaatattgcctctcacatctcatcaatctccgcgaggactggg
KT749833_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaagctccgcgaggactggg
KF779264_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF476012_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475994_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475984_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KC875260_PreS2_P-A      ctgctccaaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707628_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707537_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604317_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604277_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604188_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604172_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
HE576988_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477497_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477472_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
GQ477462_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU747320_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AM282986_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AY707087_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AF143298_PreS2_P-A      ctgctccgactattgcctctcacatctcgtcaatctccgcgaggactggg
AB362931_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcaaggactggg
U87732_PreS2_P-A        ctgctccgaatattgcctctcacatctcgtcaatctccgcaaggactggg
JQ707398_PreS2_P-A      ctgctccgaatactgcctctcacatctcgtcaatctccgcgaggactggg
JN604266_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
GQ477488_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859950_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477475_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779295_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JX125367_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgtgacgactggg
AF537371_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AF090841_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707325_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477468_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
DQ788725_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JQ707319_PreS2_P-A      ctgctacgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604197_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749825_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749826_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749842_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
X70185_PreS2_P-A        ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
V00866_PreS2_P-A        ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MT426097_PreS2_P-A      ctgctccgaatattgcctctcacatatcgttaatctccgcgaggactggg
MN507849_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KY886219_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ843184_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ843172_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779324_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779261_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF476013_PreS2_P-A      ctgctccgaatattgcctctcacatctcgccaatctccgcgaggactggg
KF476006_PreS2_P-A      cagctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF476002_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475982_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707536_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707372_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604307_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604159_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439981_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477482_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477465_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859944_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859939_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU594386_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EF208113_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697511_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB480040_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB453984_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB453983_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcaaggactggg
JQ707335_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB014370_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707301_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707316_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707337_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779213_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779215_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604181_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
KF779370_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779283_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779268_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB549213_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779280_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779274_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779271_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779281_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779253_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AY862867_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AY862868_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604173_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779256_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779383_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctacgcgaggactggg
KF779282_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU594385_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779249_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779273_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779275_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779305_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779306_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779307_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779308_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779309_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779371_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707561_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707554_PreS2_P-A      ctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggg
JQ707545_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707531_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707538_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697506_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707543_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707569_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707571_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707540_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707533_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707542_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707535_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707539_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707305_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604274_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477499_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU594387_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB126580_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718100_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ843182_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ843186_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ843218_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ843217_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718088_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718090_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718091_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718094_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718095_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718096_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718097_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718098_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718099_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718101_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707309_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggg
JQ707323_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggg
JQ707303_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggg
JQ707312_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggg
KT749832_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859938_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707344_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707324_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707326_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
U87730_PreS2_P-A        ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
U87729_PreS2_P-A        ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MT426099_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MT426098_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KX827298_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718102_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718092_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779365_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779322_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
KF779319_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
KF779311_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779284_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779265_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779263_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779257_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
KF779252_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779232_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779231_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF476015_PreS2_P-A      ctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggg
KF476014_PreS2_P-A      ctgctccgaataatgcctctcacatctcgtcaatctccgcgaggactggg
KF476008_PreS2_P-A      ctgctccgagtattgcctctcacatctcgtcaatctccgcgaggactggg
KF476007_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475995_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475992_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JX096952_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
JQ707635_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707550_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707549_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707547_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707532_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707397_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707343_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707339_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707334_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707329_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707321_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ687533_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604288_PreS2_P-A      ctgctccgaatattgcctctcacatmtcgtcaatctccgcgaggactggg
JN604282_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779234_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604270_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604268_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
JN604214_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
GQ477498_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477491_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477487_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477484_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477479_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859947_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
EU859945_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859907_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859900_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
DQ131121_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AY233280_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB480036_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB263406_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB116077_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB064314_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779372_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779349_PreS2_P-A      ctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggg
KF779356_PreS2_P-A      ctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggg
KF779374_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707333_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707299_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707302_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707308_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707311_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707320_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707341_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707342_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
Z35717_PreS2_P-A        ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779316_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779254_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB453982_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB116081_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB300366_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB480039_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604276_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707306_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707317_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707313_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707300_PreS2_P-A      ctgctccgaatattgcctctcacatctcgttaatctccgcgaggactggg
JQ707314_PreS2_P-A      ctgctccgaatattgcctctcacatctcgttaatctccgcgaggactggg
JQ707330_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707331_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604242_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477466_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707615_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707627_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707633_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707636_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779221_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ843188_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KX827296_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779358_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779354_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779344_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779345_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779348_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779276_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779239_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779269_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707391_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707388_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707387_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707384_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707378_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707377_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707374_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707338_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707328_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707327_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707322_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707315_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707310_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707304_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604319_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604306_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604167_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604162_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AY902775_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604299_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707371_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707373_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707375_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707376_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707379_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707381_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707382_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707383_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707385_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707386_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707389_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707390_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707392_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707393_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707394_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707396_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707399_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779312_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779331_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779359_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779375_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KX827294_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KX827295_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604160_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707307_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779337_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779351_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779361_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779323_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439753_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439762_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604240_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
LC517161_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707564_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779291_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779290_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779294_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779286_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779287_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707572_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AF090839_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AF090840_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779335_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707395_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697492_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779277_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779328_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779330_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779342_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707559_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707553_PreS2_P-A      ctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggg
JQ707558_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707562_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU414133_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697488_PreS2_P-A      ctgctccgaatattgnctctcacatctcgtcaatctccgcgaggactggg
AB697489_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697501_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU086721_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU159676_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779240_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
LC311241_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
LC311242_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MH932713_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697512_PreS2_P-A      ctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggg
KM606746_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctgcgcgaggactggg
JQ707570_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JN604247_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaacctccgcgaggactggg
EU859940_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
EU859946_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
EU859948_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
EU859949_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
KT749829_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
KT749844_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
GQ414522_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JN604304_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
JX310721_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
KF779385_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
KM606742_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
KM606749_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
KF779381_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
KF779336_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779317_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779313_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779259_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779255_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccacgaggactggg
MT426094_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477496_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707332_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707336_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707380_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
X02763_PreS2_C-A        ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
U87725_PreS2_P-A        ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
OK106253_PreS2_P-A      ctgccccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
LC458431_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749838_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749835_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749831_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718087_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP274927_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggg
KJ843216_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779386_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
KF779379_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779367_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
KF779333_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779329_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779325_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779315_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779310_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779279_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779270_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
KF779266_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779262_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggg
KF779251_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggg
KF779238_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779246_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779247_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779248_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP718093_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF476010_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF476005_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF476003_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF476001_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF476000_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcggggactggg
KF475999_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475998_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475997_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475996_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475993_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475991_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475989_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475988_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475986_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475985_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475983_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JX310730_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
JX310723_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JX310722_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707634_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707616_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707614_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707573_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707563_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707557_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707556_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707552_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707551_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707560_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707548_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707541_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604300_PreS2_P-A      ctgctccgactattgcctctcacatctcgtcaatctccgcgaggactggg
JN604293_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
JN604257_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604216_PreS2_P-A      ctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggg
KU605532_PreS2_P-A      ctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggg
JN604194_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475987_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF475990_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF476004_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF476009_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF476011_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604185_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604180_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GU563557_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707544_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MT426096_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GU563553_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
GQ477503_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
JN604164_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
JN604200_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
JN604297_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
JN604315_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
JX096953_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
KF779326_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
KF779334_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
KF779346_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
KF779347_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
KF779352_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
KF779373_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggg
GQ477486_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859953_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859943_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859923_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859921_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU594393_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU594391_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU594384_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU594383_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AY128092_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AJ012207_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779304_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KY003230_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB937798_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB775199_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697487_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB480041_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB300367_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB116078_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477467_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604273_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604294_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779366_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB116079_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB116080_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB246337_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB246338_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB453979_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB453980_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB453981_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB480038_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697491_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697495_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697496_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697497_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697498_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697499_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697503_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697504_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697505_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697507_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697508_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB697509_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB775198_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB775200_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB775201_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB937792_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB937793_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB937794_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AF043580_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AF297624_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AM295795_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AM295797_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU414132_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU594388_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU594389_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU594390_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU594392_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU594394_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU594395_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859898_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859899_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859901_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859902_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859903_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859904_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859905_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859906_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859908_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859909_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859910_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859911_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859912_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859913_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859914_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859915_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859916_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859917_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859918_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859919_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859920_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859922_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859924_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859925_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859926_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859927_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859928_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859929_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859930_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859931_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859932_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859933_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859935_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859936_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859937_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859941_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
EU859942_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
FJ349224_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GQ477461_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GU563546_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GU563554_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GU563555_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GU563558_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
GU563562_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439752_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439754_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439755_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439756_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439757_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439758_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439759_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439760_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439761_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439763_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439764_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439765_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF439766_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604158_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604178_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604184_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604191_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604204_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604228_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604262_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604279_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604283_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604291_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604292_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JN604303_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ687529_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707534_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707546_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707555_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707565_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707566_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707567_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707568_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707609_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707610_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707611_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707612_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707613_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707617_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707618_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707619_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707620_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707621_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707622_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707623_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707624_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707625_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707626_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707629_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707630_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707631_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707632_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707637_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JX310724_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JX310725_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JX310731_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JX310732_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779227_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779243_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779244_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779245_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779258_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779297_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779299_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779314_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779338_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779339_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779350_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779355_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779360_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779362_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779363_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779364_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779368_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779369_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779378_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ843166_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ843173_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ843192_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ843214_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ843215_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ854708_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ854709_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KJ854710_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP274925_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KP274928_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749824_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749830_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749836_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749837_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749840_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749843_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KT749850_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
L13994_PreS2_P-A        ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
LC074724_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
LC311243_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
LC430617_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
LC458430_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
LC592168_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
LC592169_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
LC592170_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MT426093_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
MT426095_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
LT992448_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatcttctcgaggactggg
KF922431_PreS2_P-A      ctgttcagaatattgtctctcacatctcgtcaatctcctcgaggactggg
LT992441_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FN545837_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgargactggg
MN585097_PreS2_P-A      ctgctcagaatattgcctcgcacatctcgtcaatctccacgaggactggg
FN545830_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggg
FN545833_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggg
FN545834_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggg
MH580627_PreS2_P-A      ctgttccgaccactgcctctcacatctcatcaatctcctcgaggactggg
MH580639_PreS2_P-A      ctgttccgaccactgcctctcacatctcatcaatctcctcgaggactggg
MH580642_PreS2_P-A      ctgttccgaccactgcctctcacatctcatcaatctcctcgaggactggg
MH580643_PreS2_P-A      ctgttccgaccactgcctctcacatctcatcaatctcctcgaggactggg
FN545832_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggg
FN545829_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctccgcgaggactggg
FN545828_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggg
FN545835_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggg
KP168435_PreS2_P-A      ctgttcaaaatattgcctctcacatctcgtcaacctcctcgaggactggg
EU304331_PreS2_P-A      ctgttccmaatattgcctctcacatctcgtcaatctcctcgaggactggg
FN545838_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
JF439727_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439732_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439733_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439751_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439906_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439910_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439900_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439908_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439898_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439899_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439901_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439896_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439909_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439724_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439907_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439897_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439902_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439904_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439738_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439903_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439905_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439747_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439723_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439721_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439735_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439736_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439737_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439725_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439728_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439750_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439734_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439720_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439744_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439742_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439739_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439722_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439731_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439746_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439745_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439748_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439740_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439741_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439743_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439730_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439726_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
JF439729_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
MW567972_PreS2_P-A      ctgttccgaatactgcatctcacatctcgtcaatctcctcgacgactggg
AY934764_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
GQ161813_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
MW567976_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
MW567975_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
KM606737_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggg
MW567973_PreS2_P-A      ctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggg
AB194951_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggattggg
AB194952_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggattggg
MT622525_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggattggg
FJ692606_PreS2_P-A      ctgctccgaatattgcctctcacatatcgtcaatctcctcgaggactggg
FJ692613_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692603_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcmtcgaggactggg
MN544634_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FN545825_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
HM363613_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692554_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FN545836_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FN545831_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
LC462120_PreS2_P-A      ctgctccgactattgcctctcacatctcgtcaatctcctcgaagactggg
FJ692598_PreS2_P-A      ctgctccgaatattgcatctcacatctcgtcaatctcctcgaggactggg
FJ692593_PreS2_P-A      ctgctccgaatattgcctctcgcatctcgtcaatctcctcgaggactggg
HM363612_PreS2_P-A      ctgctcagaatattgcctctcacatctcgtcaatctcctcgaggactggg
JN604217_PreS2_P-A      ctgctccgaatattgcctcgcacatctcgtcaatctcctcgaggactggg
FJ692605_PreS2_P-A      ctgctccgaatattgcctctcacatcttgtcaatctcctcgaggactggg
FJ692599_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692608_PreS2_P-A      ctgctccgaatattgcctctcacacctcgtcaatctcctcgaggactggg
FJ692611_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692595_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692609_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692610_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692612_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692607_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692600_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692597_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692604_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692596_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692601_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692602_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
FN545826_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB194950_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
AM180624_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
AM184125_PreS2_P-A      ctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggg
AM184126_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
EU054331_PreS2_C-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
MT114170_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KX276769_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctccgcgaggactggg
MN758699_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ349296_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
EU366129_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JN604186_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
LT992440_PreS2_P-A      ctgctccgaatattgcctctcacatctcgtcaatctcctcgaggattggg
JQ023660_PreS2_P-A      ctgttccgaatattgcctctcacatatcatcaatctcctcgaggactggg
JQ023662_PreS2_P-A      ctgttccgaatattgcctctctcatatcatcaatctcctcgaggactggg
JN604163_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JN604155_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JN604150_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JN604128_PreS2_P-A      ctgttcccaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB937795_PreS2_P-A      ctgttccaaatattgcctctcacatctcatcaatctccttgaagactggg
KP168431_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JQ023661_PreS2_P-A      ctgttccaaatattgtctctcacatctcgtcaatctcctcgaggactggg
HM011485_PreS2_P-A      ctgttcccaatactgcctctcacatctcgtcaatctcctcgaggactggg
AB116083_PreS2_P-A      ctgttcccaatattgcctctcacatatcgtcaatctcctcgaggactggg
AB246336_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JN604251_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB116094_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MG877723_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MG877725_PreS2_P-A      ctgttccaaatattgcctctcacatcwcgtcaatctcctcgaggactggg
FJ692575_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
EF103278_PreS2_P-A      ctgttccaaatattgcctcgcacatctcgtcaatctcctcgaggactggg
MF925362_PreS2_P-A      ctgttccacatattgcctctcacatctcgtcaatctcctcgaggactggg
AB116091_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KX357649_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
KC875254_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB453988_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MN758701_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MK517517_PreS2_P-A      ctgttccgaatattgtctctcacatctcgtcaatctcctcgaggactggg
KJ854689_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KP168434_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854685_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854691_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854686_PreS2_P-A      ctgttccaaatattgcctcgcacatctcgtcaatctcctcgaggactggg
KJ843183_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854697_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JN604230_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854698_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MN758716_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MN053840_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854706_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854703_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854696_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854694_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MN758684_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MK517516_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MK517519_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AF043560_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854702_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854704_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854705_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854692_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854701_PreS2_P-A      ctgttcccaatattgcctctcacatctcgtcaatctcctcgaggactggg
MF925385_PreS2_P-A      ctgttccacatattgcctctcacatctcgtcaatctcctcgaggactggg
MF925407_PreS2_P-A      ctgttccacatattgcctctcacatctcgtcaatctcctcgaggactggg
AB116084_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692567_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854699_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786655_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786656_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MN476101_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB116093_PreS2_P-A      ctgttcccaatattgcctctcacatctcgtcaatctcctcgaggactggg
MF925373_PreS2_P-A      ctgttcccaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB116086_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
U87731_PreS2_P-A        ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY161138_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY161139_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
DQ315786_PreS2_P-A      ctgttcccaatattgcctctcacatatcgtcaatctcctcgaggactggg
KX357647_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
JN604237_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JN604136_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MH464816_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KF922424_PreS2_P-A      ctgttccaaatattgcctctcacatcttgtcaatctcctcgaggactggg
KF922425_PreS2_P-A      ctgttccaaatattgcctctcacatcttgtcaatctcctcgaggactggg
KC875259_PreS2_P-A      ctgttcccaatattgcctctcacatctcgtcaatctcctcgaggactggg
KC875252_PreS2_P-A      ctgttcccaatattgcctctcacatctcgtcaatctcctcgaggactggg
KC875253_PreS2_P-A      ctgttcccaatattgcctctcacatctcgtcaatctcctcgaggactggg
KP168429_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY373428_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY934770_PreS2_P-A      ctgttccaagtattgcctcgcacatctcgtcaatctcctcgaggactggg
AY934768_PreS2_P-A      ctgttccaaatattgcctcgcacatctcgtcaatctcctcgaggactggg
AY934767_PreS2_P-A      ctgttcccaatattgcctcgcacatctcgtcaatctcctcgaggactggg
AY934765_PreS2_P-A      ctgttccaaatattgcctcgcacatctcgtcaatctcctcgaggactggg
AY934769_PreS2_P-A      ctgttccaaatattgcctcgcacatctcgtcaatctcctcgaggactggg
KM606748_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggattggg
JN604260_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KC875258_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KC875255_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MN476102_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KX357643_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KX357642_PreS2_P-A      ctgttcaaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KP168428_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY934771_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854700_PreS2_P-A      ctgttccaaatattgtctctcacatctcgtcaatctcctcgaggactggg
FJ692588_PreS2_P-A      ctgttccaaatattgcctctcacaactcgtcaatctcctcgaggattggg
KJ194506_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
LC051141_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854695_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KF170754_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692565_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786660_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692591_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692564_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692590_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KP168432_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KP168430_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854690_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692566_PreS2_P-A      ctgttccacatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786651_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786647_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MF772353_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KX357650_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KX357645_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KU736920_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KP718086_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854707_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854693_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY903452_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB241115_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KC875257_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KC875251_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KC875256_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB453987_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854687_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KP718085_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MF772351_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KM519452_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KM519453_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KF922428_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JN604145_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB937791_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB937796_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KF922426_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KF922427_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY934774_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
DQ020003_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
EU410082_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY233278_PreS2_P-A      ctgttcaaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JQ023663_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KP168433_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786662_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786645_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatatcctcgaggactggg
AB786657_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786658_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786643_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786646_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786648_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786649_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786652_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786654_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB116090_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MN585096_PreS2_P-A      ctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggg
EU859952_PreS2_P-A      ctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggg
GQ331047_PreS2_P-A      ctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggg
GQ331046_PreS2_P-A      ctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692558_PreS2_P-A      ctgttccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF779384_PreS2_P-A      ctgttccaactattgcctctcacatatcgtcaatctcctggaggactggg
JN604193_PreS2_P-A      ctgttccaactattgcctctcacatatcgtcaatctcctcgaggattggg
KF214662_PreS2_P-A      ctgttccaactattgcctctcacatatcgtcaatctcctcgaagattggg
AY373432_PreS2_P-A      ctgttccaactattgcctctcacatatcgtcaatctcctcgaggattggg
KF214659_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatcttctcgaggattggg
AB453986_PreS2_P-A      ctgttccaactattgcctctcacatatcgtcaacctcctcgaggattggg
AB116088_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KR905426_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KT366467_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KR905429_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
DQ315784_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
AB116082_PreS2_P-A      ctgttccgactattgcctctcacatctcgtcaatctcctcgaggattggg
AB116085_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KT151615_PreS2_P-A      ctgctccaactattgcctctcacatctcgtcaatctcckcgaggattggg
KR905427_PreS2_P-A      ctgttccaactattgcctctcacatatcgtcaatctcctcgaggattggg
KR905425_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KT366466_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KF214666_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
AB116092_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
AB116089_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KF214657_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
AY373429_PreS2_P-A      ctgttccaactactgcctctcacatctcgtcaatctcctcgaggattggg
KF214665_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
JN604252_PreS2_P-A      ctgttccaactattgcatctcacatctcgtcaatctcatcgaggattggg
JN604156_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
AB116087_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggactggg
MF925372_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaacctcctcgaggattggg
KF214660_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KF214661_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
AF090842_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
AB241114_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
DQ315785_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
OK274310_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
M57663_PreS2_P-A        ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KT366471_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KR905430_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KR905431_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KT366468_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KT366470_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
AB246335_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KF214663_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
MF925361_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
MT426088_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KT366469_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
JN604171_PreS2_P-A      ctgttccaactattgcctctcacatatcgtcaatctcctcgaggattggg
JN604261_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
AY233290_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgacgactggg
MF979149_PreS2_P-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgacgactggg
MH464817_PreS2_P-A      ctgttccaaatattgcctctcacatatcgtcaatctcctcgacgactggg
MH464808_PreS2_P-A      ctgttccaaatattgcatctcacatmtcgtcaatctcctcgaggactggg
MH464823_PreS2_P-A      ctgttccaaatattgcatctcacatctcgtcaatctcctcgaggactggg
KR139742_PreS2_P-A      ctgttccaaatattgcatctcacatctcgtcaatctcctcgaggactggg
MH464809_PreS2_P-A      ctgttccaaatattgcatctcacatctcgtcaatctcctcgaggactggg
KF922420_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgacgactggg
KF922421_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgacgactggg
KF922414_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgacgactggg
KF922415_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgacgactggg
KF922416_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgacgactggg
KF922417_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgacgactggg
KF922418_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgacgactggg
KF922419_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgacgactggg
MT210032_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgacgactggg
KF476023_PreS2_P-A      ctgttccaaatattgtctctcacatctcgtcaatctcctcgacgactggg
KF476022_PreS2_P-A      ctgttccaaatattgtctctcacatctcgtcaatctcctcgacgactggg
KF476024_PreS2_P-A      ctgttccaaatattgtctctcacatctcgtcaatctcctcgacgactggg
KF476025_PreS2_P-A      ctgttccaaatattgtctctcacatctcgtcaatctcctcgacgactggg
KF476026_PreS2_P-A      ctgttccaaatattgtctctcacatctcgtcaatctcctcgacgactggg
KF476027_PreS2_P-A      ctgttccaaatattgtctctcacatctcgtcaatctcctcgacgactggg
KU605536_PreS2_P-A      ctgttccaaatattgtctctcacatctcgtcaatctcctcgacgactggg
KU605537_PreS2_P-A      ctgttccaaatattgtctctcacatctcgtcaatctcctcgacgactggg
KU605538_PreS2_P-A      ctgttccaaatattgtctctcacatctcgtcaatctcctcgacgactggg
KU605539_PreS2_P-A      ctgttccaaatattgtctctcacatctcgtcaatctcctcgacgactggg
U87733_PreS2_P-A        ctgttccaaatattgcctctcacatctcgtcaatctcctcgacgactggg
AF297621_PreS2_P-A      ctgttccaaatattgcctctctcatctcgtcaatctcctcgacgactggg
U87727_PreS2_P-A        ctgttccaaatattgcctctcatatctcgtcaatctcctcgacgactggg
U87728_PreS2_P-A        ctgttccaaatattgcctctcacatctcgtcaatctcctcgacgactggg
MF979153_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgacgactggg
KF922435_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgacgactggg
KF922436_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgacgactggg
KF922437_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgacgactggg
MF979143_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgacgactggg
AB453989_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692561_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KR139744_PreS2_P-A      ctgttccaaatattgcatctcacatctcgtcaatctcctcgaggactggg
AY233287_PreS2_P-A      ctgttccaaatattgcatctcacatctcgtcaatctcctcgaggattggg
KF922429_PreS2_P-A      ctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggg
KF922430_PreS2_P-A      ctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY934772_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692576_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692562_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MH464811_PreS2_P-A      ctgttccaaatattgcatctcacatmtcgtcaatmtcctcgaggactggg
JN604241_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MF925368_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KR139743_PreS2_P-A      ctgttccaaatattgcatctcacatctcgtcaatctcctcgaggactggg
MF925400_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MH464820_PreS2_P-A      ctgttccaaatattgcatctcacatctcgtcaatctcctcgaggactggg
AY233276_PreS2_P-A      ctgttccaaatattgcatctcacatctcgtcaatctcctcgaggactggg
AY233279_PreS2_P-A      ctgttccaaatattgcatctcacatctcgtcaatctcctcgaggactggg
FJ692572_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ854688_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692577_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692559_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692571_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692578_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692579_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692580_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692581_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692582_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692583_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692584_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692585_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692557_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692574_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692563_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB076679_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KF779332_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB076687_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
U87736_PreS2_P-A        ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB076682_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
AB076685_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY233288_PreS2_P-A      ctgttccaaatattgcctttcacatctcgtcaatctcctcgaggattggg
AB076681_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JN182334_PreS2_P-A      ctgttccaaacattgcctctcacatctcgtcaacctcctcgaggactggg
AB786661_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
AY934773_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AM494718_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JN182333_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182332_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182331_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182328_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182324_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182330_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182323_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182321_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182320_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182319_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182318_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182322_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182325_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182326_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182327_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN182329_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
AB076690_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
AB076689_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
AB076683_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
AB076686_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
AB076678_PreS2_P-A      ctgttccaaatattgcctcgcacatctcgtcaacctcctcgaggactggg
AB076688_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
JN604157_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MK512462_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggg
FJ692587_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FJ692592_PreS2_P-A      ctgttccmaatattgcctctcacatctcgtcaatctcctcgaggactggg
KF922433_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaagactggg
KF922434_PreS2_P-A      ctgttcccaatattgcctctcacatctcgtcaatctcctcgaagactggg
AY233275_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaagactggg
AY233281_PreS2_P-A      ctgttccaaatattgcctctcacatctcgccaatctcctcgaagactggg
AY233284_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaagactggg
KT347087_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaagactggg
KP168427_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KF476019_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MK512455_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MK512475_PreS2_P-A      ctgttctcaatattgcctctcacatctcgtcaatctcctcgaggactggg
KF476020_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MK512471_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
HM535205_PreS2_P-A      ctgttccaaatactgcctctcacatctcggcaatctcctcgaggactggg
AB076680_PreS2_P-A      ctgttccaaatactgtctctcacatctcgtcaatctcctcgaggactggg
KP168422_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KJ010776_PreS2_P-A      ctgttcagaatattgtatctcacatctcgtcaatctcctcgaggactggg
KJ010778_PreS2_P-A      ctgttcagaatattgtatctcacatctcgtcaatctcctcgaggactggg
KJ010777_PreS2_P-A      ctgttcagaatattgtatctcacatctcgtcaatctcctcgaggactggg
MK512457_PreS2_P-A      ctgttccaaatattgcctctcacatcttgtcaatctcctcgaggactggg
AF297625_PreS2_P-A      ctgttcccaatactgcctctcacatctcgtcaatctcctcgaggactggg
U87734_PreS2_P-A        ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MH464825_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
KF476018_PreS2_P-A      ctgctccaaatactgcctctcacatctcgtcaatctcctcgaagactggg
KU605533_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaagactggg
KU605534_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaagactggg
AB786663_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MK512464_PreS2_P-A      ctgttccaaatattgcctctcacatatcgtcaatctcctcgaggactggg
KX357646_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KP168426_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FM199980_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FM199974_PreS2_P-A      ctgttccaaatattgcctctcacatatcgtcaatctcctcgaggactggg
MT426092_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KF476016_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctccgcgaggactggg
KT347091_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
KT347092_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MK512466_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MH464812_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
GU563547_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY233289_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
AY233285_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
AY233274_PreS2_P-A      ctgttccaaatactgcctctcacatctcgccaatctcctcgaggactggg
AY934766_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JN604169_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KF922409_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
KF922408_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
KF922406_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
KF922407_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MT426091_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MK512468_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MK512465_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
FM199981_PreS2_P-A      ctgttccaaatattgcctctcacatatcgtcaatctcctcgaggactggg
FM199977_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY233282_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
JX154579_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JX154580_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JX154581_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
JX154582_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KP168424_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KP168423_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AB786659_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KP168425_PreS2_P-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MF979146_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MH464810_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MH464829_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MH464813_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MH464814_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MH464818_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MH464819_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MH464821_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MH464822_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MH464826_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MH464827_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MH464830_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MH464824_PreS2_P-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
HM535200_PreS2_P-A      ctgttccaaatattgcctct