Dataset for nucleotide sequence PreC of genotype A

[Download (right click)] [Edit] [Sequences] [Repertoires]

1273 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

AB697487_PreC_P-A      atgcaactttttcacctctgccta---atcatctcwtgtwcatgtccyac
AB697498_PreC_P-A      atgcaactttttcacctctgccta---atcatctcktgtwcatgtccyac
EU414132_PreC_P-A      nnnnnnnnnnnnnnnnnnnnnnnn---ntcatctyttgtacatgtcccmc
KP857066_PreC_P-A      atgcaactttttcacctctgccta---gtcatctcttgtacatgtcccac
KM606662_PreC_P-A      atgcaactttttcacctctgccta---gtcatctcttgttcatgtcctac
AY230113_PreC_P-A      -------tttttcacctctgccta---atcatctcttgttcatgtcctac
DQ298162_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY236169_PreC_P-A      -------tttttcacctcggccta---atcatctcttgttcatgttctac
AY236165_PreC_P-A      -------tttttcacctctaccta---atcatctcttgttcatgtcctac
AY236168_PreC_P-A      -------tttttcacctctgccta---atcatctcttgttcatgtcctac
DQ298163_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY236167_PreC_P-A      -------tttttcacctctgccta---atcatctcttgttcatgtcctac
DQ298165_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
AY230111_PreC_P-A      -------tttttcacctctgccta---atcacctcttgttcatgtcctac
DQ298161_PreC_P-A      atgcaactttttcacctctgccta---atcacctcttgttcatgtcctac
AY236166_PreC_P-A      -------tttttcacctctgccta---atcatctcttgttcatgtcctac
DQ298164_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857089_PreC_P-A      atgcaactttttcccctctgccta---atcatctcttgttcatgtcctac
AJ627227_PreC_P-A      atgcaactttttcacctctgccta---rtcatctcttgtacatgtcctac
KP857068_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
KM606671_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
GQ477473_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KP857079_PreC_P-A      atgccactttttcacctctgccta---atcatctcttgttcatgtcccac
KP857087_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
KP857075_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KP857072_PreC_P-A      atgcaactttttcacctctgccta---ttcacctcttgtacatgtcccac
KP857088_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtctcac
KP857078_PreC_P-A      ttgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KP857067_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
GQ477462_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KP857070_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KP857071_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KP857091_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857076_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KP857074_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857064_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KP857073_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477474_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749822_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KP857081_PreC_P-A      atgtaactttttcacctctgccta---atcatctcttgttcatgtcccac
GQ477480_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
AB937797_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857060_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY034878_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AJ627228_PreC_P-A      atgcaactttttcacctctgccta---gtcatctcttgtacatgtcccac
GQ477477_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
GQ477475_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477502_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY603432_PreC_P-A      atgcaactttttcacctctgccta---atcatctcgtgttcatgtcctac
GQ477493_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857086_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KM606695_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF090838_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
GQ477499_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477469_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AJ627226_PreC_P-A      atgcaactttttcacctctgccta---gtcatctcttgtacatgtcccac
KP857085_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
KP857082_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
KM606693_PreC_P-A      atgcaactttttcacctctgccta---gtcatctcttgtacatgtcctac
KM606657_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
GQ477476_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AJ344115_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF419536_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477504_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477491_PreC_P-A      acgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU414049_PreC_P-A      atgyaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857077_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
GQ477501_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857083_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ477500_PreC_P-A      atacaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857059_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477497_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477487_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU414052_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU414133_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707328_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
EU414050_PreC_P-A      acgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU414048_PreC_P-A      ctgcaactttttcacctctgccta---atcacctcttgtacatgtcccac
JQ707368_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707346_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KX827295_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX827296_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX827294_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707388_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707369_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707365_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcaagtcccac
JQ707363_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707360_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707359_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707356_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707352_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707351_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707347_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707345_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707325_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707353_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707361_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707349_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707350_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707355_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707358_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707367_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707348_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707354_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707357_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707362_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707364_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707366_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707370_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707314_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707321_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707322_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707337_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707300_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707339_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707332_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707324_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707315_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707312_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707303_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707323_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707299_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707319_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707341_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707338_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatttcccac
JQ707336_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707335_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707334_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707331_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707329_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707327_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707318_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707313_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707308_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707305_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707310_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707311_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707330_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707343_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707301_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707306_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707317_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707326_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707344_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707302_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707304_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707307_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707309_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707316_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707320_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707333_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707340_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707342_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707384_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707419_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707415_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707414_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707404_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707401_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707396_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707395_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707392_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707387_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707386_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707382_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707377_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707407_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707408_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707371_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707372_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707373_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707374_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707375_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707376_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707378_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707379_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707380_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707381_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707383_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707385_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707389_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707390_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707391_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707393_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707394_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707397_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707398_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707399_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707400_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707402_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707403_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707405_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707406_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707409_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707410_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707411_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707412_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707413_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707416_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707417_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707418_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707420_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
AY902775_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477488_PreC_P-A      acgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718092_PreC_P-A      atgcaactttttcacctctgccta---atcatytyttgtacatgtcccac
GU827640_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477494_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
GQ477472_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857084_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
KP857069_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB453982_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718102_PreC_P-A      atgcaactttttcacctctgccta---atcatcttttgttcatgtcccac
KC875260_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU185776_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacgtgtcccac
EU185777_PreC_P-A      atgcaactttttcacctctgccta---atcatctyttgtacgtgtcccac
AB453983_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
KM606659_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
KP857092_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477470_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477466_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF537372_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477482_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KP995108_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KT749833_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
GU563551_PreC_P-A      atgtaactttttcacctctgccta---atcatctcttgttcatgtcccac
GQ477478_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606661_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477498_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477484_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718090_PreC_P-A      atgcaactttttcacctytgccta---atcatctyttgtacatgtcccmc
KM606650_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KP718095_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718089_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718100_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718096_PreC_P-A      atgcaactttttcacctctgcata---atcatctcttgtacatgtcccac
KP718091_PreC_P-A      atgcaactttttcacctytgccta---atcatctcttgtacatgtcccac
KP718101_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718094_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JX096953_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718088_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718097_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718098_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718099_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477503_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JX096952_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KC836858_PreC_P-A      atgcaactttttcacctctgccta---atcatctcatgttcatgtcctac
X02763_PreC_C-A        atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707577_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707595_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707596_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707605_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707600_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707582_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707594_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707607_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707598_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KT749834_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707551_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697495_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707655_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707578_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707576_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707563_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707602_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707593_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707590_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707580_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707581_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707603_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707574_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707575_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707579_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707583_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707584_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707585_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707586_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707587_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707588_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707589_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707591_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707597_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707599_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707604_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707606_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707608_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707592_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707565_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707550_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707539_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707534_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB775198_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707559_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707560_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707561_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707562_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707564_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707566_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707567_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707568_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707569_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707570_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707571_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707572_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707573_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707601_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
AB697493_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB775199_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB775200_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB775201_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB937792_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB937793_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB937794_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707531_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707532_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707533_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707535_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707536_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707537_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707538_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707540_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707541_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707542_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707543_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707544_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707545_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707546_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707547_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707548_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707549_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707552_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707553_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707554_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707556_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707557_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707558_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LC430617_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LC458430_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LC458431_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LC592168_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LC592169_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LC592170_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707555_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707634_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707623_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707620_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707612_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707609_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707610_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707611_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707613_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707614_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707616_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707617_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707618_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707619_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707621_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707622_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707624_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707625_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707626_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707627_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707628_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707629_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707630_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707631_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707632_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707637_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
GQ477467_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707635_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707615_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707633_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707636_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707638_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707639_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707640_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707641_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707642_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707643_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707644_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707645_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707646_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707647_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707648_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707649_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707650_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707651_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707652_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707653_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707654_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
JQ707656_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
EF208113_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
AJ309370_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AJ309369_PreC_P-A      atgcaactttttcacctctgccaa---atcatctcttgtacatgtcccac
AJ309371_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477490_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477465_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY152726_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
AB116076_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857061_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606653_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477486_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU185786_PreC_P-A      atgcaactttttcacctctgccta---atcatctcwtgtacatgtccyac
EU185774_PreC_P-A      atgcaactttttcacctctgccta---atcatctctcgtgcgtgtcccac
KP857080_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT448620_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AJ012207_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
X51970_PreC_P-A        atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF090841_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JF440016_PreC_P-A      ------ctttttcacctctgccta---atcatctcttgtacatgtcccac
EU185775_PreC_P-A      ctgcaactttttcacctctsccta---atcatctcttgtacgtgtcccac
EU859938_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
AF419534_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF419535_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857062_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KM606658_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ586809_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB126580_PreC_P-A      atgcaactttttcacctctgccta---atcatctctcgtacatgtcctac
KT749832_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX827297_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477468_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606688_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477495_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843172_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477463_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749836_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857058_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606742_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606692_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854709_PreC_P-A      nnnnnnctttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477496_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859934_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
DQ788725_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233286_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697488_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB362931_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB222707_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116078_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857063_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU185787_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttstrcatgtcccac
EU185789_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU185765_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
L13994_PreC_P-A        atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477479_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY738140_PreC_P-A      aygcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY738141_PreC_P-A      aygcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY738139_PreC_P-A      aygcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY738143_PreC_P-A      aygcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY738142_PreC_P-A      aygcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY603431_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY603438_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY603446_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY603430_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY603435_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY603436_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY603429_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854708_PreC_P-A      atgcaactttttcacctctgccta---atcayctcttgtacatgtcccac
EU594384_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU594386_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT448623_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
OK106253_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT426097_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT426096_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT426095_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX827298_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX827293_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749831_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606676_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843188_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843182_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707662_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ687533_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GU563557_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GU563550_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ414522_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859944_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859939_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF537371_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB064314_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AM282986_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY707087_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
V00866_PreC_P-A        atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ222208_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU747320_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ707658_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ707659_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ707661_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ707663_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ707664_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ707667_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ707669_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ707670_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ707672_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ707674_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ707675_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ707676_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ707681_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
JQ707665_PreC_P-A      atgcaactttttcacctctgccta---atcatctcctgttcatgtcccac
KC836834_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP274928_PreC_P-A      atgcaactttttcacctctgccta---atgatgtcttgtacatgtcccac
MT448622_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT448626_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
X70185_PreC_P-A        atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT426098_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MN507849_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LC311242_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749844_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749843_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749839_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749838_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749829_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749824_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718093_PreC_P-A      atgcaacttttacacctctgccta---atcatctcttgtacatgtcccac
KP718087_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP274925_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606672_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606656_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843217_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843184_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KC836831_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GU563558_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ184324_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ349222_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859919_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859912_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859898_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU594388_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU594387_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU185746_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY862868_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY862867_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY603441_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AM295796_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF536524_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF090840_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697511_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697491_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB205118_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116081_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB014370_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116077_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ687529_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606694_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606749_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606663_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606669_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606652_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749850_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843166_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843173_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843215_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
HE576988_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
Z35717_PreC_P-A        atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859956_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843218_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LC074724_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LC311241_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LC311243_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606677_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606678_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606680_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606674_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606684_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606685_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606691_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843192_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843214_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843216_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ184323_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
HE576989_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KY382410_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859942_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP274927_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749825_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749826_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749842_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749846_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749847_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749849_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859899_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859900_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859901_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859902_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859903_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859904_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859905_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859906_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859907_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859908_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859909_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859910_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859911_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859913_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859915_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859916_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859917_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859920_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859921_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859922_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859923_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859924_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859925_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859926_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859927_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859928_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749837_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU594394_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU594395_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AM295795_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AM295797_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AM410963_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU594383_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT426094_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT426099_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF090839_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU594389_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU594390_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU594391_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU594392_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859945_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859950_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854710_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM519454_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606648_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB480040_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KY886219_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB480036_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606665_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606666_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116079_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116080_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB300367_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB453979_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB453980_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB453984_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB480038_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB480041_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697489_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697496_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697497_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697499_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697501_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697503_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697504_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697505_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697508_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697509_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697512_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB937798_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY161138_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY161139_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LC517161_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH932713_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
X07911_PreC_P-A        atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859935_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859936_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB246337_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB246338_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB300366_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB453981_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB480039_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB549213_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697492_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697506_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB697507_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF043580_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF297624_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY128092_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233280_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU086721_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU185750_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU594385_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU594393_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859914_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859918_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859929_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859930_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859931_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859932_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859933_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859937_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859940_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859941_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859943_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859946_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859947_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859948_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859949_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859951_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859953_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859954_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859955_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ349224_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ477461_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GU563546_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GU563553_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GU563554_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GU563555_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GU563562_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KC836832_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KC836849_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KC836854_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843186_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606683_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606687_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606700_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606746_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749830_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749835_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT749840_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605516_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605517_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605532_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KY003230_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT426093_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
Z72478_PreC_P-A        atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FN545837_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
MN585097_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
FN545826_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692555_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FN545832_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692597_PreC_P-A      ctgcaactttttcacctytgccta---atcatctyttgtacatgtcccac
FN545828_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
FN545839_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FN545829_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FN545835_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FN545830_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FN545840_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF536820_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536814_PreC_P-A      atgcaactctttcacctctgccta---ttcatctcttgtacatgtcccac
MN544634_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF536810_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgttcatgtcccac
MF536811_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgttcatgtcccac
MF536815_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
FN545825_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB194952_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB194951_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT622525_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF536846_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536823_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536827_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536836_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536821_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536819_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536867_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536869_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536824_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536828_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536833_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536837_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536843_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536845_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536848_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536849_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536816_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536853_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536857_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536808_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536831_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536817_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536861_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536862_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536807_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536830_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536852_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536865_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536868_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536809_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536832_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536859_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536860_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536825_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536839_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536841_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536842_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536818_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536854_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536855_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536858_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536813_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536822_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536826_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536835_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536840_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536844_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536850_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536847_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536812_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536806_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536829_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536838_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536851_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536856_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536863_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536864_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
MF536866_PreC_P-A      atgcaactttttcacctctgccta---ttcatctcttgtacatgtcccac
FJ349296_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
HM042263_PreC_P-A      atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctac
FJ904411_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
MF772345_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AM180624_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FN545838_PreC_P-A      ttgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ904434_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LT992448_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FJ692609_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
FJ692610_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
AF350081_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692607_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692600_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY934764_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ161813_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB194950_PreC_P-A      ttgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MW567976_PreC_P-A      aggcaactttttcacctctgccta---atcatctcttgttcatgtcccac
FJ692599_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LT992440_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
LT992441_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF772348_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
FJ692595_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FN545833_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FN545834_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692593_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350087_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350088_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH580639_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH580642_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH580643_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH580627_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692598_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF772347_PreC_P-A      atgtaactttttcacctctgccta---atcatctcttgttcatgtcccac
MF772346_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
GQ477464_PreC_P-A      ttgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF772344_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606660_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF772350_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857090_PreC_P-A      atgtaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692611_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
AF350083_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350086_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350084_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350085_PreC_P-A      atgcagctttttcacctctgccta---atcatctcttgtacatgtcccac
AF350089_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MW567975_PreC_P-A      -------tttttcacctctgccta---atcatctcttgtacatgtcccac
KM606737_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350094_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350090_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350096_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350093_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350092_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350082_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350095_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350080_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350091_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350097_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF350098_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AM184125_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AM184126_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU054331_PreC_C-A      atgcaactttttcacctctgccta---atcatttcttgtacatgtcccac
FJ692596_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY934763_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FN545831_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692554_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FN545836_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LC462120_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692613_PreC_P-A      ttgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692602_PreC_P-A      acgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692604_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692603_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692605_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692612_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692606_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692608_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692601_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU304331_PreC_P-A      attcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MG877723_PreC_P-A      attcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MG877724_PreC_P-A      attcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MG877725_PreC_P-A      attcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116084_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT114170_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtctcac
EU366129_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX357650_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MN585096_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT210034_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692561_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ331046_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692586_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GU563547_PreC_P-A      ttgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF925362_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168428_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854701_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY161143_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgttccac
AY161144_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgttccac
AY161142_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgttccac
KM606649_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX276769_PreC_P-A      ctgcaactttttcacctctgccta---atcayctcttgtacatgtcccac
AB116092_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB453989_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX357649_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF925368_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX357640_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EF103278_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF214666_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP857065_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116086_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692576_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692564_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692565_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF925400_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT151612_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT151617_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU859952_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GQ331047_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854685_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692558_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116088_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692567_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KR905427_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168431_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606647_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB453986_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116091_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116082_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF214660_PreC_P-A      atgcaactttttcacctctgccta---atcagctcttgtacatgtcccac
KX357644_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692562_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692577_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF214662_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
HM011485_PreC_P-A      atgtaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168429_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692570_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692559_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116083_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KJ194506_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
FJ692572_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF214661_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB246336_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
DQ315785_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116087_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116089_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168433_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168432_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MN476101_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168430_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MN476102_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ023663_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ023662_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ023660_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JQ023661_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116090_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY903452_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF925373_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606748_PreC_P-A      atgcaactttttcacctctgccta---atcatctaatgtacatgtaccac
FJ868007_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854686_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KC875257_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692575_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116093_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ868002_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY934771_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU736920_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854700_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF772353_PreC_P-A      atgcaactttttcacctctgccta---atcatcttttgtacatgtcccac
KJ854690_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX686607_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM606673_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854698_PreC_P-A      nnnnnnctttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854694_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
DQ020003_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854707_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF772351_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854687_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854693_PreC_P-A      nnnnnnctttttcacctctgccta---atcatctcttgtacatgtcccac
KC836846_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718085_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP718086_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854699_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF925372_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT151615_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854691_PreC_P-A      atgcaactttttcacctctgccta---atcnnctcttgtacatgtcccac
KF798265_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KR905425_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT366466_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
DQ315786_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF925361_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX357645_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT151614_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT151611_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854706_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798292_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KC875259_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY934765_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116085_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798267_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KR905426_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT366467_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692588_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692566_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF214658_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY373429_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY934767_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY934770_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY934768_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY934769_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ867986_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ867985_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ867994_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KC875253_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
KM519452_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM519453_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KM243029_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854704_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854688_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798310_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798271_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KR905429_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798266_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF214659_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KC875251_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF925385_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB116094_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB937795_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MF925407_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MZ093431_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KC875256_PreC_P-A      acgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
AB453987_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB453988_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854703_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX357647_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX357642_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX357643_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ868008_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ867995_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ867961_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ867962_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ867960_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798286_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT366469_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
OK274310_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT426088_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
M74501_PreC_P-A        atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LK995385_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854702_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798291_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF214657_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KC875255_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KC875254_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcctac
KC875252_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
EU410082_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY934774_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY373428_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF090842_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ843183_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854697_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922426_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922427_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922428_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922424_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922425_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
LC051141_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233278_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB937791_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692590_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692591_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB937796_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692571_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692563_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF043560_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854705_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692557_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692574_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692578_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692579_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692580_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692581_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692582_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692583_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692584_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692585_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB241115_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT448625_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT448634_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT448635_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT448636_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854689_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854692_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ854696_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MN053840_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT448633_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT448637_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT448624_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
M57663_PreC_P-A        atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KR905431_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798279_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798289_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KR905430_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT366470_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798285_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798311_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT366468_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ867959_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ867958_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ867946_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ867948_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ867949_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT151618_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT151616_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798314_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798302_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798290_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798278_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF214663_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KC875258_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
DQ315784_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB241114_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB246335_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT151613_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY373432_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ867947_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF214665_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798309_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF798308_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT366471_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH464809_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtctcac
MH464808_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922421_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922417_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922416_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922420_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922414_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922415_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922418_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922419_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233279_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233276_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233287_PreC_P-A      atgcaactttttcacctctgccta---atcatcacttgtacatgtcccac
AY233290_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF297621_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF922433_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF922434_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF922435_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF922436_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH464817_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF297622_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT210032_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605536_PreC_P-A      ---caaatttttcacctctgccta---atcatctcttgtacatgtcccac
KU605537_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605538_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605539_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB076679_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH464811_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922429_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922431_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922430_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692573_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB246317_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
KF922437_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
FM199974_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FJ692587_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168422_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtccyac
FJ692592_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168426_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT731865_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH464825_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512455_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FM199977_PreC_P-A      ttgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512464_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT731929_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FM199976_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcycac
FM199975_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168427_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX357646_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512461_PreC_P-A      ttgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512475_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FM199981_PreC_P-A      atgcaactttttcacctctsccta---atcatctcttgtacatgtcccac
MK512462_PreC_P-A      aagcaactttttcacctctgccta---atcatctcttgttcatgtcccac
AF297623_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512465_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233284_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT347087_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233275_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233281_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512471_PreC_P-A      ttgcaactttttcacctctgccta---atcatctcttgttcatgtcccac
MK512463_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AF297625_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT426092_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512476_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JN182334_PreC_P-A      atgcaacttttnnnnnnnnnnnnn---nnnnnnncttgtacatgtcccac
JN182319_PreC_P-A      atgcaactttttnnnnnnnnnnnn---nnnnnnnnnnnnncatgtcccac
JN182327_PreC_P-A      atgcaacttttnnnnnnnnnnnnn---nnnnnnnnnnnnnnatgtcccac
MK512458_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatctcccac
KX648549_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JN182332_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JN182328_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JN182325_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JN182320_PreC_P-A      nnnnnnnnnnnnnncctctgccta---atcatctcttgtacatgtcccac
JN182331_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JN182329_PreC_P-A      nnnnnnctttttcacctctgccta---atcatctcttgtacatgtcccac
JN182323_PreC_P-A      nnnnnnctttttcacctctgccta---atcatctcttgtacatgtcccac
JN182318_PreC_P-A      atnnnnctttttcacctctgccta---atcatctcttgtacatgtcccac
JN182322_PreC_P-A      nnnnnnctttttcacctctgccta---atcatctcttgtacatgtcccac
JN182321_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JN182324_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JN182330_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JN182333_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AM494718_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AB076678_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY934773_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512477_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512456_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JX154580_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JX154581_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JX154582_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
JX154579_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH464812_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY934766_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512467_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT426090_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MT426091_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512474_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512469_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512460_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168435_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY934772_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168424_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168425_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512466_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GU563545_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512472_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512459_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
DQ020002_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FM199978_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512468_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU736918_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU736919_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168423_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FM199980_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512457_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
FM199979_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
GU563548_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512470_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MK512473_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233288_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX648547_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KP168434_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
HM535205_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233282_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605533_PreC_P-A      atgcaaatttttcacctctgcata---atcatctcttattcatgtcccac
MH464814_PreC_P-A      ctgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605519_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605518_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605534_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KX648548_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KF922409_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF922407_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF922406_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
KF922408_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgttcatgtcctac
MH464810_PreC_P-A      akgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH464813_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH464818_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH464830_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
HM535200_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233285_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233274_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH464815_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KT347088_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233289_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
AY233283_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605535_PreC_P-A      -tgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ010776_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ010777_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KJ010778_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605520_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605521_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
KU605522_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
MH464828_PreC_P-A      atgcaactttttcacctctgccta---atcatctcttgtacatgtcccac
                                                                   *    *

AB697487_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697498_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttgggrcatggacattg
EU414132_PreC_P-A      tgttcaagcctycaarctgtgccttgggtggctttggggcatggacattg
KP857066_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606662_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY230113_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ298162_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY236169_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY236165_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY236168_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ298163_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY236167_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ298165_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY230111_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ298161_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY236166_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacgttg
DQ298164_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacgttg
KP857089_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
AJ627227_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857068_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606671_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ477473_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857079_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857087_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857075_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KP857072_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857088_PreC_P-A      tgttcaagcctccaagctgtgccttaggtggctttgaggcatggacattg
KP857078_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857067_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
GQ477462_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857070_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KP857071_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KP857091_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857076_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857074_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857064_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KP857073_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477474_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749822_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP857081_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477480_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
AB937797_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857060_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY034878_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AJ627228_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477477_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ477475_PreC_P-A      tgttcaagcctccaagctgtgccttaggtggctttggggcatggacattg
GQ477502_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603432_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
GQ477493_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857086_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM606695_PreC_P-A      tgttcaagcctacaagctgtgccttgggtggctttggggcatggacattg
AF090838_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ477499_PreC_P-A      tgttcaagcctcctagctgtgccttrggtggctttggggcatggacattg
GQ477469_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AJ627226_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857085_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP857082_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM606693_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KM606657_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ477476_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AJ344115_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AF419536_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477504_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477491_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
EU414049_PreC_P-A      tgttcaagcctccwagctgtgccttgggtggctttggggcatggacattg
KP857077_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477501_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857083_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ477500_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857059_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477497_PreC_P-A      tgttcaagcctccaagctgtgccttaggtggctttggggcatggacattg
GQ477487_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414052_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414133_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707328_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414050_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU414048_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707368_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707346_PreC_P-A      tgttcaagcctccaagttgtgccttgggtggctttggggcatggacattg
KX827295_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX827296_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX827294_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707388_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707369_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707365_PreC_P-A      ggttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707363_PreC_P-A      tgttccagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707360_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707359_PreC_P-A      tgttcaagccttcaagctgtgccttgggtggctttggggcatggacattg
JQ707356_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707352_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707351_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707347_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707345_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707325_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707353_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707361_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707349_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707350_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707355_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707358_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707367_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707348_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707354_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707357_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707362_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707364_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707366_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707370_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707314_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707321_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707322_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707337_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707300_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707339_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707332_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707324_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707315_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707312_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707303_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707323_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707299_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707319_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707341_PreC_P-A      tgttcaagccttcaagctgtgccttgggtggctttggggcatggacattg
JQ707338_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707336_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707335_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707334_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707331_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707329_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707327_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707318_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707313_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707308_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707305_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707310_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707311_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707330_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707343_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707301_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707306_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707317_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707326_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707344_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707302_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707304_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707307_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707309_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707316_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707320_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707333_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707340_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707342_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707384_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707419_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707415_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707414_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707404_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707401_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707396_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707395_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707392_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707387_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707386_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707382_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707377_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707407_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707408_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707371_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707372_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707373_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707374_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707375_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707376_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707378_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707379_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707380_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707381_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707383_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707385_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707389_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707390_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707391_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707393_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707394_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707397_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707398_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707399_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707400_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707402_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707403_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707405_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707406_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707409_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707410_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707411_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707412_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707413_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707416_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707417_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707418_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707420_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY902775_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477488_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718092_PreC_P-A      tgttcaagcctycaagctgtgccttgggtggctttggggcatggacattg
GU827640_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477494_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ477472_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857084_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857069_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB453982_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718102_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC875260_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU185776_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU185777_PreC_P-A      tgttcaagcctccaagctgtgccktgggtggctttggggcatggacattg
AB453983_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM606659_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP857092_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477470_PreC_P-A      tgttcaagcctcctagctgtgccttgggtggctttggggcatggacattg
GQ477466_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF537372_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477482_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP995108_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749833_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU563551_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
GQ477478_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606661_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
GQ477498_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477484_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718090_PreC_P-A      tgttcmagcctycaagctgtgccttgggtggctttggggcatggacattg
KM606650_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718095_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718089_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718100_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718096_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718091_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718101_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718094_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX096953_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718088_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718097_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718098_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718099_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477503_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX096952_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836858_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X02763_PreC_C-A        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707577_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707595_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707596_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707605_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707600_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707582_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707594_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707607_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707598_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749834_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707551_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697495_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707655_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707578_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707576_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatgaacattg
JQ707563_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707602_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707593_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707590_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707580_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707581_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707603_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707574_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707575_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707579_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707583_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707584_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707585_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707586_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707587_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707588_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707589_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707591_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707597_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707599_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707604_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707606_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707608_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707592_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707565_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707550_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707539_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707534_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB775198_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707559_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707560_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707561_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707562_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707564_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707566_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707567_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707568_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707569_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707570_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707571_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707572_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707573_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707601_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697493_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB775199_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB775200_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB775201_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB937792_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB937793_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB937794_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707531_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707532_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707533_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707535_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707536_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707537_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707538_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707540_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707541_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707542_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707543_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707544_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707545_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707546_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707547_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707548_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707549_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707552_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707553_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707554_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707556_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707557_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707558_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC430617_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC458430_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC458431_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC592168_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC592169_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC592170_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707555_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707634_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707623_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707620_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707612_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707609_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707610_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707611_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707613_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707614_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707616_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707617_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707618_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707619_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707621_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707622_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707624_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707625_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707626_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707627_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707628_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707629_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707630_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707631_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707632_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707637_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477467_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707635_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707615_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707633_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707636_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707638_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707639_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707640_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707641_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707642_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707643_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707644_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707645_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707646_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707647_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707648_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707649_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707650_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707651_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707652_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707653_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707654_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707656_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EF208113_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AJ309370_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AJ309369_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AJ309371_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477490_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477465_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY152726_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AB116076_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857061_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606653_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477486_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU185786_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU185774_PreC_P-A      tgttsaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857080_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT448620_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AJ012207_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X51970_PreC_P-A        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF090841_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF440016_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU185775_PreC_P-A      tgttggagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859938_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF419534_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF419535_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857062_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KM606658_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ586809_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB126580_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749832_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX827297_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477468_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606688_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477495_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ843172_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477463_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749836_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857058_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606742_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606692_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ854709_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477496_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859934_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ788725_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY233286_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697488_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB362931_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB222707_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB116078_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857063_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU185787_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU185789_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU185765_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
L13994_PreC_P-A        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477479_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY738140_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY738141_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY738139_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY738143_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY738142_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603431_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603438_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603446_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603430_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603435_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603436_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY603429_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ854708_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594384_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594386_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT448623_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
OK106253_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT426097_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT426096_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT426095_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX827298_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX827293_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749831_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606676_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ843188_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ843182_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707662_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ687533_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU563557_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU563550_PreC_P-A      tgttcaagcctccaagctgtgccttgggtgggtttggggcatggacattg
GQ414522_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859944_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859939_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF537371_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB064314_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AM282986_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY707087_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
V00866_PreC_P-A        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ222208_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU747320_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707658_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707659_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707661_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707663_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707664_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707667_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707669_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707670_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707672_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707674_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707675_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707676_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707681_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ707665_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836834_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP274928_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT448622_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT448626_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X70185_PreC_P-A        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT426098_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MN507849_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC311242_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749844_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749843_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749839_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749838_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749829_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749824_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718093_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP718087_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP274925_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606672_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606656_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ843217_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ843184_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836831_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU563558_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ184324_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ349222_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859919_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859912_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859898_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594388_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594387_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU185746_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY862868_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY862867_PreC_P-A      tgttcaagcctccaagctgtgccctgggtggctttggggcatggacattg
AY603441_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AM295796_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF536524_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF090840_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AB697511_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697491_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB205118_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB116081_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB014370_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB116077_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ687529_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606694_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606749_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606663_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606669_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606652_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749850_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ843166_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ843173_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ843215_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HE576988_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
Z35717_PreC_P-A        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859956_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ843218_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC074724_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC311241_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC311243_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606677_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606678_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606680_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606674_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606684_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606685_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606691_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ843192_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ843214_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ843216_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ184323_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HE576989_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY382410_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859942_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP274927_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749825_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749826_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749842_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749846_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749847_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749849_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859899_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859900_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859901_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859902_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859903_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859904_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859905_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859906_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859907_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859908_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859909_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859910_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859911_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859913_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859915_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859916_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859917_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859920_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859921_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859922_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859923_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859924_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859925_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859926_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859927_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859928_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749837_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594394_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594395_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AM295795_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AM295797_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AM410963_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594383_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT426094_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT426099_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF090839_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594389_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594390_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594391_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594392_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859945_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859950_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ854710_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM519454_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606648_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB480040_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY886219_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB480036_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606665_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606666_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB116079_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB116080_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB300367_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB453979_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB453980_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB453984_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB480038_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB480041_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697489_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697496_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697497_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697499_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697501_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697503_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697504_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697505_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697508_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697509_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697512_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB937798_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY161138_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY161139_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC517161_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH932713_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X07911_PreC_P-A        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859935_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859936_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB246337_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB246338_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB300366_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB453981_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB480039_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB549213_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697492_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697506_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB697507_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF043580_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF297624_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY128092_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY233280_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU086721_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU185750_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594385_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU594393_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859914_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859918_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859929_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859930_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859931_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859932_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859933_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859937_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859940_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859941_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859943_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859946_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859947_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859948_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859949_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859951_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859953_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859954_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU859955_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ349224_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477461_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU563546_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU563553_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU563554_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU563555_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU563562_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836832_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836849_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836854_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ843186_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606683_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606687_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606700_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606746_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749830_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749835_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749840_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU605516_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU605517_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU605532_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY003230_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT426093_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
Z72478_PreC_P-A        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FN545837_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MN585097_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FN545826_PreC_P-A      tyttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
FJ692555_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
FN545832_PreC_P-A      ttttcaagcctccaagctgtgccttggvtggctttggggcatggacattg
FJ692597_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacatyg
FN545828_PreC_P-A      tcttcaagcctccaagctgtgccttgggkggctttggggcatggacattg
FN545839_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FN545829_PreC_P-A      tyttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FN545835_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FN545830_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FN545840_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MF536820_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
MF536814_PreC_P-A      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MN544634_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536810_PreC_P-A      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536811_PreC_P-A      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536815_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FN545825_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB194952_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB194951_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT622525_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536846_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536823_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536827_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536836_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536821_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536819_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536867_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536869_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536824_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536828_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536833_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536837_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536843_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536845_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536848_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536849_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536816_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536853_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF536857_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF536808_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536831_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536817_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536861_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536862_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536807_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536830_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536852_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF536865_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF536868_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF536809_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536832_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536859_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536860_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536825_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536839_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536841_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536842_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536818_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536854_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF536855_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF536858_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF536813_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536822_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536826_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536835_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536840_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536844_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536850_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536847_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536812_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536806_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536829_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536838_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF536851_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF536856_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF536863_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF536864_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF536866_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ349296_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HM042263_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ904411_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MF772345_PreC_P-A      tattcaagcctcctagctgtgccttaggtggctttgggacatggacattg
AM180624_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FN545838_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ904434_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LT992448_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692609_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ692610_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF350081_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692607_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692600_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggayattg
AY934764_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ161813_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB194950_PreC_P-A      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MW567976_PreC_P-A      tcttcaagcctccaagctgtgccttggttggctttgggacatggacattg
FJ692599_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LT992440_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LT992441_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF772348_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
FJ692595_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FN545833_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FN545834_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
FJ692593_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF350087_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF350088_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH580639_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MH580642_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MH580643_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MH580627_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692598_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF772347_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MF772346_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ477464_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF772344_PreC_P-A      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606660_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF772350_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP857090_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692611_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF350083_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350086_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350084_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350085_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350089_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MW567975_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM606737_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF350094_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350090_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350096_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350093_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350092_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350082_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350095_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350080_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350091_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350097_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF350098_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AM184125_PreC_P-A      tattcaagcctccaaactgtgccttgggtggctttggggcatggacattg
AM184126_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU054331_PreC_C-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692596_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY934763_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FN545831_PreC_P-A      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692554_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FN545836_PreC_P-A      ttttcaagcctccaarctgtgccttgggtggctttggggcatggacattg
LC462120_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692613_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692602_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692604_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692603_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692605_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692612_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692606_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692608_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692601_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
EU304331_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG877723_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacatyg
MG877724_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacatyg
MG877725_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacatyg
AB116084_PreC_P-A      ttttcaagcctccaagctgtgccttggctggctttggggcatggacattg
MT114170_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
EU366129_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KX357650_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MN585096_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT210034_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacatng
FJ692561_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
GQ331046_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692586_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU563547_PreC_P-A      tgttcaagcctccaagctgtgccttggttggctttggggcatggacattg
MF925362_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP168428_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ854701_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY161143_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY161144_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY161142_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KM606649_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KX276769_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB116092_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB453989_PreC_P-A      ttttcaagcctccaagctgtgccttggttggctttggggcatggacattg
KX357649_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF925368_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX357640_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EF103278_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF214666_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KP857065_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB116086_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692576_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
FJ692564_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692565_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MF925400_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KT151612_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KT151617_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
EU859952_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ331047_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ854685_PreC_P-A      ttttcaagcctccaagctgtgccttggctggctttggggcatggccattg
FJ692558_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB116088_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692567_PreC_P-A      ttttcaagcctccaagctgtgccttggrtggctttggggcatggacattg
KR905427_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP168431_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KM606647_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB453986_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB116091_PreC_P-A      ttttcaagcctccaagctgtgccttggttggctttggggcatggacattg
AB116082_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacatcg
KF214660_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacatcg
KX357644_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692562_PreC_P-A      tattcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692577_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF214662_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
HM011485_PreC_P-A      ttttcaagcctccaagctgtgccttggctggctttggggcatggacatcg
KP168429_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692570_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692559_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB116083_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KJ194506_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692572_PreC_P-A      ttttcaagcctccaagctgtgccttggttggctttggggcatggacattg
KF214661_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB246336_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
DQ315785_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttgggacatggacattg
AB116087_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB116089_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP168433_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP168432_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MN476101_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP168430_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MN476102_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JQ023663_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JQ023662_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JQ023660_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JQ023661_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB116090_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY903452_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MF925373_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KM606748_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ868007_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttaggacatggacattg
KJ854686_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KC875257_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692575_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB116093_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ868002_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY934771_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KU736920_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854700_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MF772353_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854690_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KX686607_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KM606673_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854698_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854694_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
DQ020003_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854707_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MF772351_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854687_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854693_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KC836846_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP718085_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP718086_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854699_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MF925372_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT151615_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854691_PreC_P-A      ttttcaagcctccaagctgtgccttggttggctttggggcatggacattg
KF798265_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KR905425_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KT366466_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
DQ315786_PreC_P-A      tgttcaagcctccaagctgtgccttggttggctttggggcatggacattg
MF925361_PreC_P-A      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX357645_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KT151614_PreC_P-A      tkttcaagcctccaagctgtgccttggrtggctttggggcatggacattg
KT151611_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854706_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798292_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KC875259_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY934765_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB116085_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798267_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KR905426_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KT366467_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692588_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692566_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF214658_PreC_P-A      ttttcaagcctcccagctgtgccttggatggctttggggcatggacattg
AY373429_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY934767_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY934770_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY934768_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY934769_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ867986_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttgggacatggacattg
FJ867985_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ867994_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KC875253_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacgttg
KM519452_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KM519453_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KM243029_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854704_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854688_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798310_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798271_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KR905429_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798266_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF214659_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KC875251_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MF925385_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB116094_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB937795_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MF925407_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MZ093431_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KC875256_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB453987_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB453988_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854703_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggactttg
KX357647_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KX357642_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KX357643_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ868008_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ867995_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ867961_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ867962_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttaggacatggacattg
FJ867960_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttgggacatggacattg
KF798286_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KT366469_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
OK274310_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MT426088_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
M74501_PreC_P-A        ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
LK995385_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854702_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798291_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF214657_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KC875255_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KC875254_PreC_P-A      tttttaagcctccaagctgtgccttggatggctttggggcatggacattg
KC875252_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
EU410082_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY934774_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY373428_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF090842_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ843183_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854697_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF922426_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF922427_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF922428_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF922424_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF922425_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
LC051141_PreC_P-A      ttttcaagcctccaagctgtgccttggttggctttggggcatggacattg
AY233278_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB937791_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692590_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692591_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB937796_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692571_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692563_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF043560_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854705_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692557_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692574_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692578_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692579_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692580_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692581_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692582_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692583_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692584_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692585_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB241115_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MT448625_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MT448634_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MT448635_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MT448636_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854689_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854692_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ854696_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MN053840_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MT448633_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MT448637_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MT448624_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
M57663_PreC_P-A        ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KR905431_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798279_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798289_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KR905430_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KT366470_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798285_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798311_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KT366468_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ867959_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttagggcatggacattg
FJ867958_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ867946_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ867948_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ867949_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KT151618_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KT151616_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798314_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798302_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798290_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798278_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF214663_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KC875258_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
DQ315784_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB241114_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB246335_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KT151613_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY373432_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ867947_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF214665_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798309_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF798308_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KT366471_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MH464809_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttgaggcatggacattg
MH464808_PreC_P-A      tgttcaagcctccaagctgtgccttggmtggctttggggcatggacattg
KF922421_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF922417_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF922416_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF922420_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF922414_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF922415_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF922418_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF922419_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY233279_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY233276_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY233287_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttgggacatggacattg
AY233290_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF297621_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KF922433_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KF922434_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KF922435_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KF922436_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MH464817_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF297622_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT210032_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KU605536_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KU605537_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KU605538_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KU605539_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB076679_PreC_P-A      tattcaagcctccaagctgtgccttggctggctttggggcatggacattg
MH464811_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF922429_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF922431_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF922430_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ692573_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB246317_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF922437_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
FM199974_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FJ692587_PreC_P-A      tcttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP168422_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttagggcatggacatcg
FJ692592_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP168426_PreC_P-A      tgttcaagcctccaagctgtgccttggktggctttggggcatggacattg
MT731865_PreC_P-A      tgttcaagcctccaagctgtgccttggrtggctttggggcatggacattg
MH464825_PreC_P-A      tgttcaagcctccaagctgtgccttggttggctttggggcatggacattg
MK512455_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacatcg
FM199977_PreC_P-A      tgttcaagcctccaagctgtgccttggttggctttggggcatggacattg
MK512464_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT731929_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FM199976_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttgrggcatggacattg
FM199975_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP168427_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX357646_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512461_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK512475_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FM199981_PreC_P-A      tgttcaagcctcctagctgtgccttggrtggctttggggcatggacattg
MK512462_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AF297623_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK512465_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY233284_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT347087_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY233275_PreC_P-A      tgttcaagcctccaagctgtgccttggctggctttggggcatggacattg
AY233281_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512471_PreC_P-A      tcttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK512463_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AF297625_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MT426092_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK512476_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN182334_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182319_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182327_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512458_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacatcg
KX648549_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182332_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182328_PreC_P-A      tgttcaagcctccaagctgtgccctggatggctttggggcatggacattg
JN182325_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182320_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182331_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182329_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182323_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182318_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182322_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182321_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182324_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182330_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JN182333_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AM494718_PreC_P-A      tattcaagcctccaagctgtgccttggatggctttggggcatggacattg
AB076678_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY934773_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512477_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttgggacatggacattg
MK512456_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JX154580_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JX154581_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JX154582_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
JX154579_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MH464812_PreC_P-A      tgttcaagcctccwagctgtgccttggatggctttggggcatggacattg
AY934766_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512467_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MT426090_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MT426091_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512474_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512469_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512460_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP168435_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY934772_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP168424_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP168425_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512466_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
GU563545_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512472_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512459_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ020002_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FM199978_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512468_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KU736918_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KU736919_PreC_P-A      ttttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP168423_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FM199980_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512457_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
FM199979_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
GU563548_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MK512470_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttgggacatggacattg
MK512473_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY233288_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KX648547_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KP168434_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
HM535205_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY233282_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KU605533_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacatcg
MH464814_PreC_P-A      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU605519_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacatcg
KU605518_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacatcg
KU605534_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacatcg
KX648548_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF922409_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF922407_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF922406_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KF922408_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MH464810_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MH464813_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MH464818_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MH464830_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
HM535200_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY233285_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY233274_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MH464815_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KT347088_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY233289_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
AY233283_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KU605535_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ010776_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ010777_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KJ010778_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KU605520_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KU605521_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
KU605522_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
MH464828_PreC_P-A      tgttcaagcctccaagctgtgccttggatggctttggggcatggacattg
                         **  ***** * *  ****** * *  ** ***  * ****    * *

AB697487_PreC_P-A      acccktataaagaatttggagctwctgtggagttactctcktttttgcct
AB697498_PreC_P-A      acccktataaagaatttggagctwctgtggagttactctcktttttgcct
EU414132_PreC_P-A      acccttataaagaatttggagstactgkggagktactctcgtttttkcct
KP857066_PreC_P-A      acccttataaagaatttggcgcttctgttgagttactctcgtttttgcct
KM606662_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcttttttgcct
AY230113_PreC_P-A      acacttataaagaatttggagctactgtggagttgctctcttttttgcct
DQ298162_PreC_P-A      acacttataaagaatttggagctactgtggagttgctctcttttttgcct
AY236169_PreC_P-A      acacttataaagaatttggagctactgtggagttgctctcttttttgcct
AY236165_PreC_P-A      acacttataaagaatttggagctactgtggagttgctctcttttttgcct
AY236168_PreC_P-A      acacttataaagaatttggagctactgtggagttgctctcttttttgcct
DQ298163_PreC_P-A      acacttataaagaatttggagctactgtggagttgctctcttttttgcct
AY236167_PreC_P-A      acacttataaagaatttggagctactgtggagttgctctcttttttgcct
DQ298165_PreC_P-A      acacttataaagaatttggagctactgtggagttgctctcttttttgcct
AY230111_PreC_P-A      acacttataaagaatttggagctactgtggagttgctctcttttttgcct
DQ298161_PreC_P-A      acacttataaagaatttggagctactgtggagttgctctcttttttgcct
AY236166_PreC_P-A      acacttataaagaatttggcgctactgtggagttgctctcttttttgcct
DQ298164_PreC_P-A      acacttataaagaatttggcgctactgtggagttgctctcttttttgcct
KP857089_PreC_P-A      acccttataaagaatttggagctactacggaattactctcgtttttgcct
AJ627227_PreC_P-A      acctttataaagaatttggagctagtgtggagttactctcgtttttgcct
KP857068_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KM606671_PreC_P-A      acccttataaagaatttggcgcttctgtggagttactctcgtttttacct
GQ477473_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857079_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857087_PreC_P-A      acctgtataaagaatttggagctactgtggagttactctcttttttgcct
KP857075_PreC_P-A      acccgtataaagagtttggagctagtgtggagttactctcgtttttgcct
KP857072_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857088_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857078_PreC_P-A      acccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857067_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477462_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857070_PreC_P-A      acccttataaagaatttggagcgtctgtggagttactctcgtttttgcct
KP857071_PreC_P-A      acccttataaagaatttggagcgtctgtggagttactctcatttttgcct
KP857091_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857076_PreC_P-A      acccgtataaagaatttggagcttctgtggagttactctcctttttgcct
KP857074_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
KP857064_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857073_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477474_PreC_P-A      acccttataaagaatttggagcttctgtggagttaatctcgtttttgcct
KT749822_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857081_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477480_PreC_P-A      acccttataaagaatttggagcttctacggagttactctcgtttttgcct
AB937797_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857060_PreC_P-A      acccttataaagaatttggagctaccgtggagttactctcgtttttgccg
AY034878_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AJ627228_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477477_PreC_P-A      acccttataaagaatttggagcttctgcgagcttactctcgtttttgcct
GQ477475_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcatttttgcct
GQ477502_PreC_P-A      acccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603432_PreC_P-A      acccttataaagaatttggcgctactgtggagttactctcgtttttgcct
GQ477493_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857086_PreC_P-A      acccttataaagaatttggcgcttctgcgcagttgctctcgtttttgcct
KM606695_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF090838_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477499_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477469_PreC_P-A      acccttataaagaatttggagctactgctgagttactctcatttttgcct
AJ627226_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
KP857085_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857082_PreC_P-A      acccttataaagaatttggcgccactgtggagttactctcttttttgcct
KM606693_PreC_P-A      acccttataaagaatttggcgctactgtggagttactctcttttttgcct
KM606657_PreC_P-A      acccttataaagaatttggagctaccgcggagttactctcgtttttgcct
GQ477476_PreC_P-A      acccttataaagaatttggcgctactgctgagttactctcgtttttgcct
AJ344115_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF419536_PreC_P-A      acccttataaagaatttggagctagtgtggagttactctcgtttttgcct
GQ477504_PreC_P-A      acccttataaagagtttggagctactgtggagttactctcgtttttgcct
GQ477491_PreC_P-A      acccttataaagaatttggagcttctgtggacttactctcttttttgcct
EU414049_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcktttttgcct
KP857077_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477501_PreC_P-A      acccttataaagaatttggagctacagtggagttactctcgtttttgcct
KP857083_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcttttttgcct
GQ477500_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857059_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcatttttgcct
GQ477497_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477487_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU414052_PreC_P-A      acccttataaagaatttggagctaccgtggagttactctcgtttttgcct
EU414133_PreC_P-A      acccttataaagaatttggagctaccgtggagttactctcgtttttgcct
JQ707328_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU414050_PreC_P-A      acccttataaagaatttggagctactgtggagctactctcgtttttgcct
EU414048_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JQ707368_PreC_P-A      acccttctaaagaatttggagctactgtggagttactctcgtttctgcct
JQ707346_PreC_P-A      acccttataaagaatttggagctactgtggagttactttcgtttttgcct
KX827295_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX827296_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX827294_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707388_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707369_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcctttttgccc
JQ707365_PreC_P-A      acccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707363_PreC_P-A      acccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707360_PreC_P-A      acccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707359_PreC_P-A      acccttataaagaatttggagctaccgtggagttactctcgtttttgcct
JQ707356_PreC_P-A      acccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707352_PreC_P-A      acccttataaagaatttggagccactgtggagttactctcgtttttgcct
JQ707351_PreC_P-A      acccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707347_PreC_P-A      acccttataaagaatttggagctaccgtggagttactctcgtttttgcct
JQ707345_PreC_P-A      acccttataaagaatttggagctactgtggagttagtctcgtttttgcct
JQ707325_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707353_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcatttttgcct
JQ707361_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcatttttgcct
JQ707349_PreC_P-A      acccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707350_PreC_P-A      acccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707355_PreC_P-A      acccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707358_PreC_P-A      acccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707367_PreC_P-A      acccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707348_PreC_P-A      acccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707354_PreC_P-A      acccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707357_PreC_P-A      acccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707362_PreC_P-A      acccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707364_PreC_P-A      acccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707366_PreC_P-A      acccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707370_PreC_P-A      acccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707314_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707321_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707322_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707337_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707300_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707339_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707332_PreC_P-A      acccttataaagaattcggagctactgtggagttactctcgtttttgcct
JQ707324_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707315_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707312_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707303_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707323_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707299_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707319_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707341_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707338_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707336_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707335_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707334_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707331_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707329_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707327_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707318_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707313_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707308_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707305_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707310_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707311_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707330_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707343_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707301_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707306_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707317_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707326_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707344_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707302_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707304_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707307_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707309_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707316_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707320_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707333_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707340_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707342_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707384_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707419_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707415_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707414_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707404_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707401_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707396_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707395_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707392_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707387_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707386_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttacct
JQ707382_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707377_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707407_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707408_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707371_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707372_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707373_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707374_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707375_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707376_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707378_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707379_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707380_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707381_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707383_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707385_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707389_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707390_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707391_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707393_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707394_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707397_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707398_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707399_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707400_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707402_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707403_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707405_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707406_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707409_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707410_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707411_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707412_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707413_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707416_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707417_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707418_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707420_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY902775_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477488_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcttttttgcct
KP718092_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU827640_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477494_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477472_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857084_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857069_PreC_P-A      acccttataaagaatttggagcttctgtggaattactctcgtttttgcct
AB453982_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP718102_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875260_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185776_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185777_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB453983_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KM606659_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857092_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477470_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477466_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF537372_PreC_P-A      acccttataaagagtttggagctactgtggagttactctcgtttttgcct
GQ477482_PreC_P-A      accattataaagaatttggagctactgtggagttactctcgtttttgcct
KP995108_PreC_P-A      acacttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749833_PreC_P-A      acacttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563551_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcttttttgcct
GQ477478_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttacct
KM606661_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477498_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477484_PreC_P-A      acccttataaagaatttggagctactgtggaattactctcgtttttgcct
KP718090_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606650_PreC_P-A      acctttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718095_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718089_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718100_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718096_PreC_P-A      acccttataaagaatttggagctactgtggagttactatcatttttgcct
KP718091_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718101_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718094_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX096953_PreC_P-A      acccttataaagaatttggagctactgtggagttaccctcgtttttgcct
KP718088_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718097_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718098_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718099_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477503_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX096952_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC836858_PreC_P-A      acccgtataaagaatttggagcttctgtggagttactctcttttttgcct
X02763_PreC_C-A        acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707577_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707595_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707596_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707605_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707600_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707582_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707594_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707607_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707598_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
KT749834_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707551_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697495_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707655_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgccg
JQ707578_PreC_P-A      acccttataaagaatttggagctactgcggagttactcttgtttttgcct
JQ707576_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707563_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707602_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707593_PreC_P-A      acccttataaagaatttggagctactgcggagttactcgcgtttttgcct
JQ707590_PreC_P-A      acccttataaagaatttggcgctactgcggagttactctcgtttttgcct
JQ707580_PreC_P-A      acccttataaagaatttggggctactgcggagttactctcgtttttgcct
JQ707581_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707603_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707574_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707575_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707579_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707583_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707584_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707585_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707586_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707587_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707588_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707589_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707591_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707597_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707599_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707604_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707606_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707608_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707592_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707565_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707550_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707539_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707534_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB775198_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707559_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707560_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707561_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707562_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707564_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707566_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707567_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707568_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707569_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707570_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707571_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707572_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707573_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707601_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697493_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB775199_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB775200_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB775201_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB937792_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB937793_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB937794_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707531_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707532_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707533_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707535_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707536_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707537_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707538_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707540_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707541_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707542_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707543_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707544_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707545_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707546_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707547_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707548_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707549_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707552_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707553_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707554_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707556_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707557_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707558_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC430617_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC458430_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC458431_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC592168_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC592169_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC592170_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707555_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707634_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707623_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707620_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707612_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707609_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707610_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707611_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707613_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707614_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707616_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707617_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707618_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707619_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707621_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707622_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707624_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707625_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707626_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707627_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707628_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707629_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707630_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707631_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707632_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707637_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477467_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707635_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707615_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707633_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707636_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707638_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707639_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707640_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707641_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707642_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707643_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707644_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707645_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707646_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707647_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707648_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707649_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707650_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707651_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707652_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707653_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707654_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707656_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EF208113_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AJ309370_PreC_P-A      acccttataaagaatttggagctactgttgagttactctcgtttttgcct
AJ309369_PreC_P-A      acccttataaagaatttggagctactgttgagttactctcgtttttgcct
AJ309371_PreC_P-A      acccttataaagaatttggagctactgttgagttactctcgtttttgcct
GQ477490_PreC_P-A      acccttataaagaatttggagctactgtcgagttactctcgtttttgcct
GQ477465_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY152726_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116076_PreC_P-A      acccttataaagaatttggagctactgtgcagttactctcgtttttgcct
KP857061_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606653_PreC_P-A      acccttataaagaatttggagctactgcggagttactctcgtttttgcct
GQ477486_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcttttttgcct
EU185786_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185774_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857080_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MT448620_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AJ012207_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
X51970_PreC_P-A        acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF090841_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF440016_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185775_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859938_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF419534_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF419535_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857062_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606658_PreC_P-A      accattataaagaatttggagcttctgtggagttactctcgtttttgcct
KJ586809_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB126580_PreC_P-A      accctcataaagaatttggagctactgtggagttactctcgtttttgcct
KT749832_PreC_P-A      acccttataaagaatttggagctactgtggagttaatctcgtttttgcct
KX827297_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477468_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606688_PreC_P-A      acccttataaagaatttggagctactgccgagttactctcgtttttgcct
GQ477495_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcttttttgcct
KJ843172_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477463_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749836_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857058_PreC_P-A      acccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KM606742_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606692_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854709_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477496_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859934_PreC_P-A      acccttataaagaatttggagctaccgtggagttactctcgtttttgcct
DQ788725_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY233286_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcatttttgcct
AB697488_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB362931_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB222707_PreC_P-A      acccttataaagaatttggagctagtgtggagttactctcgtttttgcct
AB116078_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857063_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185787_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185789_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185765_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
L13994_PreC_P-A        acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477479_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY738140_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY738141_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY738139_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY738143_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY738142_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY603431_PreC_P-A      acccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603438_PreC_P-A      acccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603446_PreC_P-A      acccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603430_PreC_P-A      acccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603435_PreC_P-A      acccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603436_PreC_P-A      acccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603429_PreC_P-A      acccgtataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854708_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594384_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594386_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT448623_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
OK106253_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426097_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426096_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426095_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttatgcct
KX827298_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX827293_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749831_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606676_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843188_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843182_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707662_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ687533_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563557_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563550_PreC_P-A      acccttataaagaatttggagctactggggagttactctcgtttttgcct
GQ414522_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859944_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859939_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF537371_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB064314_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM282986_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY707087_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
V00866_PreC_P-A        acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ222208_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU747320_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707658_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707659_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707661_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707663_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707664_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707667_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707669_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707670_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707672_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707674_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707675_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707676_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707681_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707665_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC836834_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP274928_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT448622_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT448626_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
X70185_PreC_P-A        acccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426098_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507849_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC311242_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749844_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749843_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749839_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749838_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749829_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749824_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718093_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718087_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP274925_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606672_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606656_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843217_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843184_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC836831_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563558_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ184324_PreC_P-A      acccttataaagaatttggagctactctggagttactctcgtttttgcct
FJ349222_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859919_PreC_P-A      acccttataaagaatttggagctactgtggagttcctctcgtttttgcct
EU859912_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859898_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594388_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594387_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185746_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY862868_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY862867_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY603441_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM295796_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF536524_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF090840_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697511_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697491_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB205118_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116081_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB014370_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116077_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ687529_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606694_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606749_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606663_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606669_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606652_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749850_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843166_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843173_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843215_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
HE576988_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
Z35717_PreC_P-A        acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859956_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843218_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC074724_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC311241_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC311243_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606677_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606678_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606680_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606674_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606684_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606685_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606691_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843192_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843214_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843216_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ184323_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
HE576989_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY382410_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859942_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP274927_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749825_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749826_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749842_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749846_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749847_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749849_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859899_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859900_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859901_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859902_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859903_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859904_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859905_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859906_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859907_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859908_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859909_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859910_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859911_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859913_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859915_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859916_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859917_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859920_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859921_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859922_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859923_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859924_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859925_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859926_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859927_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859928_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749837_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594394_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594395_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM295795_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM295797_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM410963_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594383_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426094_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426099_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF090839_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594389_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594390_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594391_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594392_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859945_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859950_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854710_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM519454_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606648_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB480040_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY886219_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB480036_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606665_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606666_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116079_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116080_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB300367_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB453979_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB453980_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB453984_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB480038_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB480041_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697489_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697496_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697497_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697499_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697501_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697503_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697504_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697505_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697508_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697509_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697512_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB937798_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161138_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161139_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC517161_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH932713_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
X07911_PreC_P-A        acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859935_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859936_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB246337_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB246338_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB300366_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB453981_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB480039_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB549213_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697492_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697506_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697507_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF043580_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF297624_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY128092_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY233280_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU086721_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185750_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594385_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594393_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859914_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859918_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859929_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859930_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859931_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859932_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859933_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859937_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859940_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859941_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859943_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859946_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859947_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859948_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859949_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859951_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859953_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859954_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859955_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349224_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477461_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563546_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563553_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563554_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563555_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563562_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC836832_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC836849_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC836854_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843186_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606683_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606687_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606700_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606746_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749830_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749835_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749840_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605516_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605517_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605532_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY003230_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426093_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
Z72478_PreC_P-A        acccttataaagaatttggagctactgtggagttactctcgtttttgcct
FN545837_PreC_P-A      acccttataaagaatttggagcgactgtggagttactctcttttttgcct
MN585097_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcatttttgcct
FN545826_PreC_P-A      acccttataaagaatttggagctactgtggagttaatctcgtttttgcct
FJ692555_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcttttttgcct
FN545832_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcttttttgcct
FJ692597_PreC_P-A      acccttataaagaatttggagcttctgtggagttactctcttttttgcct
FN545828_PreC_P-A      acccttataaagaatttggcgctactgtagagttactctcttttttgcct
FN545839_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcttttttgcct
FN545829_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcttttttgcct
FN545835_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcttttttgcct
FN545830_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcttttttgcct
FN545840_PreC_P-A      acccttataaagagtttggagctactgtggagttactctcttttttgcct
MF536820_PreC_P-A      acccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536814_PreC_P-A      acccttataaagaatatggagataatgtggagttactctct